ABSTRACT
Due to its zootechnical importance, the gene encoding growth hormone (GH) from several fish species has been isolated and expressed in heterologous systems. In this study, we isolated the cDNA sequence of GH of tambaqui (Colossoma macropomum), a species native to the Amazon basin and considered promising for Brazilian fish farming, and expressed it in the yeast Komagataella phaffii GS115. Heterologous expression was regulated by the AOX1 promoter and recombinant tambaqui GH (rtGH) secreted to the culture supernatant via the alpha factor of Saccharomyces cerevisiae. The rtGH was successfully expressed in shaken flask and bioreactor systems and purified using affinity chromatography. In the bioreactor, the production reached 250 mg L-1. This is the first report of the heterologous expression, purification and production of rtGH in a bioreactor. Our results contribute to making tambaqui a target species for future biotechnological innovations based on the significant levels of rtGH obtained in the bioreactor and the future zootechnical applications of this protein, which can be exploited in aquaculture.
KEYWORDS:
somatotropic hormone; Amazonian fish; heterologous expression; shake flasks; bioreactor
RESUMO
Devido à sua importância zootécnica, o gene que codifica o hormônio de crescimento (GH) de diversas espécies de peixes tem sido isolado e expresso em sistemas heterólogos. Neste estudo, isolamos a sequência de cDNA do GH do tambaqui (Colossoma macropomum), espécie nativa da bacia amazônica e considerada promissora para a piscicultura brasileira, e a expressamos na levedura Komagataella phaffii GS115. A expressão heteróloga foi regulada pelo promotor AOX1 e GH de tambaqui recombinante (rtGH) foi secretado para o sobrenadante da cultura através do fator alfa de Saccharomyces cerevisiae. O rtGH foi expresso com sucesso em frascos agitados e sistemas de biorreatores e purificado por cromatografia de afinidade. No biorreator a produção atingiu 250 mg L-1. Este é o primeiro relato da expressão heteróloga, purificação e produção de rtGH em biorreator. Nossos resultados contribuem para tornar o tambaqui uma espécie alvo para futuras inovações biotecnológicas baseadas nos níveis significativos de rtGH obtidos no biorreator e nas futuras aplicações zootécnicas desta proteína, que pode ser explorada na aquicultura.
PALAVRAS-CHAVE:
hormônio somatotrópico; peixe amazônico; expressão heteróloga; frascos agitados; biorreator
INTRODUCTION
Genetic studies involving the search for and cloning and expression of genes that encode proteins associated with important physiological processes and advantageous characteristics from the zootechnical point of view have made biotechnological research increasingly promising. Due to its importance in medicine, veterinary and agricultural sciences, the gene encoding growth hormone (GH) of several vertebrate species, including fish, has been widely expressed in heterologous systems (Tsai et al. 1997Tsai, H.J.; Hsih, M.H.; Kuo, J.C. 1997. Escherichia coli-produced fish growth hormone as a feed additive to enhance the growth of juvenile black seabream (Acanthopagrus schlegeli). Journal of Applied Ichthyology 13: 79-82.; Anathy et al. 2001Anathy, V.; Venugopal, T.; Koteeswaran, R.; Pandian, T.J.; Mathavan, S. 2001. Cloning, sequencing and expression of cDNA encoding growth hormone from Indian catfish (Heteropneustes fossilis). Journal of biosciences 26: 315-324.; Acosta et al. 2007Acosta, J.; Morales, R.; Morales, A.; Alonso, M.; Estrada, M.P. 2007. Pichia pastoris expressing recombinant tilapia growth hormone accelerates the growth of tilapia. Biotechnology Letters 29: 1671-1676.; Sekar et al. 2014Sekar, M.; Singh, S.D.; Gupta, S. 2014. Cloning and characterization of Pangasianodon hypophthalmus growth hormone gene and its heterologous expression. Applied Biochemistry and Biotechnology 173: 1446-1468.) to produce a recombinant protein with preserved biological activity (Li et al. 2003Li, Y.; Bai, J.; Jian, Q.; Ye, X.; Lao, H.; Li, X.; Luo, J.; Liang, X. 2003. Expression of common carp growth hormone in the yeast Pichia pastoris and growth stimulation of juvenile tilapia (Oreochromis niloticus). Aquaculture 216: 329-341.; Funkenstein et al. 2005Funkenstein, B.; Dyman, A.; Lapidot, Z.; Jesus-Ayson, E.G.; Gertler, A.; Ayson, F.G. 2005. Expression and purification of a biologically active recombinant rabbitfish (Siganus guttatus) growth hormone. Aquaculture 250: 504-515.; Acosta et al. 2009Acosta, J.; Carpio, Y.; Ruiz, O.; Morales, R.; Martínez, E.; Valdés, J.; et al. 2009. Tilapia somatotropin polypeptides: potent enhancers of fish growth and innate immunity. Biotecnologia Aplicada 26: 267-272.).
GH is a polypeptide produced in the pituitary gland of all vertebrates (Moriyama 2016Moriyama, S. 2015. 15A-growth hormone. In: Takei Y.; Ando, H.; Tsutsui, K. (Ed.). Handebook of Hormones. 1st. ed. Academic Press, San Diego, p.110-e15A-5. ). In fish, its action includes the regulation of ions and lipids, osmotic balance, carbohydrate and protein metabolism, growth of soft and skeletal tissues, reproduction, immune functions, energy mobilization, gonadal development, appetite, social behavior and aging (Björnsson 1997Björnsson, B.T. 1997. The biology of salmon growth hormone: from daylight to dominance. Fish Physiology and Biochemistry 17: 9-24.; Bartke et al. 2021Bartke, A.; Hascup, E.; Hascup, K.; Masternak, M.M. 2021. Growth hormone and aging: new findings. The World Journal of Men’s Health 39: 454-465.). Several studies have shown that the cDNA of the GH in fish encodes a mature polypeptide with a high degree of conservation, whith length ranging from 178-191 amino acid residues and a secretion signal peptide of between 17-22 residues (Agellon and Chen 1986Agellon, L.B.; Chen, T.T. 1986. Rainbow trout growth hormone: molecular cloning of cDNA and expression in Escherichia coli. DNA 5: 463-471.; Akiko et al. 1988Akiko, S.; Susumu, S.; Yoshinori, K.; Moriyuki, S.; Tetsuya, H.; Seiga, I. 1988. Molecular cloning of eel growth hormone cDNA and its expression in Escherichia coli. Gene 73: 545-551.; Koren et al. 1989Koren, Y.; Sarid, S.; Ber, R.; Daniel, V. 1989. Carp growth hormone: molecular cloning and sequencing of cDNA. Gene 77: 309-315.; Rentier-Delrue et al. 1989Rentier-Delrue, F.; Swennen, D.; Mercier, L.; Lion, M.; Benrubi, O.; Martial, J.A. 1989a. Molecular cloning and characterization of two forms of trout growth hormone cDNA: expression and secretion of tGH-II by Escherichia coli. DNA 8: 109-117.a,bRentier-Delrue, F.; Swennen, D.; Philippart, J.C.; L’hoir, C.; Lion, M.; Benrubi, O.; et al. 1989b. Tilapia growth hormone: molecular cloning of cDNA and expression in Escherichia coli. DNA 8: 271-278.; Funkenstein et al. 1991Funkenstein, B.; Chen, T.T.; Powers, D.A.; Cavari, B. 1991. Cloning and sequencing of the gilthead seabream (Sparus aurata) growth hormone-encoding cDNA. Gene 103: 243-247.; Lemaire et al. 1994Lemaire, C.; Warit, S.; Panyim, S. 1994. Giant catfish Pangasianodon gigas growth hormone-encoding cDNA: cloning and sequencing by one-sided polymerase chain reaction. Gene 149: 271-276.; Pendón et al. 1994Pendón, C.; Martínez-Barberá, J.P.; Pérez-Sánchez, J.; Rodríguez, R.B.; Grenett, H.; Valdivia, M.M. 1994. Cloning of the sole (Solea senegalensis) growth hormone-encoding cDNA. Gene 145: 237-240.; Venugopal et al. 2002Venugopal, T.; Anathy, V.; Pandian, T.J.; Gong, G.Z.; Mathavan, S. 2002. Molecular cloning of growth hormone-encoding cDNA of an Indian major carp, Labeo rohita, and its expression in Escherichia coli and zebrafish. General and Comparative Endocrinology 125: 236-247.; Moriyama 2016Moriyama, S. 2015. 15A-growth hormone. In: Takei Y.; Ando, H.; Tsutsui, K. (Ed.). Handebook of Hormones. 1st. ed. Academic Press, San Diego, p.110-e15A-5. ; Lima et al. 2023Lima, E.R.; Freire, R.P.; Suzuki, M.F.; Oliveira, J.E.; Yosidaki, V.L.; Peroni, C.N.; et al. 2023. Isolation and characterization of the Arapaima gigas growth hormone (ag-GH) cDNA and three-dimensional modeling of this hormone in comparison with the human hormone (hGH). Biomolecules 13: 158. (https://doi.org/10.3390/biom13010158).
https://doi.org/10.3390/biom13010158...
). As it has a function that is comparable to natural GH, which is produced in the pituitary gland, this polypeptide can be used in studies that focus on physiology (Li et al. 2003) and improvement of zootechnical performance in fish (Acosta et al., 2007Acosta, J.; Morales, R.; Morales, A.; Alonso, M.; Estrada, M.P. 2007. Pichia pastoris expressing recombinant tilapia growth hormone accelerates the growth of tilapia. Biotechnology Letters 29: 1671-1676.), as growth manipulation is an important subject in aquatic biotechnology. The successful expression of gene encoding fish GH has been reported in prokaryotes [e.g., Escherichia coli Escherich, 1885 (Agellon and Chen 1986; Jeh et al. 1998Jeh, H.S., Kim, C.H., Lee, H.K., Han, K. 1998. Recombinant flounder growth hormone from Escherichia coli: overexpression, efficient recovery, and growth-promoting effect on juvenile flounder by oral administration. Journal of Biotechnology 60: 183-193.), Bacillus subtilis Cohn, 1872 (Ng Alan et al. 2016Ng, K.L.; Lam, C-C.; Kwong, K.W.Y.; Dik, D.W.N.; Lai, C.Y.; Au Yong, J.L-W.; Qian, P.; Wong, W.K. 2016. Enhancement of fish growth employing feed supplemented with recombinant fish growth hormone expressed in Bacillus subtilis. Research Journal of Biotechnology 11:1-11.) and cyanobacteria (Liu et al. 2008Liu, S.; Zhang, X.; Zang, X.; Liu, B.; Arunakumara, K.K.I.U; Xu, D.; Zhang, X. 2008. Growth, feed efficiency, body muscle composition, and histology of flounder (Paralichthys olivaceus) fed GH transgenic Synechocystis. Aquaculture 277: 78-82.)] and in eukaryotes [e.g., Saccharomyces cerevisiae Pasteur, 1856 (Piyaviriyakul et al. 2002Piyaviriyakul, P.; Panyim, S.; Eurwilaichitr, L. 2002. High intracellular expression of giant catfish growth hormone under the control of PGK promoter in Saccharomyces cerevisiae. World Journal of Microbiology & Biotechnology 18: 773-777.), algae (Chen et al. 2008Chen, H.L.; Li, S.S.; Huang, R.; Tsai, H.J. 2008. Conditional production of a functional fish growth hormone in the transgenic line of Nannochloropsis oculata (Eustigmatophyceae).Journal of Phycology 44: 768-776.), insect cells (Tsai et al. 1994Tsai, H.J.; Chen, H.M.; Lo, C.F. 1994. Secretory synthesis of active recombinant fish growth hormone by insect cells using a baculovirus vector. Canadian Journal of Fisheries and Aquatic Sciences 51: 1-7.) and transgenic fish such as the Atlantic salmon (Salmo salar Linnaeus, 1758) developed and marketed by the Canadian company AquAdvantage® (Du et al. 1992Du, S.J.; Gong, Z.; Fletcher, G.L.; Shears, M.A.; King, M.J.; Idler, D.R.; Hew, C.; 1992. Growth enhancement in transgenic Atlantic salmon by the use of an “all fish” chimeric growth hormone gene construct. Bio/technology 10: 176-181.)].
The methylotrophic yeast Komagataella phaffii Phaff, 1956 (formerly Pichia pastoris) has been successfully used as a heterologous eukaryotic gene expression system due to that (a) it has a high frequency of transformation by heterologous DNA; (b) transformation occurs by means of integrative vectors by homologous complementation directly in the cellular genome, which leads to greater genetic stability of recombinant cells; (c) it has high levels of intra or extracellular protein expression under the control of strong and inducible promoters, such as the AOX1, the promoter of the alcohol oxidase I enzyme gene; (d) the genetic manipulation and fermentative techniques are well establishe; (e) detailed information on the structures of N-linked oligosaccharides on secreted proteins; (f) the presence of post-translational modifications that are compatible with those found in superior eukaryotes; and (g) it is generally recognized as safe (GRAS) (Cregg et al. 1993Cregg, J.M.; Vedvick, T.S.; Raschke, W.C. 1993. Recent advances in the expression of foreign genes in Pichia pastoris. Bio/technology 11: 905-910.; Cereghino and Cregg 2000Cereghino, J.L.; Cregg, J.M. 2000. Heterologous protein expression in the methylotrophic yeast Pichia pastoris. FEMS Microbiology Reviews 24: 45-66.; Cereghino et al. 2002Cereghino, G.P.L.; Cereghino, J.L.; Ilgen, C.; Cregg, J.M. 2002. Production of recombinant proteins in fermenter cultures of the yeast Pichia pastoris. Current Opinion in Biotechnology 13: 329-332.), which allows its use in the production of proteins for use in aquaculture.
The tambaqui (Colossoma macropomum Cuvier, 2018) is a fish native to the Amazon basin with great economic importance as one of the most appreciated and consumed fish in northern Brazilian cuisine (Araújo-Lima and Goulding 1998Araújo-Lima, C.A.; Goulding, M. 1998. Os Frutos do Tambaqui: Ecologia, Conservação e Cultivo na Amazônia. Editora SCM, Tefé, 186p.; Morais and O’Sullivan 2017Morais, I.S.; O´sullivan, A.L.F. 2017. Biologia, habitat e cultivo do tambaqui Colossoma macropomum (CUVIER, 1816). Scientia Amazonia 6: 81-93.). It has characteristics that make it appropriate for farming, as well as an ample consumer market, standing out as the most produced native species in fish farming in Brazil (IBGE 2022IBGE. 2022. Instituto Brasileiro de Geografia e Estatística. Informações sobre Aquicultura no Brasil. ( (https://cidades.ibge.gov.br/brasil/pesquisa/18/16459?indicador=16512 ). Accessed on 27 Jan 2024.
https://cidades.ibge.gov.br/brasil/pesqu...
). For this reason, tambaqui has become the focus of extensive research efforts regarding feeding and reproductive management (Melo et al. 2001Melo, L.A.S.; Izel, A.C.U.; Rodrigues, F.M. 2001. Criação de Tambaqui (Colossoma macropomum) em Viveiros de Argila/Barragens no Estado do Amazonas. Documentos Embrapa #18. ( (https://www.infoteca.cnptia.embrapa.br/bitstream/doc/668979/1/Doc18.pdf ). Accessed on 27 Jan 2024.
https://www.infoteca.cnptia.embrapa.br/b...
; Izel et al. 2013Izel, A.C.U, Melo, L.A.S. 2004. Criação de tambaqui (Colossoma macropomum) em tanques escavados no Estado do Amazonas. Documentos Embrapa #32. ( (https://www.infoteca.cnptia.embrapa.br/infoteca/bitstream/doc/674621/1/Doc32.pdf ). Accessed on 27 Jan 2024.
https://www.infoteca.cnptia.embrapa.br/i...
; Morais and O’Sullivan 2017). Studies include the evaluation of the effects of different nutritional constituents and probiotics combined with food management on physiological and zootechnical responses (Pereira Junior et al. 2013Pereira Junior, G.P.; Pereira, E.M.O.; Filho, M.P.; Barbosa, P.S.; Shimoda, E.; Brandão, L.V. 2013. Desempenho produtivo de juvenis de tambaqui (Colossoma macropomum CUVIER, 1818) alimentados com rações contendo farinha de crueira de mandioca (Manihot esculenta, Crantz) em substituição ao milho (Zea mays). Acta Amazonica 43: 217-226.; Sandre et al. 2017Sandre, L.C.G.; Buzollo, H.; Nascimento, T.M.T.; Neira, L.M.; Jomori, R.K.; Carneiro, D.J. 2017. Productive performance and digestibility in the initial growth phase of tambaqui (Colossoma macropomum) fed diets with different carbohydrate and lipid levels. Aquaculture Reports 6: 28-34.; Sadalla-Pinto et al. 2021Sadalla-Pinto, E.A.; Liebl, A.R.S.; Nascimento, M.S.; Flor, N.S.; Aride, P.H.R.; Oliveira, A.T. 2021. Nutrição e manejo alimentar de peixes amazônicos. In: Mattos, B.O.; Pantoja-Lima, J.; Oliveira, A.T.; Aride, P.H.R. (Org.). Aquicultura na Amazônia: Estudos Técnico-Científicos e Difusão de Tecnologias. Atena Editora, Ponta Grossa, p.177-197.).
The present study aimed to isolate the cDNA sequence of the tambaqui growth hormone (tGH) from the pituitary gland and part of the brain of juvenile tambaqui and to use this sequence for extracellular expression in the K. phaffii phenotypes Mut+ and Muts and the subsequent purification of the recombinant protein secreted (recombinant tambaqui GH, rtGH) in the culture supernatant, as well as its production in a bioreactor system.
MATERIAL AND METHODS
Strains, vector and culture media
The strain E. coli DH10B, used for plasmid propagation, was obtained from New England BioLabs (NEB®). The yeast strain K. phaffii GS115 and the vector pPIC9 were obtained from Invitrogen®. Luria-Bertani medium (LB) was prepared according to the description in the molecular cloning manual (Sambrook and Russell 2001Sambrook, J.; Russell, D.W. 2001. Molecular cloning: a laboratory manual. 3rd ed. Cold Spring Harbor Laboratory Press, New York, 2100p.). Buffered glycerol-complex media (BMGY), buffered methanol-complex media (BMMY), minimal dextrose media (MD) and minimal methanol (MM) were prepared as described in the instruction manual of the Invitrogen® Pichia expression kit. The FM22 basal salts medium was prepared with the following components: KH2PO4 42.9 g L-1, (NH4)SO4 5 g L-1, CaSO4.2H2O 1.0 g L-1, K2 SO4 14.3 g L-1, MgSO4.7H2O 11.7 g L-1, glycerol 80 g L-1 and PTM4 1 mL L-1. The mixture was completed with distilled water and the pH adjusted to 5.0 with KOH. The PMT4 trace element solution was prepared with CuSO4.5H2O 2.0 g L-1, NaI 0.08 g L-1, MnSO4.H2O 3.0 g L-1, Na2MoO4.2H2O 0.2 g L-1, H3BO3 0.02 g L-1, CaSO4.2H2O 0.5 g L-1, CoCl2 0.5 g L-1, ZnCl2 7 g L-1, FeSO4.7H2O 22 g L-1, biotin 0.2 g L-1 and [H2SO4] 1 mL. The PMT4 solution was also added to methanol as a supplement (at a concentration of 4 mL L-1).
tGH cDNA acquisition from transcriptome
The tGH cDNA sequence was obtained from a cDNA library. Total RNA was extracted using the guanidine isothiocyanate method and using the TRIZOL kit (Invitrogen®) according to the manufacturer’s recommendations. The poly(A)+ fraction (containing mRNAs) was isolated via centrifugal affinity chromatography in an oligo(dT)-cellulose column, using the FastTrack 2.0 kit (Invitrogen®). The cDNA library of the pituitary tissues and part of the brain of 12 juvenile tambaqui of approximately 15 cm length each (obtained from the fish farming station at the National Institute for Amazonian Research - INPA in its acronym in Portugues) was built following the protocol of the SuperScript® Plasmid System and using the Gateway® Technology for cDNA Synthesis and Cloning Kit. The vector used for cloning the fractionated cDNA fragments was pCMVSPORT6-SuperScript™ (Invitrogen®). To obtain the fragments corresponding to tGH, the following GHP-F primers were used: TCAGACAACCAGCGGCTCTTC and GHP-R: CAGGGTGCAGTTGGAATCCAG (Pinheiro et al. 2008Pinheiro, J.S.; Wolff, J.L.C.; Araújo, R.C.; Hilsdorf, A.W.S. 2008. Molecular cloning and sequence analysis of growth hormone cDNA of Neotropical freshwater fish pacu (Piaractus mesopotamicus). Genetics and Molecular Biology 31: 381-384.). The PCR-amplified products were sequenced using the method of Sanger et al. (1977Sanger, F.; Nicklen, S.; Coulson, A.R. 1977. DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences 74: 5463-5467.) and were then compared with GH sequences of fish species already described. The consensus of all the sequences obtained served as the basis for the chemical synthesis of the open reading frame (ORF) of the tGH.
Design and synthesis of tGH ORF
The cDNA sequence of the tGH was adapted with the use of preferential codons from K. phaffii and the reduction of the high content of adenine-thymine (AT) in the native sequence. In this step, we used the software Blast (https://blast.ncbi.nlm.nih.gov/Blast.cgi), Oligocalc (http://biotools.nubic.northwestern.edu/OligoCalc.html), NEBcutter® V2.0 (https://nc3.neb.com/NEBcutter/), ExPASy (https://www.expasy.org/), ProtParam (https://protparam.net/index.html), NetNGlyc 1.0 Server (https://services.healthtech.dtu.dk/services/NetNGlyc-1.0/) and NetOGlyc 3.1 Server (https://www.hsls.pitt.edu/obrc/index.php?page=URL1043959855), which are available online. The adapted sequence was obtained via chemical synthesis and cloned into the pUC19 vector by GenOne Biotechnologies Ltd. (Rio de Janeiro, RJ, Brazil). Restriction sites for the EcoRI and NotI enzymes flanking the synthetic sequence were added. Flanking the START Codon, the sequence Kozak ACCATGG was added to confer greater efficiency at the start of the translation. Histidine tail codons were inserted in the 3’ region for confirmation and purification of the expressed protein.
pPIC-tGH expression plasmid acquisition
The synthetic sequence of the tGH gene and the pPIC9 vector were digested with the enzymes EcoRI and NotI and were purified and linked by the enzyme T4-DNA ligase (NEB®). Escherichia coli DH10B cells were transformed with the recombinant plasmid pPIC-tGH, and the selected colonies were obtained via colony PCR to confirm the transformants containing the tGH gene sequence. For this, the primers 5’AOX1-forward 5´-GACTGGTTCCAATTGACAAGC-3´ and 3’AOX1-reverse 5´-GCAAATGGCATTCTGACATCC-3´ (Invitrogen®) were used. The colonies selected for PCR were resuspended in 5 µL of water. PCR conditions were as follows: 1 µL of cells, 1x Taq DNA polymerase enzyme buffer, 1.5 mM MgCl2, 0.3 mM dNTPs, 5 pmol of each primer, 1.5 U Taq DNA enzyme (NEB®), 2 minutes at 95°C, followed by 25 cycles of 94°C for 40 seconds, 62°C for 40 seconds, 72°C for 1 minute and a final extension at 72°C for 5 minutes. The resulting products were analyzed in 0.8% agarose gel stained with ethidium bromide 0.5 µg mL-1 and visualized under UV light.
Transformation of K. phaffii and phenotype determination
The pPIC-tGH recombinant plasmid was linearized with BglII and used to transform K. phaffii GS115 via electroporation (1900 V, Electroporator 2510 Eppendorf, 1.0 mm cuvette). The transformants were selected in MD medium and the colonies were visible after 2-3 days of incubation at 30 ºC. For the Mut+ and Muts phenotypic determination, the transformants were seeded in MM medium and identified according to their growth capacity in methanol as the sole carbon source, following the manufacturer’s instructions (Invitrogen®).
tGH gene expression in shaken flasks
Komagataella phaffii GS115/pPIC-tGH transformants of both the Mut+ and Muts phenotypes selected for tGH gene expression were inoculated in 25 mL of BMGY medium and incubated for 16-20 hours at 30 ºC under shaking at 250 rpm until the culture reached an optical density at 600 nm (OD600) of between 2-6. The cultures were then centrifuged for 10 minutes at 4,000 g at 4 ºC and the pellets were inoculated in 100 mL of BMMY in 500 mL flasks and incubated for 96 hours at 30 ºC under shaking at 250 rpm. Absolute methanol was added to the culture every 24 hours to a final concentration of 0.5 % (v/v). Samples of the cultures were collected and preserved at -80 ºC for further analysis via SDS-PAGE and Western blotting.
Analysis of rtGH
Samples of supernatants from the expression were precipitated with 10% TCA and resuspended in 1x sample buffer for SDS-PAGE (200 mM Tris pH 6.8; 0.1% bromophenol blue (w/v); 4% SDS (v/v); 4% β-mercaptoethanol; 20% glycerol (v/v)). The samples were loaded into a mini gel SDS-PAGE system (BioRad), according to the methodology of Sambrook and Russell (2001Sambrook, J.; Russell, D.W. 2001. Molecular cloning: a laboratory manual. 3rd ed. Cold Spring Harbor Laboratory Press, New York, 2100p.). After the electrophoretic run, the proteins were stained with Coomassie brilliant blue R-250 overnight and transferred to a nitrocellulose membrane in a semi-dry transfer system (Trans-Blot®SD, Semi-Dry Transf Cell, Bio-Rad). For the development of the Western blot, the C-terminal anti-His-tag primary antibody was used at a dilution of 1:5000 (v/v) (Life Technologies, catalog: 46-0693) along with the WesternBreeze® Chromogenic Western Blot Immunodetection kit, following the manufacturer’s instructions (Invitrogen®).
Purification of rtGH
After induction by methanol for 96 hours, samples of the supernatant of K. phaffii GS115/pPIC-tGH phenotype Mut+ were purified via affinity chromatography (Akta Purifier system, GE Healthcare), using the commercial column His Trap HP 5 mL (GE Healthcare), previously equilibrated with buffer A (50 mM NaH2PO4, 300 mM NaCl, 10% glycerol (v/v)). The rtGH was eluted with buffer B (buffer A with 500 mM imidazole) in the linear gradient from 0 to 100% at a flow of 2 mL per minute. The fractions collected were analyzed via SDS-PAGE.
rtGH production in bioreactor
The cell mass of K. phaffii GS115/pPIC-tGH/Mut+ grown in BMGU was inoculated in FM22 medium containing glycerol 80 g L-1 for biomass formation in a mechanically agitated and instrumented bioreactor (BIOSTAT B, B. Braun Biotech International), with real-time monitoring sensors of pH, temperature and dissolved oxygen (DO), coupled to a vessel with a capacity of 4 L and a working volume of 3 L. The pH of the medium was adjusted to 5.0 using 28% ammonium hydroxide solution, temperature 30 ºC, aeration 5-18 L min-1, DO at over 20% saturation and shaking between 50 and 1,000 rpm. Antifoam (polypropylene oxide) was added to eliminate excess foam. The bioreactor operated in single batch mode until the glycerol was fully consumed (about 26 hours), followed by a period of starvation (60-90 min) for consumption of any glycerol residues and inhibitors of heterologous expression. After this period, induction of gene expression was initiated with 7.5 g L-1 of methanol containing PTM4, increasing to 15 g L-1 after the second pulse at intervals of approximately 3 hours. Throughout the fermentation, the supernatant samples were collected to quantify the rtGH. Cell biomass was quantified by means of a standard curve that indicated optical density and cell concentration (X) in dry weight, which, after linear adjustment, provided the following equation: X (g L-1) = 0.27 • OD600. Optical density was measured with a spectrophotometer (Shimadzu, UV 1601). The bioprocess lasted 80 hours. The determination of glycerol and methanol was performed by high performance liquid chromatography (HPLC) using a Shimadzu liquid chromatograph that was equipped with Hi-Plex H column (100 mm x 7.7 mm) and refractive index detector (RID). The temperature was maintained at 60°C, and a 5 mM sulfuric acid solution was used as the mobile phase. The volume of the injected sample was 0.5 mL.
Quantification of rtGH
The amount of rtGH secreted into the supernatant was determined using the immunodetection method and the 96-well Cell Biolabs His-tag Protein ELISA kit, as recommended by the manufacturer. The microplate reading was at 450 nm and the rtGH concentration was quantified by means of a standard curve generated with the C-terminal His-tag Rhotekin RBD protein (10 kDa) of a known concentration, which was provided by the kit.
RESULTS
Acquisition of tGH cDNA, comparison with other species and translational alignment
From the PCR A fragments of approximately 536 bp was obtained from the transcriptome of the pituitary and brain tissue. The sequencing of the fragment revealed it to be the cDNA of mature tambaqui GH. The comparative analysis of the predicted amino acid sequence had 100% identity with the tGH sequence deposited by Souza et al. (2016Souza, C.J.H.; Benavides, M.V.; Melo, E.O. 2016. Caracterização molecular do hormônio do crescimento do tambaqui (Colossoma macropomum). Embrapa Pesca e Aquicultura. Boletim de Pesquisa e Desenvolvimento #12, 15p. ( (https://www.infoteca.cnptia.embrapa.br/infoteca/handle/doc/1072736 ). Accessed on 27 Jan 2024.
https://www.infoteca.cnptia.embrapa.br/i...
) (GenBank accession # ANG09167.1), as well as high similarity with GH sequences from other teleost species (Table 1). Translational analysis of the tGH sequence revealed a polypeptide of 186 amino acid residues including the five conserved cysteine residues responsible for the formation of the disulfide bridges that are essential for maintaining the structural integrity and biological activity of the molecule (Chang et al. 1992Chang, Y.S.; Liu, C.S.; Huang, F.L.; Lo, T.B. 1992. The primary structures of growth hormones of three cyprinid species: bighead carp, silver carp, and grass carp. General and Comparative Endocrinology 87: 385-393.) and two N-glycosylation sites at positions 125 and 177 (Figure 1). The predicted molecular mass for non-glycosylated rtGH was 21.5 kDa, including the histidine tail.
Acquisition of the cDNA of mature GH from tambaqui. Comparative analysis (BlastX) of the predicted amino acid sequence of the cDNA of tambaqui GH obtained in this study (see Figure 1) with GH amino acid sequences deposited in GenBank.
Predicted amino acid sequence of tambaqui GH. Translational alignment of tambaqui cDNA adapted for expression in Komagataella phaffii. Gray highlight indicates the existence of two signal sites for N-glycosylation, five cysteine residues and the restriction sites in 5’-EcoRI and 3’-NotI. Also highlighted are the 5’- Kozak sequence and the histidine tail in the C-terminal region.
pPIC-tGH acquisition and expression in K. phaffii
The cloning of the synthetic sequence of the tGH gene in the pPIC9 vector (Figure 2a) and the purification of the pPIC9 vector, the insertion of the tGH gene (Figure 2b), and the transformation of the PCR of ten colonies with the pPIC-tGH recombinant plasmid (Figure 2c) were successfully performed.
Acquisition of the pPIC-tGH vector for tambaqui GH expression in Komagataella phaffii. Electrophoretic profiles in 0.8% agarose gel. A - double digestion of the pUC-tGH vector and pPIC9 with the enzymes EcoRI and NotI, L: 1KB molecular mass marker (Promega), well 1: digested pUC-tGH plasmid; B - purification of pPIC9 vector and tGH gene insert, well 1: purified tGH gene insert; well 2: linearized and purified pPIC9 vector, well 3: non-linearized pPIC9 vector; C - PCR of Escherichia coli DH10B colony transformed with the product of linkage between synthetic tGH gene sequence and pPIC9 vector, L: 1 kb molecular mass marker (Promega), wells 1 and 6-9: E. coli DH10B/pPIC-tGH transformant, wells 2-5 and 10: E. coli DH10B/pPIC9 transformant, well 11: negative PCR control. The bands of wells 1 and 6-9 have 1078 bp (corresponding to the 586 bp tGH gene insert + 492 bp pPIC9 vector signal peptide coding region).
The rtGH (~23 kDa) was secreted to the extracellular medium in both the phenotypes Mut+ and Muts, starting at 24 hours until 96 hours (Figure 3). Western blotting analysis confirmed the presence of rtGH in the supernatant of cultures of K. phaffii GS115/pPIC-tGH of both the phenotypes Mut+ and Muts, in the induction intervals from 24 to 96 hours (Figure 4).
Expression of rtGH in Komagataella phaffii. Electrophoretic profiles of SDS-PAGE 15% gel proteins of rtGH expression. A - K. phaffii GS115/pPIC-tGH Mut+, wells 1-5: methanol induction times of 0 h, 24 h, 48 h, 72 h and 96 h, L: Unstained Protein Ladder PageRuler marker (Fermentas), well 6: human GH isoform 20 kDa (kindly provided by Cristália-Produtos Químicos Farmacêuticos, São Paulo, Brazil), wells 7-9: times 0 h, 48 h and 96 h of the C- (GS115/pPIC9/Mut+, negative control); B - K. phaffii GS115/pPIC-tGH Muts, wells 1-5: methanol induction times of 0 h, 24 h, 48 h, 72 h and 96 h, L: Unstained Protein Ladder PageRuler marker (Fermentas), well 6: 20 kDa human GH isoform, wells 7-9: times 0 h, 48 h and 96 h of the C- (GS115/pPIC9/Mut+, negative control).
Western blotting analysis of rtGH expression. A - Komagataella phaffii GS115/pPIC-tGH Mut+, wells 1-5: methanol induction times of 0 h, 24 h, 48 h, 72 h and 96 h, L: molecular mass marker ColorPlus Prestained Protein Ladder, broad range of 10-230 kDa (New England BioLabs); B - K. phaffii GS115/pPIC-tGH Muts, wells 1-5: methanol induction times of 0 h, 24 h, 48 h, 72 h and 96 h, L: molecular mass marker ColorPlus Pretained Protein Ladder, broad range of 10-230 kDa (New England BioLabs), C-: negative control (GS115/pPIC9/Mut+) with 72 h induction.
Purification of rtGH
The rtGH was purified directly from the culture supernatant of K. phaffii GS115 pPIC-tGH Mut+ induced with methanol for 72 hours. Elution occurred in the gradient of approximately 20% imidazole (100 mM) (Figure 5). The existence of three purified bands may be related to the existence of rtGH isoforms.
Purification of rtGH expressed by Komagataella phaffii. A - rtGH purification chromatogram obtained from the supernatant of the induced culture of K. phaffii GS115/pPIC-tGH/Mut+. The red arrow indicates the peak elution of rtGH with 20% imidazole (100 mM); B - electrophoretic profile of proteins on SDS-PAGE 15% gel of the rtGH elution fractions from the chromatographic column. Well 1: crude extract of the culture supernatant, L: protein molecular mass marker (Thermo Scientific Spectra Multicolor Broad Range Protein Ladder), wells 2, 3, 4 and 5: elution fractions 8, 7, 6 and 5, respectively.
rtGH production in bioreactor
The fermentation for the production of rtGH was successfully conducted in a total time of 80 hours. The specific growth rate in glycerol was 0.216 h-1. The dry cell mass achieved after total glycerol consumption was 31.5 g L-1 in 28 hours. During the induction phase, the specific growth rate in methanol was reduced to 0.0172 h-1. The dry cell mass achieved in methanol was 62.8 g L-1 in 52 hours of induction. The rtGH was detected in the culture medium from the first 6 hours of induction and its concentration continued with a linear growth until the end of fermentation, reaching a peak production of 250.7 mg L-1 in 80 hours (Figure 6a). Overall, there was low pH variation due to the addition of ammonium hydroxide throughout the culture, yet there was a marked variation in the saturation level of DO, from zero to peaks of ≅ 95% (Figure 6b).
Kinetic profile of rtGH production by Komagataella phaffii in FM22 culture medium. The system was operated in a batch fed by pulses in a mechanically agitated bioreactor. A - variation of cell concentration (X), glycerol, methanol and rtGH; B - variation of dissolved oxygen and pH.
DISCUSSION
The cDNA sequence of tambaqui GH was successfully obtained from the pituitary and part of the brain of juvenile tambaqui. This sequence was adapted for extracellular expression in the yeast K. phaffii GS115. During the adaptation of the sequence, the AT content was reduced from over 65% to 58% and the preferential codons of K. phaffii were used. These were decisive steps for the success of heterologous expression, since in the attempts at expression of the native cDNA we were unsucessful (data not shown). The high AT content (> 65%) of the tGH cDNA sequence is consistent with reports in the literature that sequences with an AT content above 60% are associated with low levels of expression or no gene expression in the K. phaffii system due to premature termination of transcription of the RNA in formation (Boettner et al. 2007Boettner, M.; Steffens, C.; Mering, C.; Bork, P.; Stahl, U.; Lang, C. 2007. Sequence-based factors influencing the expression of heterologous genes in the yeast Pichia pastoris - A comparative view on 79 human genes. Journal of Biotechnology 130: 1-10.).
The 100% identity between the gene sequence described in here and the sequence deposited in GenBank (Souza et al. 2016Souza, C.J.H.; Benavides, M.V.; Melo, E.O. 2016. Caracterização molecular do hormônio do crescimento do tambaqui (Colossoma macropomum). Embrapa Pesca e Aquicultura. Boletim de Pesquisa e Desenvolvimento #12, 15p. ( (https://www.infoteca.cnptia.embrapa.br/infoteca/handle/doc/1072736 ). Accessed on 27 Jan 2024.
https://www.infoteca.cnptia.embrapa.br/i...
) demonstrated the reliability of our results. This high similarity is related to that the GH coding region tends to be highly conserved among different vertebrate groups, therefore the GH gene has been used to evaluate evolutionary relationships among fish at different taxonomic levels (Meier et al. 2006Meier, K.M.; Castaño, C.S.; Laurino, J.P.; Sabaj, J.A.L.; Marins, L.F.F. 2006. cDNA cloning and phylogenetic analysis of growth hormone genes from the mullet Mugil platanus (Mugilomorpha, Mugilidae) and the halfbeak Hemiramphus brasiliensis (Atherinomorpha, Hemiramphidae). Atlântica (Rio Grande) 28: 97-102.; Bart et al. 2010Bart, H.L.; Reneau, P.C.; Doosey, M.H.; Bell, C.D. 2010. Evolutionary divergence of duplicate copies of the growth hormone gene in suckers (Actinopterygii: Catostomidae). International Journal of Molecular Sciences 11: 1090-1102.; Kamenskaya and Brykov 2020Kamenskaya, D.N.; Brykov, V.A. 2020. Fish growth hormone genes: structure and divergence. Russian Journal of Marine Biology 46: 233-242.). In our analysis of the amino acid sequence, tGH showed high amino acid similarity with the GH of other teleost fish species, such as Cypriniformes, Siluriformes and Characiformes.
SDS-PAGE and Western blotting analyses confirmed the presence of rtGH in the culture supernatant starting from the first 24 h until 96 h of induction. The rtGH was well secreted into the extracellular medium due to the signal peptide alpha factor of S. cerevisiae present in the vector pPIC9. The efficient secretion in the K. phaffii system represents an important advantage in the heterologous production of GHs of fish by facilitating its detection and subsequent purification (Cregg et al. 1993Cregg, J.M.; Vedvick, T.S.; Raschke, W.C. 1993. Recent advances in the expression of foreign genes in Pichia pastoris. Bio/technology 11: 905-910.; Cereghino and Cregg 2000Cereghino, J.L.; Cregg, J.M. 2000. Heterologous protein expression in the methylotrophic yeast Pichia pastoris. FEMS Microbiology Reviews 24: 45-66.; Cereghino et al. 2002). Due to the GRAS status of K. phaffii, the rtGH expressed by it can be used in aquaculture. Several studies have already demonstrated that the use of yeast in fish feed increases digestibility (El-Bab et al. 2022El-Bab, A.F.F; Saghir, S.A.M.; El-Naser, I.A.A; El-Kheir, S.M.M.A.; Abdel-Kader, M.F.; Alruhaimi, R.S.; et al. 2022. The effect of dietarySaccharomyces cerevisiaeon growth performance, oxidative status, and immune response of sea bream (Sparus aurata). Life12: 1013. (https://doi.org/10.3390/life12071013).
https://doi.org/10.3390/life12071013...
), feed efficiency and immunological resistance (Li and Gatlin 2004Li, P.; Gatlin, D.M. 2004. Dietary brewers yeast and the prebiotic Grobiotic™AE influence growth performance, immune responses and resistance of hybrid striped bass (Morone chrysops x M. saxatilis) to Streptococcus iniae infection. Aquaculture 231: 445-456.; El-Bab et al. 2022), feed conversion and productive performance (Ozório et al. 2012Ozório, R.O.A.; Portz, L.; Borghesi, R.; Cyrino, J.E.P. 2012. Effects of dietary yeast (Saccharomyces cerevisiae) supplementation in practical diets of tilapia (Oreochromis niloticus). Animals 2: 16-24.; El-Bab et al. 2022), in addition to serving as a source of vitamins (Zhang et al. 2019Zhang, R.; Jiang, Y.; Zhou, L.; Chen, Y.; Wen, C.; Liu, W.; Zhou, Y. 2019. Effects of dietary yeast extract supplementation on growth, body composition, non-specific immunity, and antioxidant status of Chinese mitten crab (Eriocheir sinensis).Fish & Shellfish Immunology 86:1019-1025.).
The difference between the predicted molecular mass (21.5 kDa) and the equivalent band obtained in electrophoretic migration (~23 kDa) suggests the hypothesis of the occurrence of glycosylation in the recombinant protein, given the existence of two glycosylation sites in the molecule. The bands surrounding rtGH, observed both in Western blotting and purification, corroborate this hypothesis. In K. phaffii, approximately 0.5 to 1% of translated proteins are glycoproteins (Bretthauer and Castellino 1999Bretthauer, R.K.; Castellino, F.J. 1999. Glycosylation of Pichia pastoris-derived proteins. Biotechnology and applied biochemistry 30: 193-200.; Daly and Hearn 2005Daly, R.; Hearn, M.T.W. 2005. Expression of heterologous proteins in Pichia pastoris: a useful experimental tool in protein engineering and production. Journal of Molecular Recognition: An Interdisciplinary Journal 18: 119-138.). Glycosylation can increase the resistance of the protein against proteolytic degradation (Pratap et al. 2000Pratap, J; Rajamohan, G; Dikshit, K.L. 2000. Characteristics of glycosylated streptokinase secreted from Pichia pastoris: enhanced resistance of SK to proteolysis by glycosylation. Applied microbiology and biotechnology 53: 469-475.), assist in correcting folding and passage through the secretory pathway, and also increase the stability of the mature protein (Daly and Hearn 2005). The majority of heterologous N- or O-glycosylated proteins expressed in K. phaffii preserved the bioactivity found in the native non-glycosylated protein (Li et al. 2007Li, P.; Anumanthan, A.; Gao, X.G.; Ilangovan, K.; Suzara, V.V.; Düzgüneş, N.; Renugopalakrishnan, V. 2007. Expression of recombinant proteins in Pichia pastoris. Applied Biochemistry and Biotechnology 142: 105-124.). The occurrence of glycosylation has also been reported for human GH produced in K. phaffii, which has preserved the pharmacological effect and prolonged the half-life in the circulatory system of rats by a factor of 24 compared to the natural non-glycosylated variant (Flintegaard et al. 2010Flintegaard, T.V.; Thygesen, P.; Rahbek-Nielsen, H.; Levery, S.B.; Kristensen, C.; Clausen, H.; Bolt, G. 2010. N-glycosylation increases the circulatory half-life of human growth hormone. Endocrinology 151: 5326-5336.). These results demonstrate a positive aspect of glycosylation and make the expression of tGH in yeast even more promising for use in fish farming.
Our results showed that chromatography is a viable method for obtaining purified rtGH, which can be used in future biological activity assays, since the presence of the His-tag tail does not alter the biological activity of recombinant GHs (Doozandeh-Juibari et al. 2019Doozandeh-Juibari, A.; Ghovvati, S.; Vaziri, H.R.; Sohani, M.M.; Pezeshkian, Z. 2019. Cloning, expression, purification and evaluation of the biological properties of the recombinant human growth hormone (hGH) inEscherichia coli. International Journal of Peptide Research and Therapeutics 26: 487-495.). Recombinant growth hormones (rGH), which are isolated from host cell pellets, have been tested for their physiological effects and efficiency in the zootechnical performance of fish (Tsai et al. 1997Tsai, H.J.; Hsih, M.H.; Kuo, J.C. 1997. Escherichia coli-produced fish growth hormone as a feed additive to enhance the growth of juvenile black seabream (Acanthopagrus schlegeli). Journal of Applied Ichthyology 13: 79-82.; Jeh et al. 1998Jeh, H.S., Kim, C.H., Lee, H.K., Han, K. 1998. Recombinant flounder growth hormone from Escherichia coli: overexpression, efficient recovery, and growth-promoting effect on juvenile flounder by oral administration. Journal of Biotechnology 60: 183-193.; Li et al. 2003Li, Y.; Bai, J.; Jian, Q.; Ye, X.; Lao, H.; Li, X.; Luo, J.; Liang, X. 2003. Expression of common carp growth hormone in the yeast Pichia pastoris and growth stimulation of juvenile tilapia (Oreochromis niloticus). Aquaculture 216: 329-341.; Funkenstein et al. 2005Funkenstein, B.; Dyman, A.; Lapidot, Z.; Jesus-Ayson, E.G.; Gertler, A.; Ayson, F.G. 2005. Expression and purification of a biologically active recombinant rabbitfish (Siganus guttatus) growth hormone. Aquaculture 250: 504-515.). However, purification of rGH is not economically viable for use in commercial cultivation (Liu et al. 2008Liu, S.; Zhang, X.; Zang, X.; Liu, B.; Arunakumara, K.K.I.U; Xu, D.; Zhang, X. 2008. Growth, feed efficiency, body muscle composition, and histology of flounder (Paralichthys olivaceus) fed GH transgenic Synechocystis. Aquaculture 277: 78-82.). The extracellular production of rtGH in K. phaffii facilitates the use of this hormone in fish farming without the need for purification. The only study on the physiological effects of exogenous GHs on tambaqui used the commercial bovine GH (bGH) Lactotropin@ and demonstrated a significant weight gain in the first 15 days of fish treatment (Paz and Val 2018Paz, A.L.; Val, A.L. 2018. Manipulation of growth of the Amazonian fish tambaqui, Colossoma macropomum (Characiformes: Serrasalmidae): analysis of physiological and zootechnical aspects. Acta Amazonica 48: 197-206.). However, the use of commercial bGH is impracticable for fish farming, both due to its high cost and that it is a hormone from another vertebrate class. With our study, it will be possible to carry out new studies using rtGH to evaluate the physiological and zootechnical performance of tambaqui subjected to the recombinant hormone with a focus on fish farming.
The good results obtaind for the heterologous production of rtGH in the bioreactor have room for improvement. The optimization of the production levels of heterologous proteins in K. phaffii depend on genetic factors, such as the native cDNA sequence, preferred codons and number of copies of the expression cassette integrated into the yeast genome, and physical, chemical and physicochemical parameters of the system, such as temperature, pH, inducer concentration and oxygen (Cregg et al. 1993Cregg, J.M.; Vedvick, T.S.; Raschke, W.C. 1993. Recent advances in the expression of foreign genes in Pichia pastoris. Bio/technology 11: 905-910.; Brabander et al. 2023Brabander, P.D.; Uitterhaegen, E; Delmulle, T; Winter, K.D.; Soetaert, W. 2023. Challenges and progress towards industrial recombinant protein production in yeasts: a review. Biotechnology Advances 64, 108121. (https://doi.org/10.1016/j.biotechadv.2023.108121).
https://doi.org/10.1016/j.biotechadv.202...
). In our system, the preferred codon parameters, temperature, pH and methanol concentration were maintained in the ranges considered optimal, which reflected in the significant production of rtGH. However, the specific growth rates, both in glycerol (0.216 h-1) and methanol (0.0172 h-1), were lower than the values recorded in the literature for the K. phaffii system (0.24 h-1 and 0.14 h-1, respectively; Stratton et al. 1998Stratton, J.; Chiruvolu, V.; Meagher, M. 1998. Methods in molecular biology. In: Higgins, D.R.; Cregg, J.M. (Ed.). Pichia Protocols. Humana Press, Totowa, p.107-120.), indicating the need to adjust the system, especially in relation to the oxygen supply. The abrupt variations of dissolved oxygen were due to the high cell density that avidly consumed oxygen. When the methanol was depleted, the oxygen concentration increased to near saturation, but, as soon as the bioreactor was fed with methanol pulses, oxygen consumption was restored. Dissolved oxygen frequently reached critical levels, below 5% saturation, especially after the first 28 hours, when the cell concentration exceeded 30 g L-1 (see Figure 6b). Peaks in dissolved oxygen concentration corresponded to intervals of depleted methanol in the medium, and drops in oxygen level corresponded to intervals of pulses of methanol in the medium as an inducer of AOX promoter activity, resulting in rtGH production and cell growth. In the metabolism of methanol, the increase in cell concentration demands a greater amount of oxygen, and meeting this demand results in greater heterologous production (Curvers et al. 2001Curvers, S.; Linnemann, J.; Klauser, T.; Wandrey, C.; Takors, R. 2001. Recombinant protein production with Pichia pastoris in continuous fermentation - kinetic analysis of growth and production formation. Engineering in Life Sciences 2: 229-235.). In our fermentation process, oxygen from filtered air was used. A possible alternative for maintaining the oxygen level above 20% saturation would be the supply of concentrated oxygen to the system at times of increased cellular metabolism. The level of 250.7 mg L-1 of rtGH production obtained in the fermentation is satisfactory in comparison to levels of rGH produced in bioreactor reported in the literature. For example, the pioneering study on recombinant human growth hormone (rhGH) in K. phaffii obtained in a bioreactor reported a production of 49 mg L-1 (Ecamilla-Treviño et al. 2000Ecamilla-Treviño, L.L.; Viader-Salvadó, J.M.; Barrera-Saldaña, H.A.; Guerrero-Olazarán, M. 2000. Biosynthesis and secretion of recombinant human growth hormone in Pichia pastoris. Biotechnology Letters 22: 109-114.). Subsequent studies obtained 150 mg L-1 of rhGH in 24 h of induction (Çalik et al. 2010Çalik, P.; Bayraktar, E.; Inankur, B.; Soyaslan, E.Ş.; Şahin, M.; Taşpinar, H.; et al. 2010. Influence of pH on recombinant human growth hormone production by Pichia pastoris. Journal of Chemical Technology & Biotechnology 85: 1628-1635.) and the highest level of rhGH in 24 h reported to date of 500 mg L-1 (Apte-Deshpande et al. 2009Apte-Deshpande, A.; Rewanwar, S.; Kotwal, P.; Raiker, V.A.; Padmanabhan, S. 2009. Efficient expression and secretion of recombinant human growth hormone in the methylotrophic yeast Pichia pastoris: potential applications for other proteins. Biotechnology and Applied Biochemistry 54: 197-205.), twice as much as the level of rtGH obtained in our study. The latter authors used optimized conditions of continuous methanol feeding, dissolved oxygen maintained at 30% and supplementation with Tween 20 surfactant. Azadi et al. (2018Azadi, S.; Sadjady, S.K.; Mortazavi, S.A.; Naghdi, N.; Mahboubi, A.; Solaimanian, R. 2018. Bioprocess and downstream optimization of recombinant human growth hormone inPichia pastoris. Research in Pharmaceutical Sciences 13: 222-238.) used an optimized strategy of mixed methanol/sorbitol feeding and supplementation with ascorbic acid in 30 h of induction to obtain an exceptional rhGH production of 1.4 g L-1.
Our findings show a strong potential for tambaqui to be used as a target species for rGH production in biorector and its use in biotechnological innovations and zootechnical applications of this protein in aquaculture.
CONCLUSIONS
We demonstrated, for the first time, that gene expression and production of rGH derived from tambaqui can be successfully performed in K. phaffii yeast, either in shaken flasks or in a bioreactor, with efficient secretion into the culture supernatant and purification of the recombinant protein by affinity chromatography. Despite the great diversity of the Amazonian ichthyofauna, this is also the first time that the cDNA of the GH of a native Amazonian fish is expressed in a heterologous system and produced in a bioreactor, which opens the way for future work involving other Amazonian species that are important for fish farming in the region. The success of the heterologous expression of the tGH gene and the considerable level of bioreactor production of the rtGH shows great potential for future genetic, physiological and biotechnological research aimed at improving the productivity of tambaqui in fish farming.
ACKNOWLEDGMENTS
This work was funded by Coordenação de Aperfeiçoamento de Pessoal de Nível Superior - CAPES/Brazil and Fundação de Amparo à Pesquisa do Estado do Amazonas - FAPEAM, which provided scholarships. We also thank the Instituto Federal de Educação, Ciência e Tecnologia do Amazonas - IFAM, and the Graduate Program in Biotechnology at the Federal University of Amazonas (PPGBIOTEC/UFAM) and the Bioprocess and Bioproduct Development Laboratory at the Federal University of Rio de Janeiro (LADEBIO/UFRJ) for the provision of human resources, laboratory structure, materials and equipment used to carry out this work.
REFERENCES
- Acosta, J.; Carpio, Y.; Ruiz, O.; Morales, R.; Martínez, E.; Valdés, J.; et al. 2009. Tilapia somatotropin polypeptides: potent enhancers of fish growth and innate immunity. Biotecnologia Aplicada 26: 267-272.
- Acosta, J.; Morales, R.; Morales, A.; Alonso, M.; Estrada, M.P. 2007. Pichia pastoris expressing recombinant tilapia growth hormone accelerates the growth of tilapia. Biotechnology Letters 29: 1671-1676.
- Agellon, L.B.; Chen, T.T. 1986. Rainbow trout growth hormone: molecular cloning of cDNA and expression in Escherichia coli DNA 5: 463-471.
- Akiko, S.; Susumu, S.; Yoshinori, K.; Moriyuki, S.; Tetsuya, H.; Seiga, I. 1988. Molecular cloning of eel growth hormone cDNA and its expression in Escherichia coli Gene 73: 545-551.
- Anathy, V.; Venugopal, T.; Koteeswaran, R.; Pandian, T.J.; Mathavan, S. 2001. Cloning, sequencing and expression of cDNA encoding growth hormone from Indian catfish (Heteropneustes fossilis). Journal of biosciences 26: 315-324.
- Apte-Deshpande, A.; Rewanwar, S.; Kotwal, P.; Raiker, V.A.; Padmanabhan, S. 2009. Efficient expression and secretion of recombinant human growth hormone in the methylotrophic yeast Pichia pastoris: potential applications for other proteins. Biotechnology and Applied Biochemistry 54: 197-205.
- Araújo-Lima, C.A.; Goulding, M. 1998. Os Frutos do Tambaqui: Ecologia, Conservação e Cultivo na Amazônia Editora SCM, Tefé, 186p.
- Azadi, S.; Sadjady, S.K.; Mortazavi, S.A.; Naghdi, N.; Mahboubi, A.; Solaimanian, R. 2018. Bioprocess and downstream optimization of recombinant human growth hormone inPichia pastoris Research in Pharmaceutical Sciences 13: 222-238.
- Bart, H.L.; Reneau, P.C.; Doosey, M.H.; Bell, C.D. 2010. Evolutionary divergence of duplicate copies of the growth hormone gene in suckers (Actinopterygii: Catostomidae). International Journal of Molecular Sciences 11: 1090-1102.
- Bartke, A.; Hascup, E.; Hascup, K.; Masternak, M.M. 2021. Growth hormone and aging: new findings. The World Journal of Men’s Health 39: 454-465.
- Björnsson, B.T. 1997. The biology of salmon growth hormone: from daylight to dominance. Fish Physiology and Biochemistry 17: 9-24.
- Boettner, M.; Steffens, C.; Mering, C.; Bork, P.; Stahl, U.; Lang, C. 2007. Sequence-based factors influencing the expression of heterologous genes in the yeast Pichia pastoris - A comparative view on 79 human genes. Journal of Biotechnology 130: 1-10.
- Brabander, P.D.; Uitterhaegen, E; Delmulle, T; Winter, K.D.; Soetaert, W. 2023. Challenges and progress towards industrial recombinant protein production in yeasts: a review. Biotechnology Advances 64, 108121. (https://doi.org/10.1016/j.biotechadv.2023.108121).
» https://doi.org/10.1016/j.biotechadv.2023.108121 - Bretthauer, R.K.; Castellino, F.J. 1999. Glycosylation of Pichia pastoris-derived proteins. Biotechnology and applied biochemistry 30: 193-200.
- Çalik, P.; Bayraktar, E.; Inankur, B.; Soyaslan, E.Ş.; Şahin, M.; Taşpinar, H.; et al. 2010. Influence of pH on recombinant human growth hormone production by Pichia pastoris Journal of Chemical Technology & Biotechnology 85: 1628-1635.
- Cereghino, G.P.L.; Cereghino, J.L.; Ilgen, C.; Cregg, J.M. 2002. Production of recombinant proteins in fermenter cultures of the yeast Pichia pastoris Current Opinion in Biotechnology 13: 329-332.
- Cereghino, J.L.; Cregg, J.M. 2000. Heterologous protein expression in the methylotrophic yeast Pichia pastoris FEMS Microbiology Reviews 24: 45-66.
- Chang, Y.S.; Liu, C.S.; Huang, F.L.; Lo, T.B. 1992. The primary structures of growth hormones of three cyprinid species: bighead carp, silver carp, and grass carp. General and Comparative Endocrinology 87: 385-393.
- Chen, H.L.; Li, S.S.; Huang, R.; Tsai, H.J. 2008. Conditional production of a functional fish growth hormone in the transgenic line of Nannochloropsis oculata (Eustigmatophyceae).Journal of Phycology 44: 768-776.
- Cregg, J.M.; Vedvick, T.S.; Raschke, W.C. 1993. Recent advances in the expression of foreign genes in Pichia pastoris Bio/technology 11: 905-910.
- Curvers, S.; Linnemann, J.; Klauser, T.; Wandrey, C.; Takors, R. 2001. Recombinant protein production with Pichia pastoris in continuous fermentation - kinetic analysis of growth and production formation. Engineering in Life Sciences 2: 229-235.
- Daly, R.; Hearn, M.T.W. 2005. Expression of heterologous proteins in Pichia pastoris: a useful experimental tool in protein engineering and production. Journal of Molecular Recognition: An Interdisciplinary Journal 18: 119-138.
- Doozandeh-Juibari, A.; Ghovvati, S.; Vaziri, H.R.; Sohani, M.M.; Pezeshkian, Z. 2019. Cloning, expression, purification and evaluation of the biological properties of the recombinant human growth hormone (hGH) inEscherichia coli International Journal of Peptide Research and Therapeutics 26: 487-495.
- Du, S.J.; Gong, Z.; Fletcher, G.L.; Shears, M.A.; King, M.J.; Idler, D.R.; Hew, C.; 1992. Growth enhancement in transgenic Atlantic salmon by the use of an “all fish” chimeric growth hormone gene construct. Bio/technology 10: 176-181.
- Ecamilla-Treviño, L.L.; Viader-Salvadó, J.M.; Barrera-Saldaña, H.A.; Guerrero-Olazarán, M. 2000. Biosynthesis and secretion of recombinant human growth hormone in Pichia pastoris Biotechnology Letters 22: 109-114.
- El-Bab, A.F.F; Saghir, S.A.M.; El-Naser, I.A.A; El-Kheir, S.M.M.A.; Abdel-Kader, M.F.; Alruhaimi, R.S.; et al. 2022. The effect of dietarySaccharomyces cerevisiaeon growth performance, oxidative status, and immune response of sea bream (Sparus aurata). Life12: 1013. (https://doi.org/10.3390/life12071013).
» https://doi.org/10.3390/life12071013 - Flintegaard, T.V.; Thygesen, P.; Rahbek-Nielsen, H.; Levery, S.B.; Kristensen, C.; Clausen, H.; Bolt, G. 2010. N-glycosylation increases the circulatory half-life of human growth hormone. Endocrinology 151: 5326-5336.
- Funkenstein, B.; Chen, T.T.; Powers, D.A.; Cavari, B. 1991. Cloning and sequencing of the gilthead seabream (Sparus aurata) growth hormone-encoding cDNA. Gene 103: 243-247.
- Funkenstein, B.; Dyman, A.; Lapidot, Z.; Jesus-Ayson, E.G.; Gertler, A.; Ayson, F.G. 2005. Expression and purification of a biologically active recombinant rabbitfish (Siganus guttatus) growth hormone. Aquaculture 250: 504-515.
- IBGE. 2022. Instituto Brasileiro de Geografia e Estatística. Informações sobre Aquicultura no Brasil. ( (https://cidades.ibge.gov.br/brasil/pesquisa/18/16459?indicador=16512 ). Accessed on 27 Jan 2024.
» https://cidades.ibge.gov.br/brasil/pesquisa/18/16459?indicador=16512 - Izel, A.C.U, Melo, L.A.S. 2004. Criação de tambaqui (Colossoma macropomum) em tanques escavados no Estado do Amazonas. Documentos Embrapa #32. ( (https://www.infoteca.cnptia.embrapa.br/infoteca/bitstream/doc/674621/1/Doc32.pdf ). Accessed on 27 Jan 2024.
» https://www.infoteca.cnptia.embrapa.br/infoteca/bitstream/doc/674621/1/Doc32.pdf - Jeh, H.S., Kim, C.H., Lee, H.K., Han, K. 1998. Recombinant flounder growth hormone from Escherichia coli: overexpression, efficient recovery, and growth-promoting effect on juvenile flounder by oral administration. Journal of Biotechnology 60: 183-193.
- Kamenskaya, D.N.; Brykov, V.A. 2020. Fish growth hormone genes: structure and divergence. Russian Journal of Marine Biology 46: 233-242.
- Koren, Y.; Sarid, S.; Ber, R.; Daniel, V. 1989. Carp growth hormone: molecular cloning and sequencing of cDNA. Gene 77: 309-315.
- Lemaire, C.; Warit, S.; Panyim, S. 1994. Giant catfish Pangasianodon gigas growth hormone-encoding cDNA: cloning and sequencing by one-sided polymerase chain reaction. Gene 149: 271-276.
- Li, P.; Anumanthan, A.; Gao, X.G.; Ilangovan, K.; Suzara, V.V.; Düzgüneş, N.; Renugopalakrishnan, V. 2007. Expression of recombinant proteins in Pichia pastoris Applied Biochemistry and Biotechnology 142: 105-124.
- Li, P.; Gatlin, D.M. 2004. Dietary brewers yeast and the prebiotic Grobiotic™AE influence growth performance, immune responses and resistance of hybrid striped bass (Morone chrysops x M. saxatilis) to Streptococcus iniae infection. Aquaculture 231: 445-456.
- Li, Y.; Bai, J.; Jian, Q.; Ye, X.; Lao, H.; Li, X.; Luo, J.; Liang, X. 2003. Expression of common carp growth hormone in the yeast Pichia pastoris and growth stimulation of juvenile tilapia (Oreochromis niloticus). Aquaculture 216: 329-341.
- Lima, E.R.; Freire, R.P.; Suzuki, M.F.; Oliveira, J.E.; Yosidaki, V.L.; Peroni, C.N.; et al. 2023. Isolation and characterization of the Arapaima gigas growth hormone (ag-GH) cDNA and three-dimensional modeling of this hormone in comparison with the human hormone (hGH). Biomolecules 13: 158. (https://doi.org/10.3390/biom13010158).
» https://doi.org/10.3390/biom13010158 - Liu, S.; Zhang, X.; Zang, X.; Liu, B.; Arunakumara, K.K.I.U; Xu, D.; Zhang, X. 2008. Growth, feed efficiency, body muscle composition, and histology of flounder (Paralichthys olivaceus) fed GH transgenic Synechocystis Aquaculture 277: 78-82.
- Meier, K.M.; Castaño, C.S.; Laurino, J.P.; Sabaj, J.A.L.; Marins, L.F.F. 2006. cDNA cloning and phylogenetic analysis of growth hormone genes from the mullet Mugil platanus (Mugilomorpha, Mugilidae) and the halfbeak Hemiramphus brasiliensis (Atherinomorpha, Hemiramphidae). Atlântica (Rio Grande) 28: 97-102.
- Melo, L.A.S.; Izel, A.C.U.; Rodrigues, F.M. 2001. Criação de Tambaqui (Colossoma macropomum) em Viveiros de Argila/Barragens no Estado do Amazonas. Documentos Embrapa #18. ( (https://www.infoteca.cnptia.embrapa.br/bitstream/doc/668979/1/Doc18.pdf ). Accessed on 27 Jan 2024.
» https://www.infoteca.cnptia.embrapa.br/bitstream/doc/668979/1/Doc18.pdf - Morais, I.S.; O´sullivan, A.L.F. 2017. Biologia, habitat e cultivo do tambaqui Colossoma macropomum (CUVIER, 1816). Scientia Amazonia 6: 81-93.
- Moriyama, S. 2015. 15A-growth hormone. In: Takei Y.; Ando, H.; Tsutsui, K. (Ed.). Handebook of Hormones 1st. ed. Academic Press, San Diego, p.110-e15A-5.
- Ng, K.L.; Lam, C-C.; Kwong, K.W.Y.; Dik, D.W.N.; Lai, C.Y.; Au Yong, J.L-W.; Qian, P.; Wong, W.K. 2016. Enhancement of fish growth employing feed supplemented with recombinant fish growth hormone expressed in Bacillus subtilis Research Journal of Biotechnology 11:1-11.
- Ozório, R.O.A.; Portz, L.; Borghesi, R.; Cyrino, J.E.P. 2012. Effects of dietary yeast (Saccharomyces cerevisiae) supplementation in practical diets of tilapia (Oreochromis niloticus). Animals 2: 16-24.
- Paz, A.L.; Val, A.L. 2018. Manipulation of growth of the Amazonian fish tambaqui, Colossoma macropomum (Characiformes: Serrasalmidae): analysis of physiological and zootechnical aspects. Acta Amazonica 48: 197-206.
- Pendón, C.; Martínez-Barberá, J.P.; Pérez-Sánchez, J.; Rodríguez, R.B.; Grenett, H.; Valdivia, M.M. 1994. Cloning of the sole (Solea senegalensis) growth hormone-encoding cDNA. Gene 145: 237-240.
- Pereira Junior, G.P.; Pereira, E.M.O.; Filho, M.P.; Barbosa, P.S.; Shimoda, E.; Brandão, L.V. 2013. Desempenho produtivo de juvenis de tambaqui (Colossoma macropomum CUVIER, 1818) alimentados com rações contendo farinha de crueira de mandioca (Manihot esculenta, Crantz) em substituição ao milho (Zea mays). Acta Amazonica 43: 217-226.
- Pinheiro, J.S.; Wolff, J.L.C.; Araújo, R.C.; Hilsdorf, A.W.S. 2008. Molecular cloning and sequence analysis of growth hormone cDNA of Neotropical freshwater fish pacu (Piaractus mesopotamicus). Genetics and Molecular Biology 31: 381-384.
- Piyaviriyakul, P.; Panyim, S.; Eurwilaichitr, L. 2002. High intracellular expression of giant catfish growth hormone under the control of PGK promoter in Saccharomyces cerevisiae World Journal of Microbiology & Biotechnology 18: 773-777.
- Pratap, J; Rajamohan, G; Dikshit, K.L. 2000. Characteristics of glycosylated streptokinase secreted from Pichia pastoris: enhanced resistance of SK to proteolysis by glycosylation. Applied microbiology and biotechnology 53: 469-475.
- Rentier-Delrue, F.; Swennen, D.; Mercier, L.; Lion, M.; Benrubi, O.; Martial, J.A. 1989a. Molecular cloning and characterization of two forms of trout growth hormone cDNA: expression and secretion of tGH-II by Escherichia coli DNA 8: 109-117.
- Rentier-Delrue, F.; Swennen, D.; Philippart, J.C.; L’hoir, C.; Lion, M.; Benrubi, O.; et al. 1989b. Tilapia growth hormone: molecular cloning of cDNA and expression in Escherichia coli DNA 8: 271-278.
- Sadalla-Pinto, E.A.; Liebl, A.R.S.; Nascimento, M.S.; Flor, N.S.; Aride, P.H.R.; Oliveira, A.T. 2021. Nutrição e manejo alimentar de peixes amazônicos. In: Mattos, B.O.; Pantoja-Lima, J.; Oliveira, A.T.; Aride, P.H.R. (Org.). Aquicultura na Amazônia: Estudos Técnico-Científicos e Difusão de Tecnologias Atena Editora, Ponta Grossa, p.177-197.
- Sambrook, J.; Russell, D.W. 2001. Molecular cloning: a laboratory manual 3rd ed. Cold Spring Harbor Laboratory Press, New York, 2100p.
- Sandre, L.C.G.; Buzollo, H.; Nascimento, T.M.T.; Neira, L.M.; Jomori, R.K.; Carneiro, D.J. 2017. Productive performance and digestibility in the initial growth phase of tambaqui (Colossoma macropomum) fed diets with different carbohydrate and lipid levels. Aquaculture Reports 6: 28-34.
- Sanger, F.; Nicklen, S.; Coulson, A.R. 1977. DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences 74: 5463-5467.
- Sekar, M.; Singh, S.D.; Gupta, S. 2014. Cloning and characterization of Pangasianodon hypophthalmus growth hormone gene and its heterologous expression. Applied Biochemistry and Biotechnology 173: 1446-1468.
- Souza, C.J.H.; Benavides, M.V.; Melo, E.O. 2016. Caracterização molecular do hormônio do crescimento do tambaqui (Colossoma macropomum). Embrapa Pesca e Aquicultura. Boletim de Pesquisa e Desenvolvimento #12, 15p. ( (https://www.infoteca.cnptia.embrapa.br/infoteca/handle/doc/1072736 ). Accessed on 27 Jan 2024.
» https://www.infoteca.cnptia.embrapa.br/infoteca/handle/doc/1072736 - Stratton, J.; Chiruvolu, V.; Meagher, M. 1998. Methods in molecular biology. In: Higgins, D.R.; Cregg, J.M. (Ed.). Pichia Protocols Humana Press, Totowa, p.107-120.
- Tsai, H.J.; Chen, H.M.; Lo, C.F. 1994. Secretory synthesis of active recombinant fish growth hormone by insect cells using a baculovirus vector. Canadian Journal of Fisheries and Aquatic Sciences 51: 1-7.
- Tsai, H.J.; Hsih, M.H.; Kuo, J.C. 1997. Escherichia coli-produced fish growth hormone as a feed additive to enhance the growth of juvenile black seabream (Acanthopagrus schlegeli). Journal of Applied Ichthyology 13: 79-82.
- Venugopal, T.; Anathy, V.; Pandian, T.J.; Gong, G.Z.; Mathavan, S. 2002. Molecular cloning of growth hormone-encoding cDNA of an Indian major carp, Labeo rohita, and its expression in Escherichia coli and zebrafish. General and Comparative Endocrinology 125: 236-247.
- Zhang, R.; Jiang, Y.; Zhou, L.; Chen, Y.; Wen, C.; Liu, W.; Zhou, Y. 2019. Effects of dietary yeast extract supplementation on growth, body composition, non-specific immunity, and antioxidant status of Chinese mitten crab (Eriocheir sinensis).Fish & Shellfish Immunology 86:1019-1025.
-
CITE AS:
Sadalla-Pinto, E.A.; Andrade, E. de; Carmo, E.J. do; Souza-Neto, J.N. de; Batista, L.M.; Bentes-Sousa, A.R.; Mariúba, L.A.M.; Passos, D. de F.; Fernandes, R.P.; Pereira Junior, N.; Porton, J.I.R.; Astolfi-Filho, S. 2024. Extracellular expression, purification and bioreactor production of tambaqui (Colossoma macropomum) growth hormone in the yeast Komagataella phaffii (formerly Pichia pastoris). Acta Amazonica 54: e54bt23179.
Data availability
The data that support the findings of this study are not publicly available.
Edited by
ASSOCIATE EDITOR:
Publication Dates
-
Publication in this collection
22 Apr 2024 -
Date of issue
Apr-Jun 2024
History
-
Received
14 June 2023 -
Accepted
21 Jan 2024