Detection of arboviruses in Aedes aegypti through transovarian analysis: A study in Goiânia, Goiás

Abstract

Background:

Arboviral diseases are a group of infectious diseases caused by viruses transmitted by arthropods, mainly mosquitoes. These diseases, such as those caused by the dengue (DENV), Zika (ZIKV), chikungunya (CHIKV), and yellow fever (YFV) viruses, have a significant impact worldwide. In this context, entomological surveillance plays a crucial role in the control and prevention of arboviruses by providing essential information on the presence, distribution, and activity of vector mosquitoes. Based on entomological surveillance, transovarian transmission provides information regarding the maintenance and dissemination of arboviruses. The objective of this study was to detect these arboviruses in Goiânia, Goiás, and analyze the occurrence of transovarian transmission.

Methods:

Aedes aegypti eggs were collected from different regions of Goiânia and cultivated under controlled laboratory conditions until the emergence of adult mosquitoes. Adult females were grouped into pools containing their heads and thoraxes. These pools were subsequently evaluated using reverse-transcription quantitative polymerase chain reaction (RT-qPCR) assay.

Results:

A total of 157 pools (N=1570) were analyzed, with two pools testing positive for CHIKV and one pool testing positive for ZIKV, indicating that the offspring resulting from transovarian transmission are potentially infectious.

Conclusions:

In summary, the demonstration of the vertical transmission mechanisms of CHIKV and ZIKV in A. aegypti serves as an alert to health authorities, as these diseases are still underreported, and their primary urban vector has likely acquired this capacity, contributing to the dissemination of these infections.

Keywords:
Arboviruses; RT-qPCR; Vertical transmission; Monitoring

Introduction

Arboviral diseases are a group of infectious diseases caused by viruses transmitted by arthropods that are primarily members of the Culicidae family. These diseases, including those caused by the dengue (DENV), Zika (ZIKV), yellow fever (YFV) (Flaviviridae family), chikungunya (CHIKV) (Togaviridae family), and oropouche (OROV) (Peribunyaviridae family) viruses, pose a significant challenge to public health worldwide¹. In addition to impacting human health, arboviral diseases have a significant impact on society and the economy². The social impact of arboviral diseases is marked by human suffering caused by debilitating symptoms, such as high fever, intense joint pain, and skin rashes^1,3, as well as severe complications, such as Guillain-Barré syndrome⁴ and ZIKV-induced microcephaly in neonates⁵. Some arboviral diseases can be fatal, such as dengue hemorrhagic fever (DHF) and dengue shock syndrome (DSS)^6,7. Vulnerable populations, including children, the elderly, and individuals with preexisting health conditions, are the most affected. In addition, arboviral diseases impose a significant burden on healthcare systems, individuals, and their families. Direct costs include medical treatment, hospitalization, and long-term care for patients with sequelae. There are also indirect costs, such as loss of productivity at work due to illness or disability, which negatively impact the local and national economies⁸.

Mosquitoes of the genus Aedes are the primary vectors of arboviral diseases. Aedes aegypti and Aedes albopictus are the main vectors of DENV, ZIKV, and CHIKV^9,10. They are highly adapted to urban environments and are primarily bred in artificial containers that collect stagnant water, such as tires, plant pots, and household containers¹¹. Additionally, they are capable of transovarial transmission^12,13. The larvae that emerge from the eggs are already infected and become adult mosquitoes capable of transmitting the virus to other hosts, contributing to the persistence of arboviruses in urban areas, even during periods of low incidence of human cases. This makes controlling these diseases more challenging, because continuous transmission by infected mosquitoes from the larval stage can perpetuate viral circulation^14,15.

Entomological surveillance focuses on these mosquitoes and plays a crucial role in the control and prevention of arboviral diseases by providing essential information on the presence, distribution, and activity of vector mosquitoes¹⁶. Through the placement of traps to capture adult mosquitoes and the inspection of breeding sites to analyze eggs and larvae for the presence of arboviruses, it is possible to identify areas with higher infestation, determine the population density of vectors, and monitor the presence of arboviruses in mosquitoes¹⁷. Continuous and comprehensive entomological surveillance is essential to monitor vector activity, evaluate the effectiveness of control measures, and provide crucial information for planning and implementing strategies to prevent and control arboviral diseases¹⁸.

Among the surveillance approaches used, surveillance of the transovarial transmission in vector mosquitoes is noteworthy. This type of surveillance enables the identification and monitoring of arboviruses in mosquito populations from the larval stage to the adult phase when they can transmit the disease. A systematic collection of eggs, larvae, and mosquitoes allows the identification of sites where transovarial transmission occurs and the estimation of the viral infection rate in these populations¹⁹. Surveillance of transovarial transmission in mosquitoes is a strategic and complementary approach to conventional entomological surveillance, contributing to the interruption of the viral transmission chain and the effective control of arboviral diseases²⁰.

Considering that there was a 211% increase in confirmed DENV cases, a 430% increase in CHIKV cases, and a 364.71% increase in ZIKV cases from 2021 to 2022, as reported in the epidemiological bulletin of the state of Goiás, it is possible that this increase is related to transovarial transmission²¹. Therefore, the objective of this study was to monitor the arboviruses DENV, CHIKV, ZIKV, and OROV through the analysis of transovarial transmission occurrence in A. aegypti mosquitoes in the city of Goiânia, Goiás.

Methods

● Study area and collection of eggs

A. aegypti eggs were laid in the city of Goiânia, Goiás (Latitude: −16.6799 and Longitude: −49.255). It is the most populous city in the central region of Brazil, with more than 1.5 million inhabitants. The semi-humid tropical climate contributes to the proliferation of the vector of arboviruses, A. aegypti, causing Goiânia to register an increase in cases of arboviruses annually, with regions of the municipality in a state of alert for epidemics. Previous studies on transovarian transmission in A. aegypti were carried out in the city where the Mayaro virus (MAYV) was detected in vectors close to Basic Health Units in the municipality²². In view of this, three regions of the city-north (N), southwest (SW), and northwest (NW)-were chosen for the collection of A. aegypti eggs, for the analysis of transovarial transmission in this vector (Figure 1). The collection was conducted by agents of the Sanitary Surveillance of the State of Goiás (SVS/GO) from January to September 2022, ovitraps were used to capture the eggs.

FIGURE 1:
Collection regions and steps carried out in this study. In general, this work included the following steps: (A) capturing A. aegypti eggs in the North, Northwest and Southwest regions of Goiânia. (B) (I) Development of larvae; (II) development of pupae; (III) identification of mosquitoes, gender differentiation, and separation of the head and thorax from the abdomen; (IV) and maceration of the pools. (C) Extraction of the macerated pools and RT-qPCR of extracted samples.

● Development of mosquitoes, assembly of pools, and extraction of viral RNA

The collected eggs were added to containers containing distilled water and nutrients until the larvae hatched. The larvae were collected using a sieve and placed in 2 L PET bottles containing sterile distilled water and cat food, which were later sealed with cotton. Adult mosquitoes were captured by suction using an aspirator and placed directly in falcon tubes lined with filter paper and immediately stored in a −80 °C freezer until the pools were assembled. All reagents used during mosquito manipulation were tested using reverse-transcription quantitative real-time PCR (RT-qPCR) to determine the presence of internal contamination.

Morphological identification was performed at the genus and species levels as described by Forattini et al.²³. Adult mosquitoes were sexed by observing characteristics such as the plumage of the insects’ antennae, as shown in Supplementary Figure 1. The females were separated and organized into pools of 10 individuals containing the head and thorax for analysis of the salivary gland and stored in 1.5 mL tubes (Axygen, USA). Mosquito pools were macerated with a plastic pestle in 300 µL of H2O MilliQ autoclaved directly in tubes, and the macerate was centrifuged for 2 min at 500×g. The supernatant was collected and transferred to new tubes and stored at −80 °C until viral RNA extraction. Viral extraction was performed with a MagMAX™ Viral/Pathogen Nucleic Acid Isolation Kit (Thermo Fisher, Scientific, Waltham, Massachusetts, USA), according to the manufacturer’s instructions.

● Molecular detection of DENV, CHIKV, ZIKV, and OROV

The detection of arboviruses DENV, ZIKV, and CHIKV was performed using the primers and probes synthesized according to the CDC (Center for Disease Control and Prevention, USA) and employed the GoTaq® Probe 1-Step RT-qPCR system (Promega, WI, USA). The primers for OROV were based on the methods described by Rojas et al.²⁴ (Table 1). A set of primers and probes that amplified the actin gene of Aedes spp. were used as endogenous controls for RT-qPCR.

TABLE 1:
Sequence of primers/probes for identification of DENV, CHIKV, ZIKV, and OROV arboviruses and the endogenous control actin gene of Aedes spp.

Target	Primer forward	Primer reverse	Probe
Actin	5'GACYGACTACCTGATGAAGATC 3'	5'GTTCATAAGACTTCTCCAGGG 3'	5' SUNCTGGACTTCGAGCAGGAAATGG 3' IowaBlack
OROV	5' GACAAGTSCTCAATGCTGGTGT 3'	5'CGTTGTCCGGSACTGGATT 3'	5'TGGTTGACCTYACTTTTGGTGGGGT 3' FAM/ZEN TM IBFQ
DENV	5'-GGTTAGAGGAGACCCCTCCC-3'	5'GAGACAGCAGGATCTCTGGTCT-3'	5'/56FAM/AAACAGCAT/ZEN/ATTGACGCTGGGA/3iABkFQ/3'
ZIKV	5'-CCGCTGCCCAACACAAG-3'	5'CCACTAACGTTCTTTTGCAGACAT-3'	5'-/56FAM/AGCCTACCT/ZEN/TGACAAGCAGTCAGACACTCAA/3lABkFQ/-3'
CHIKV	5'-AAAGGGCAAACTCAGCTTCAC-3'	5'GCCTGGGCTCATCGTTATTC-3'	5'-/56FAM/CGCTGTGAT/ZEN/ACAGTGGTTTCGTGTG/3lABkFQ/-3'

• OROV: oropouche virus; DENV: dengue virus; ZIKV: Zika virus; CHIKV: chikungunya virus.

Gblocks (Integrated DNA Technologies, Coralville, IA, USA), synthetic DNA fragments from DENV (GenBank accession number OK040058.1), CHIKV (GenBank accession number MW581885.1), ZIKV (GenBank accession number OK054487.1), and OROV (GenBank accession number HQ830492.1), were designed and used as positive controls to establish standard curves for absolute quantification by RT-qPCR. Subsequently, a second Gblock was designed to contain primer-binding regions for OROV and the actin gene, as shown in Supplementary Table 1.

The total volume of RT-qPCR was 10 μL (5 μL GoTaq® Probe 1-Step RT-qPCR System kit, 0.2 μL Go Script RT Mix for 1-Step RT-qPCR, 0.8 μL Nuclease-Free Water, 0.5 primers/probe, and 2.5 µL of RNA) (Promega, Madison, Wisconsin, USA). Nuclease-free water for molecular biology (Sigma-Aldrich, EUA) was used as a negative control. RT-qPCR was performed using an AriaMX Real-Time PCR System (Agilent, CA, USA). The amplification program consisted of one cycle at 45 °C for 15 minutes for reverse transcription and one cycle at 95 °C for 2 minutes for reverse transcriptase denaturation and DNA polymerase activation, followed by 40 cycles at 95 °C for 15 seconds and 60 °C for 1 min for denaturation and amplification. Fragments of both Gblocks were used as positive controls and to construct standard curves for absolute quantification of the RT-qPCR reactions. The standard curve for each specific arbovirus or actin gene was constructed using a serial log¹⁰ dilution ranging from 10⁵ to 1 copy/reaction, and each reaction was performed in duplicate. A standard curve was used to determine the number of copies of viral genetic material present in the pools of mosquitoes or the endogenous control gene, actin. Pools with Cq values ​​equal to or below 34.30 for actin²⁵, 31.17 for DENV, 33.49 for ZIKV, 31.66 for CHIKV²², and 34.54 for OROV were considered positive (data not shown). Pools with Cq values above the limit of detection were considered negative.

Results and Discussion

A total of 1570 A. aegypti females were captured in the three major regions of Goiânia and distributed in 157 pools. This resulted in 83 (52.9%) pools from the northwest region, 48 (30.6%) from the southwest region, and 26 (16.6%) from the north region (data not shown). Two samples from the north region tested positive for CHIKV. The southwest region had a positive pool for ZIKV. The northwest region did not show any positive pools. DENV and OROV were not detected in this study. A total of 26 ovitraps were used in this study, with 14 in the northwest region, 7 in the southwest region, and 4 in the northern region (Table 2).

TABLE 2:
Location coordinates of ovitraps distributed in the southwest, northwest, and north regions of Goiânia.

Region	Nº ovitraps	Xa	Yb	CHIKV	ZIKV	Cq	Number of copiesc
Southwest	8	671823,45	8144543,67	-	-	No cq	ND
	9	672014,84	8144326,97	-	-	No cq	ND
	10	671744,45	8144305,96	-	+	28.48	783
	11	671894,29	8143982,35	-	-	No cq	ND
	12	672339,7	8144028,63	-	-	No cq	ND
	13	672542,9	8143732,42	-	-	No cq	ND
	14	672023,68	8143942,31	-	-	No cq	ND
Northwest	26	679788,69	8162192,31	-	-	No cq	ND
	27	679825,04	8161881,73	-	-	No cq	ND
	28	679486,96	8162145,81	-	-	No cq	ND
	29	679466,46	8161650,16	-	-	No cq	ND
	30	679185,51	8161458,6	-	-	No cq	ND
	31	679564,92	8161217,67	-	-	No cq	ND
	32	679274,36	8160818,31	-	-	No cq	ND
	33	678890,45	8160983,68	-	-	No cq	ND
	34	679417,77	8160375,21	-	-	No cq	ND
	35	679032,86	8160499,56	-	-	No cq	ND
	36	678678,35	8160676,33	-	-	No cq	ND
	37	678855,85	8160388,48	-	-	No cq	ND
	38	679284,33	8160204,49	-	-	No cq	ND
	39	679737,29	8161727,32	-	-	No cq	ND
North	40	-16620154	-49.294.576	-	-	No cq	ND
	41	16.612.873	-49.299.803	-	-	No cq	ND
	42	-16.644.245	-49.229.127	+	-	34.21	105
	43	-16.643.354	-49.231.684	-	-	No cq	ND
	44	-16.618.823	-49.217.875	+	-	28.78	2442

• ^aGeographic coordinate; ^bGeographic coordinate; ^cThe viral load obtained and its number of copies determined by the standard Gblock curve; CHIKV: chikungunya virus; ZIKV: Zika virus; Cq: amplification cycle value obtained by RT-qPCR.

The transmission of arboviruses by the urban vector A. aegypti represents an important public health challenge because of its ability to cause diseases with significant social and economic impacts. The transmission of arboviruses occurs horizontally in competent mosquitoes, where the virus must be able to infect different anatomical regions of the vector, including overcoming the physical barriers of the midgut, and multiplying in secondary organs, such as the ovaries and salivary glands, present in the head and thorax of the mosquito. When a blood meal is obtained, the mosquito transmits the virus to another vertebrate²⁶. The detection of CHIKV and ZIKV in the head and thorax pools suggests viral replication in the salivary glands of mosquitoes; that is, the progeny resulting from vertical transmission are potentially infectious and capable of transmission after birth.

Another form of arbovirus transmission is vertical, in which eggs are infected during oviposition, or transovarial transmission by the infected female mosquito²⁷. This mechanism plays an important role in the persistence, dissemination, and maintenance of the virus in nature between inter-epidemic periods, as eggs can persist in the environment under adverse conditions, and in favorable environmental conditions, they hatch and generate infected progeny²⁸.

Vertical transmission in A. aegypti has already been identified for the arboviruses CHIKV^29,30, DENV^13,31,32, ZIKV^14,33,34, and MAYV^13,22 through the analysis of eggs, larvae, and males of A. aegypti, experimentally, using adult A. aegypti fed with infected blood and stimulated to spawn. Contaminated environments used as sources of oviposition for A. aegypti and A. albopictus, such as sewage and urine, can also contaminate the larvae and pupae of these insects, as reported for ZIKV²⁷.

The number of DENV and CHIKV recorded cases in Goiânia, the capital of the state of Goiás, significantly increased in 2022 compared with that in previous years, especially 2020 and 2021, during which studies supported the hypothesis of underreporting of arboviruses starting in 2020, likely due to the impact of the pandemic caused by the Sars-CoV-2 virus^35,36. In Table 3 we present the epidemiological data of the arboviruses DENV, ZIKV, and CHIKV from the last 5 years in the city of Goiânia, reported by the State Secretariat of Goiás³⁷.

TABLE 3:
Epidemiological data on arboviruses over the last 5 years.

	Reported Cases
Year	DENV	CHIKV	ZIKV
2018	33327	67	377
2019	35512	65	123
2020	16241	16	0
2021	14280	141	1
2022	60413	1462	1
2023	19271	510	2

• DENV: dengue virus; CHIKV: chikungunya virus; ZIKV: Zika virus.

In 2021, the municipality of Goiânia presented high risk and medium risk for the occurrence of DENV cases in all regions of the city, while CHIKV presented medium risk in the north regions, where a positive pool was detected, and in the southwest region. ZIKV cases decreased, with only one case in the city (Figure 2), which can be understood as an underreporting of cases or difficulty in diagnostic suspicion²¹.

FIGURE 2:
Distribution of all positive cases of DENV, CHIKV, and ZIKV in 2021 in Goiânia, Goiás.

Despite reports of vertical transmission of DENV in A. aegypti, both experimentally and in nature^32,38, Goiânia has a high incidence of DENV cases (300 cases/100,000 inhabitants) in all regions of the city, especially in the northwest region³⁹. In this study, no pools of A. aegypti infected with DENV were detected. This may be related to the fact that transovarial transmission occurs at a low frequency for DENV, not exceeding 20% in nature^40,41, and that the highest rates of vertical transmission of DENV are associated with the A. albopictus rather than A. aegypti mosquito. Other studies also have not detected the presence of DENV in pools of A. aegypti in the Goiânia region^42.

In the state of Goiás, as far as we know, there are no reports of the occurrence of OROV fever in humans; however, previous studies have identified the presence of antibodies to the OROV virus in primates captured in two parks in Goiânia⁴³. The detection of antibodies against this virus in primates is important because of the possibility of its dissemination among these animals and potential for introduction among humans living in populated areas. Thus, in addition to the most frequent arboviruses in the city (DENV, CHIKV, and ZIKV), we performed tests to detect OROV. However, there were no positive pooled results for OROV because the main vectors related to this arbovirus are the mosquitoes Culicoides paraensis and Culex quinquefasciatus^44,45. There have been no reports of A. aegypti acting in the transmission of OROV, although it is a member of the genus. Aedes serratus has been identified as naturally infected by the virus⁴⁶. During the egg collection period, the studied regions did not present a high OROV risk.

Cases of ZIKV and CHIKV infections are frequently underreported, mainly because infected individuals have mild symptoms or are asymptomatic. In addition, a lack of awareness, proper diagnosis, and efficient surveillance systems contribute to the underreporting of these viruses. This can lead to the mistaken perception that the epidemiological situation is under control when there is a continuous circulation of viruses in the mosquito population. Our findings underscore the importance of the ongoing surveillance and comprehensive monitoring of viral transmission. This highlights the need to strengthen public health systems, improve diagnostic methods, and promote collaboration among researchers, health professionals, and government officials to effectively detect and respond to mosquito-borne viral outbreaks.

The end of transmission and effective reduction of infestation by disease-transmitting mosquitoes in urban areas, including A. aegypti, is still a goal that is far from being achieved. Traditional methods have proven ineffective, and mosquito larvae show significant resistance to larvicides. Identification of sectors containing mosquitoes infected with arboviruses could be a valuable tool for disease control. This will enable public health authorities to make intensive efforts to reduce local vector populations, thereby reducing the potential for transmission by eliminating infected mosquitoes and shortening the infection cycle. This detection also opens the possibility of predicting transmission levels by estimating the percentage of infected mosquitoes within a given epidemiological week⁴⁷.

Conclusion

The vertical transmission of ZIKV and CHIKV arboviruses in A. aegypti mosquitoes, detected through the analysis of pools containing the head and thorax of A. aegypti females, indicates the formation of infectious offspring. Monitoring mosquitoes for the presence of arboviruses is crucial for preventing the spread of these infectious diseases because they typically undergo horizontal transmission, where insects transmit the viruses through blood feeding. Vertical transmission is an adaptive mechanism by which insects pass viruses to their offspring, facilitating their dispersal to urban areas. Mosquito surveillance programs can identify areas where infected mosquitoes are present, allowing public health authorities to implement targeted control measures, such as insecticide spraying, removal of stagnant water, and public education campaigns. Early detection and swift response can help prevent outbreaks and reduce arbovirus transmission, making mosquito monitoring essential for public health protection.

Acknowledgments

This work was carried out with the support of the Academic Cooperation Program in National Defense (PROCAD), CAPES, and CNPq. We would like to thank the Secretary of Sanitary Surveillance of Goiânia (Goiás-Brasil), especially Welington Tristão da Rocha.

References

• ¹
  Azevedo RSS, Oliveira CS, Vasconcelos PF da C. Chikungunya risk for Brazil. Rev Saude Publica. 2015;49:1-6.
• ²
  Donalisio MR, Freitas ARR, Zuben APB Von. Arboviruses emerging in Brazil: challenges for clinic and implications for public health. Rev Saude Publica . 2017;51:30-6.
• ³
  Morrison TE. Reemergence of Chikungunya Virus. J Virol. 2014;88(20):11644-7.
• ⁴
  Leonhard SE, Tan CY, Eijk AA, Reisin RR, Franken SC, Huizinga R, et al. Antecedent infections in Guillain-Barré syndrome in endemic areas of arbovirus transmission: A multinational case-control study. J Peripher Nerv Syst. 2021;26(4):449-60.
• ⁵
  Triunfol M. A new mosquito-borne threat to pregnant women in Brazil. Lancet Infect Dis. 2016;16(2):156-7.
• ⁶
  Uno N, Ross TM. Dengue virus and the host innate immune response. Emerg Microbes Infect. 2018;7(1):1-11.
• ⁷
  Andrioli DC, Busato MA, Lutinski JA. Características da epidemia de dengue em Pinhalzinho, Santa Catarina, 2015-2016. Epidemiol Serv Saude. 2020;29(4):e2020057.
• ⁸
  Deng X, Yan R, Li Z qiao, Tang X wen, Zhou Y, He H. Economic and disease burden of Japanese encephalitis in Zhejiang Province, 2013-2018. PLoS Negl Trop Dis. 2021;15(6):e0009505.
• ⁹
  Souza-Neto JA, Powell JR, Bonizzoni M. Aedes aegypti vector competence studies: A review. Infect Genet Evol. 2019;67:191-209.
• ¹⁰
  Lozano-Fuentes S, Kenney JL, Varnado W, Byrd BD, Burkhalter KL, Savage HM. Susceptibility and Vectorial Capacity of American Aedes albopictus and Aedes aegypti (Diptera: Culicidae) to American Zika Virus Strains. J Med Entomol. 2019;56(1):233-40.
• ¹¹
  Kraemer MUG, Reiner RC, Brady OJ, Messina JP, Gilbert M, Pigott DM, et al. Past and future spread of the arbovirus vectors Aedes aegypti and Aedes albopictus Nat Microbiol. 2019;4(5):854-63.
• ¹²
  da Costa CF, dos Passos RA, Lima JBP, Roque RA, de Souza Sampaio V, Campolina TB, et al. Transovarial transmission of DENV in Aedes aegypti in the Amazon basin: a local model of xenomonitoring. Parasit Vectors. 2017;10(1):249-58.
• ¹³
  Maia LMS, Bezerra MCF, Costa MCS, Souza EM, Oliveira MEB, Ribeiro ALM, et al. Natural vertical infection by dengue virus serotype 4, Zika virus and Mayaro virus in Aedes (Stegomyia) aegypti and Aedes (Stegomyia) albopictus Med Vet Entomol. 2019;33(3):437-42.
• ¹⁴
  Lequime S, Fontaine A, Ar Gouilh M, Moltini-Conclois I, Lambrechts L. Genetic Drift, Purifying Selection and Vector Genotype Shape Dengue Virus Intra-host Genetic Diversity in Mosquitoes. PLoS Genet. 2016;12(6):e1006111.
• ¹⁵
  Izquierdo-Suzán M, Zárate S, Torres-Flores J, Correa-Morales F, González-Acosta C, Sevilla-Reyes EE, et al. Natural Vertical Transmission of Zika Virus in Larval Aedes aegypti Populations, Morelos, Mexico. Emerg Infect Dis. 2019;25(8):1477-84.
• ¹⁶
  Campos KB, Alomar AA, Eastmond BH, Obara MT, S Dias LD, Rahman RU, et al. Assessment of insecticide resistance of Aedes aegypti (Diptera: Culicidae) populations to insect growth regulator pyriproxyfen, in the northeast region of Brazil. J Vector Ecol. 2023;48(1):12-8.
• ¹⁷
  Moura MCBM, Oliveira JV, Pedreira RM, Tavares AM, de Souza TA, de Lima KC, et al. Spatio-temporal dynamics of Aedes aegypti and Aedes albopictus oviposition in an urban area of northeastern Brazil. Trop Med Int Saúde. 2020;25(12):1510-21.
• ¹⁸
  Macêdo SF, Silva KA, Vasconcelos RB, Sousa IV, Mesquita LPS, Barakat RDM, et al. Scaling up of Eco-Bio-Social Strategy to Control Aedes aegypti in Highly Vulnerable Areas in Fortaleza, Brazil: A Cluster, Non-Randomized Controlled Trial Protocol. Int J Environ Res Public Health. 2021;18(3):1278-301.
• ¹⁹
  Zeidler JD, Acosta POA, Barrêto PP, Cordeiro J da S. Vírus dengue em larvas de Aedes aegypti e sua dinâmica de infestação, Roraima, Brasil. Rev Saude Publica . 2008;42(6):986-91.
• ²⁰
  Bona ACD, Twerdochlib AL, Navarro-Silva MA. Detecção do vírus da dengue em populações naturais de mosquitos Detection of dengue virus in natural populations of mosquitoes. Bol Malariol Salud Ambient. 2011;52(2):107-16.
• ²¹
  Ministério da Saúde (MS). Secretaria Municipal de Saúde da Prefeitura de Goiânia. Sistema Nacional de Vigilância em Saúde - Relatório de Situação: Boletim Epidemiológico. Goiânia. 8ª edição. Goiás. MS; 2022. 1 p.
• ²²
  de Curcio JS, Salem-Izacc SM, Pereira Neto LM, Nunes EB, Anunciação CE, Silveira-Lacerda E de P. Detection of Mayaro virus in Aedes aegypti mosquitoes circulating in Goiânia-Goiás-Brazil. Microbes Infect. 2022;24(4):104948-54.
• ²³
  Forattini OP, Kakitani I, Santos RLC, Kobayashi KM, Ueno HM, Fernandez Z. Comportamento de Aedes albopictus e de Ae. scapularis adultos (Diptera: Culicidae) no Sudeste do Brasil. Rev Saude Publica . 2000;34(5):461-7.
• ²⁴
  Rojas A, Stittleburg V, Cardozo F, Bopp N, Cantero C, López S, et al. Real-time RT-PCR for the detection and quantitation of Oropouche virus. Diagn Microbiol Infect Dis. 2020;96(1):114894-99.
• ²⁵
  De Sousa FB, de Curcio JS, do Carmo Silva L, da Silva DMF, Salem-Izacc SM, Anunciação CE, et al. Report of natural Mayaro virus infection in Mansonia humeralis (Dyar & Knab, Diptera: Culicidae). Parasit Vectors. 2023;16(1):140-6.
• ²⁶
  Hardy JL, Houk EJ, Kramer LD, Reeves WC. Intrinsic Factors Affecting Vector Competence of Mosquitoes for Arboviruses. Annu Rev Entomol. 1983;28(1):229-62.
• ²⁷
  Ciota AT, Bialosuknia SM, Ehrbar DJ, Kramer LD. Vertical Transmission of Zika Virus by Aedes aegypti and Ae. albopictus Mosquitoes. Emerg Infect Dis . 2017;23(5):880-2.
• ²⁸
  Pepe VLE, Albuquerque MV, Osorio-de-Castro CGS, Pereira CCA, Oliveira CVS, Reis LGC, et al. Proposta de análise integrada de emergências em saúde pública por arboviroses: o caso do Zika vírus no Brasil. Saúde Debate. 2020;44(2):69-83.
• ²⁹
  Honório NA, Wiggins K, Eastmond B, Câmara DCP, Alto BW. Experimental Vertical Transmission of Chikungunya Virus by Brazilian and Florida Aedes Albopictus Populations. Viruses. 2019;11(4):353-65.
• ³⁰
  Ribeiro Cruz AC, Pinto NNJ, Patroca SS, Vieira PSE, Galvão Pereira JG, Maia SM, et al. Chikungunya virus Detection in Aedes aegypti and Culex quinquefasciatus during an Outbreak in the Amazon Region. Viruses. 2020;12(8):853-64.
• ³¹
  Martins VEP, Alencar CH, Kamimura MT, de Carvalho Araújo FM, De Simone SG, Dutra RF, et al. Occurrence of Natural Vertical Transmission of Dengue-2 and Dengue-3 Viruses in Aedes aegypti and Aedes albopictus in Fortaleza, Ceará, Brazil. PLoS One. 2012;7(7):e41386.
• ³²
  Vilela APP, Figueiredo LB, dos Santos JR, Eiras AE, Bonjardim CA, Ferreira PC, et al. Dengue Virus 3 Genotype I in Aedes aegypti Mosquitoes and Eggs, Brazil, 2005-2006. Emerg Infect Dis . 2010;16(6):989-92.
• ³³
  Costa CF, Silva AV, Nascimento VA, de Souza VC, Monteiro DCDS, Terrazas WCM, et al. Evidence of vertical transmission of Zika virus in field-collected eggs of Aedes aegypti in the Brazilian Amazon. PLoS Negl Trop Dis . 2018;12(7):e0006594.
• ³⁴
  Comeau G, Zinna RA, Scott T, Ernst K, Walker K, Carrière Y, et al. Vertical Transmission of Zika Virus in Aedes aegypti Produces Potentially Infectious Progeny. Am J Trop Med Hyg. 2020;103(2):876-83.
• ³⁵
  Lisboa TR, et al. Relação entre incidência de casos de arboviroses e a pandemia da COVID-19. Interdisciplinary Journal of Applied Science, v. 6, n. 10, p. 31-36, 2022.
• ³⁶
  Da Silva TSL, Barbosa DAM, Do Vale G, Lisa A. Chikungunya na pandemia da COVID-19, o que aconteceu? Uma revisão integrativa. Research, Society and Development, v. 12, n. 6, p. e10112642015-e10112642015, 2023.
• ³⁷
  Ministério da Saúde (MS). Secretaria Municipal de Saúde da Prefeitura de Goiânia. Sistema Nacional de Vigilância em Saúde - Relatório de Situação: Boletim Epidemiológico. Goiânia. 40ª edição. Goiás. MS; 2023. 1 p.
• ³⁸
  Cecílio AB, Campanelli ES, Souza KPR, Figueiredo LB, Resende MC. Natural vertical transmission by Stegomyia albopicta as dengue vector in Brazil. Braz J Biol. 2009;69(1):123-7.
• ³⁹
  Ministério da Saúde (MS). Secretaria Municipal de Saúde da Prefeitura de Goiânia. Sistema Nacional de Vigilância em Saúde - Relatório de Situação: Boletim Epidemiológico. Goiânia. 52ª edição. Goiás. MS; 2021. 1 p.
• ⁴⁰
  Rosen L. Mechanism of vertical transmission of the dengue virus in mosquitoes. C R Acad Sci III. 1987;13(304):347-50.
• ⁴¹
  Joshi V, Mourya DT, Sharma RC. Persistence of dengue-3 virus through transovarial transmission passage in successive generations of Aedes aegypti mosquitoes. Am J Trop Med Hyg . 2002;67(2):158-61.
• ⁴²
  Curcio JS de, Silvia MS-I, Neto LMP, Nunes EBEASL. Detection of Mayaro virus in Aedes aegypti mosquitoes circulating in Goiânia-GoiásBrazil. Microbes Infect. Published online 2022.
• ⁴³
  Gibrail MM, Fiaccadori FS, Souza M, Almeida TN, Chiang JO, Martins LC, et al. Detection of antibodies to Oropouche virus in non-human primates in Goiânia City, Goiás. Rev Soc Bras Med Trop. 2016;49(3):357-60.
• ⁴⁴
  Pinheiro FP, Hoch AL, Gomes ML, Roberts DR. Oropouche virus. IV. Laboratory transmission by Culicoides paraensis Am J Trop Med Hyg . 1981;30(1):172-6.
• ⁴⁵
  McGregor BL, Connelly CR, Kenney JL. Infection, Dissemination, and Transmission Potential of North American Culex quinquefasciatus, Culex tarsalis, and Culicoides sonorensis for Oropouche Virus. Viruses. 2021;13(2):226-37.
• ⁴⁶
  Pereira-Silva JW, Ríos-Velásquez CM, Lima GR, Dos Santos MEF, Belchior HCM, Luz SLB, et al. Distribution and diversity of mosquitoes and Oropouche-like virus infection rates in an Amazonian rural settlement. PLoS One . 2021;16(1):e0246932.
• ⁴⁷
  Araújo HR, Carvalho DO, Ioshino RS, Costa-da-Silva AL, Capurro ML. Aedes aegypti control strategies in Brazil: incorporation of new technologies to overcome the persistence of dengue epidemics. Insects. 2015;6(2):576-94.

• Financial Support: Program of Academic Cooperation in National Defense (PROCAD) - process 88887.387750/2019-00/TED Nº8764786/2021.CNPq.

Publication Dates

• Publication in this collection
  23 Feb 2024
• Date of issue
  2024

History

• Received
  26 June 2023
• Accepted
  10 Nov 2023