Characterisation of an area of coexistent visceral and cutaneous leishmaniasis transmission in the State of Piauí, Brazil

Abstract

BACKGROUND

In Brazil, transmission of visceral and cutaneous leishmaniasis has expanded geographically over the last decades, with both clinical forms occurring simultaneously in the same area.

OBJECTIVES

This study characterised the clinical, spatial, and temporal distribution, and performed entomological surveillance and natural infection analysis of a leishmaniasis-endemic area.

METHODS

In order to characterise the risk of leishmaniasis transmission in Altos, Piauí, we described the clinical and socio-demographic variables and the spatial and temporal distribution of cases of American visceral leishmaniasis (AVL) and American cutaneous leishmaniasis (ACL) cases and identified potential phlebotomine vectors.

FINDINGS

The urban area concentrated almost 54% of ACL and 86.8% of AVL cases. The temporal and spatial distribution of AVL and ACL cases in Altos show a reduction in the number of risk areas, but the presence of permanent disease transmission foci is observed especially in the urban area. 3,808 phlebotomine specimens were captured, with Lutzomyia longipalpis as the most frequent species (98.45%). Of the 35 females assessed for natural infection, one specimen of Lu. longipalpis tested positive for the presence of Leishmania infantum and Leishmania braziliensis DNA.

MAIN CONCLUSION

Our results indicate the presence of risk areas for ACL and AVL in the municipality of Altos and highlight the importance of entomological surveillance to further understand a possible role of Lu. longipalpis in ACL transmission.

Key words:
sand flies; vector-borne disease; cutaneous leishmaniasis; natural infection

Leishmaniasis are worldwide distributed anthropozoonosis caused by protozoan parasites of the Leishmania genus, with high prevalence in the Americas. One of the the six most relevant neglected diseases in the world, leishmaniasis are a group of diseases caused by Leishmania protozoan parasites that usually manifests as two distinct clinical forms: cutaneous leishmaniasis (CL), and visceral leishmaniasis (VL).

In Brazil, an increasing distribution and urbanisation have been observed in all regions of the country but still lack effective prevention and control policies for interrupting transmission.^1,2,3 Global climate changes in addition to the emergence of new and complex epidemiological scenarios resulting from human intervention of the environment, have contributed to dissemination to new areas.^4,5

In Piauí State, located in the northeast of Brazil, American VL (AVL) is endemic and was documented for the first time in 1934. Environmental changes combined with migratory flows, resulted in a process of disease urbanisation.^6,7 Figueiredo et al.⁸ demonstrated that habitations in urban areas surrounded by vegetation had higher number of seropositive dogs for Leishmania infantum infection and the proximity to places with denser vegetation favours the interaction between the wild and peridomestic parasite transmission cycles and provides better conditions for the maintenance of sand fly populations, the vector of Leishmania parasites.

The occurrence of American CL (ACL) outbreaks has been recently reported, with the identification of species of sand flies captured by entomological surveys in distinct municipalities.^9,10 Despite the growing number of ACL cases in Piauí, the species of Leishmania responsible for causing cutaneous lesions has not been identified.¹¹

Batista et al.¹¹ described for the first time the occurrence of ACL in Piauí, with the highest number of cases reported in 2010 and the predominant involvement of adult men, suggesting a possible occupational exposure. In 2014, there were 78 reported cases of ACL in the state. Although Brazil reported a 34% reduction in the incidence of cutaneous leishmaniasis in 2016,¹² the municipality of Altos in Piauí State reported an increase in ACL cases in the last two years, suggesting a failure in the control strategies, the capacity of vector adaptation and increased population exposure to the risk of infection. Previous studies by our group have already demonstrated the presence of the main vectors of ACL, Nyssomyia whitmani, and of AVL, Lutzomyia longipalpis, captured in the peridomicile of both urban and rural areas of Altos.¹³ As an urban area with remained rural activity and with the constant appearance of ACL cases, the city of Altos has been chosen to further characterise the eco-epidemiology of the disease including the vectors involved, the circulating parasites and possible reservoirs.

The occurrence of the two leishmaniasis clinical forms in the same area deserves attention from the scientific community and health professionals. Epidemiological analysis and the spatial distribution of ACL and AVL cases in conjunction with the identification of sand fly vectors will contribute to the understanding of Leishmania spp. transmission in the municipality of Altos and may be used to guide prevention and control actions.

MATERIALS AND METHODS

Study design and study area - This is a descriptive study, based on retrospectively collected secondary data on the ACL and AVL cases recorded in the municipality of Altos, in Piauí (Fig. 1). The research was implemented in the municipality of Altos, located in the Entre Rios territory, with an estimated population of 39,715 inhabitants, 957,655 km² of land area and 40.54 inhabitants per km². Located at an altitude of 180 m above sea level, it has an average temperature of 30ºC, with a warm and tropical climate. The average annual rainfall varies from 800 to 1600 mm, with five to six rainy months with a dry season. The months of February, March and April correspond to the wettest quarter in the region [Supplementary data (Fig. 1)].¹⁴

Fig. 1:
description of the municipality of Altos, Piauí State, Brazil. Map showing the location of the municipality and its urban and rural areas.

Study population and data source - The data on the confirmed cases of ACL and AVL from 2008 to 2018 were obtained from SINAN¹⁵ the disease notification system available at the Municipal Health Department of Altos and after authorisation from the ethics committee. Notification forms cover several variables, such as: sociodemographic, epidemiological, case evolution and autochthony. The variables used included date of notification, date of birth, age, gender, education, city, and district of residence, clinical manifestations, human immunodeficiency virus (HIV) co-infection, parasitological and immunological diagnosis, type of entry, initial drug choice for treatment, possible location of the infection source and case evolution. Most variables were categorical, except age, month and year of occurrence, that were continuous.

Spatial and temporal distribution analysis - The human cases spatial analysis was performed to define areas with higher incidence of leishmaniasis and to compare ACL and AVL distribution (Fig. 2). The addresses were geocoded using the Global Positioning System (GPS). These data were used in the construction of ACL and AVL spatial distribution maps. Kernel maps were used to assess the density distribution of cases of both diseases in the region. A comparison between the temporal distributions of ACL and AVL cases were performed using Kernel ratio maps.

Fig. 2:
distribution of leishmaniasis cases in urban and rural areas of Altos. Map showing the localised cases of American cutaneous leishmaniasis (ACL) and American visceral leishmaniasis (AVL). The map shows the vegetation characteristics of the region and the type of soil of the studied area.

Lesions and histopathological analyses of ACL patients - Cases of ACL in Altos were identified by physical examination and laboratory diagnosis. Two patients were followed during diagnosis and treatment and images from the lesion before and after treatment were obtained. A biopsy was performed in both patients before treatment to confirm the presence of parasites in the lesion. The tissue specimen was fixed in formalin and placed in paraffin. Histological sections were stained with HE (hematoxylin and eosin) and analysed in an optical microscope.

Sand flies’ collection and identification - Sand flies were collected from January/2019 to January/2020 and January/2021 to December/2021 using CDC light traps during the night, placed in the peridomicile (hen house, pigsty, and stables) and intradomicile of houses situated in urban and rural areas with high incidence of cases. According to the municipality of Altos, urban areas are characterised by a high population density, continuous presence of construction and urban infrastructure. Meanwhile, Alto’s rural zone corresponds to a set of primary activities (especially agriculture activities), practiced in areas not occupied by a large population density. Although, there is an official limit between urban and rural zones, some neighbourhoods included in the urban area (newly constructed houses and buildings) that are far from the initial urban infrastructure, are considered an urban area. We had a total of 667 hours of collection effort, five months out of the 25 months had no collection. At least two residences per neighbourhood with at least three traps, twice a week for one week per month were sampled. The geographic coordinates were obtained with a portable GPS navigator (Garmin^®) for geocoding the homes of individuals with both AVL and ACL cases (Fig. 1). The same place was used to set the traps to capture sand flies. Climatic variables such as temperature and relative humidity were obtained using a thermo-hygrometer and rainfall data was obtained from the National Institute of Meteorology (INMET) database. Sand flies were separated and fixed in alcohol 70%, mounted on a glass slide using Berlese liquid. Identification was based on the classification method of Galati et al. and the abbreviation of genus and subgenus based on previous work.^16,17 After morphological identification, the female’s abdomen was placed in tubes according to its species for molecular study to identify infection by Leishmania spp.

Molecular detection of Leishmania DNA in sand flies and parasite species identification - A sampling of non-engorged females was randomly selected for the individual analysis of Leishmania DNA detection. For this, the DNA of each sand fly was extracted and submitted to a multiplex PCR assay following a previously established protocol.¹⁸ The assay can simultaneously amplify the conserved region of kDNA minicircles of the Leishmania genus¹⁹ and the IVS6 region of the cacophony gene of neotropical sand flies;²⁰ the latter acts as an internal control and DNA yield and purity.¹⁸ Male sand flies were included as negative controls for DNA extraction.

After confirming the DNA detection of Leishmania genus among female sand flies, the parasite species identification was performed by nested-polymerase chain reaction (PCR) amplification of the Leishmania hsp70 (hsp70C reverse: 5’ GGA CGA GAT CGA GCG CAT GGT 3’ and hsp70C forward: 5’ TCC TTC GAC GCC TCC TGG TTG 3’), generating a 234 bp fragment, as previously described.²¹ In the second round of amplification of the 234 bp product, the hsp70C reverse primer and a new forward primer 5’ (hsp70F2 GGA GAA CTA CGC GTA CTC GAT GAA G3’) were used, generating an internal 144 bp region of the Leishmania hsp70 gene.²² The 144 bp product was cloned using pGEM^®-T Easy Vector Systems (Promega, Madison, USA) according to manufacturer’s recommendations. Recombinant plasmids were subjected to DNA extraction using the commercial PureLink Quick Plasmid DNA Miniprep kit (Invitrogen, Carlsbad, USA), following manufacturer’s protocol, and submitted to sequencing.

Sequencing was performed using BigDye™ Terminator v3.1 Cycle Sequencing Ready Reaction kit (Applied Biosystems, Foster City, USA), in the Sanger ABI 3730XL sequencing platform at Fiocruz-RJ. Consensus sequences were obtained and edited using the software package Phred/Phrap/Consed version: 0.020425.c (University of Washington, Seattle, USA). Sequences with Phred values above 20 were used as contigs and were assembled and aligned in MEGA5 software.²³ Sequences were evaluated against NCBI nr database using BLASTn.

Statistical analysis - The chi-squared test was used to assess differences between categorical variables. Statistical significance was established when p < 0.05. For calculation of incidence, annual projections from DATASUS and IBGE (Brazilian Institute of Geography and Statistics) were used. The softwares QGIS 3.10 and TerraView were used for the geospatial analysis.

Ethics - The epidemiological data and addresses were obtained from the Municipal Health Department of Altos - Piauí. The data available for this research are not freely accessible. The participants are committed to data confidentiality according to the commitment term for data use. Only secondary data were used through the SINAN database preserving the identification of patients. This project was submitted to the Research Ethics Committee (CEP) of the Oswaldo Cruz Institute (IOC) and was approved under CAAE number 28217119800005248. The project was also submitted to the Biodiversity Authorisation and Information System (SISBIO), for legal authorisation to collect wild animals, approved under number 61837-1.

RESULTS

Socio-demographic data of ACL and AVL cases in Altos - There was a small variation on the socio-demographic variables distribution among ACL cases in Altos (Table I). Almost no variation was observed for gender and the most affected age groups were the elderly and people between 41 and 50 years of age. The analysed group had low education, with 72.9% of reported cases with only incomplete or complete primary education, and 10.2% were illiterate. The urban area concentrated almost 54% of notified ACL cases.

TABLE I
Socio-demographic characteristics from patients with American cutaneous leishmaniasis (ACL) and American visceral leishmaniasis (AVL) in Altos, between 2008 and 2018

Variables	ACL (nº/%)	AVL (nº/%)	Total (nº/%)	p-value
Gender
Male	85(51.21)	19(50.00)	104(50.98)	1.00
Female	81(48.79)	19(50.00)	100(49,02)
Residence zone
Urban	89(53.61)	33(84.22)	122(59.80)	< 0.001
Rural	77(46.39)	5(15.78)	82(40.20)
Age groups (years)
≥ 20	28(16.87)	23(60.53)	51(25.00)	< 0.001
21 - 30	17(10.24)	3(7.89)	20(9.80)
31 - 40	24(14.46)	5(13.16)	29(14.22)
41 - 50	35(21.08)	1(2.63)	36(17.65)
51 - 60	26(15.66)	2(5.26)	28(13.73)
> 60	36(21.69)	4(10.53)	40(19.60)
Education
Illiterate	18(10.84)	3(7.9)	21(10.29)	< 0.001
Junior school	121(72.90)	10(26.3)	131(64.22)
High school	17(10.24)	2(5.3)	19(9.31)
Higher education	5(3.01)	0(0)	5(2.45)
Unknown	5(3.01)	23(60.5)	28(13.73)

• n: number.

Concerning AVL cases, there was similar numbers of men and women notified. The most affected age group was under twenty, corresponding to 60.5% of confirmed cases, followed by the group from 31 to 40 years (13.2%). Regarding education, 60.5% of cases did not give this information what compromised assessment of this indicator. The urban area presented almost all the confirmed cases, with 86.8% of the notified patients (Table I).

Clinical data of ACL and AVL cases in Altos - Regarding ACL in the municipality of Altos, 97.6% of cases were classified as cutaneous lesions, with occasional occurrences of mucosal lesions. The clinical epidemiological classification criteria was the most used diagnostic method (72.3% of cases). Among the laboratory methods, Montenegro’s intradermal reaction was the most used method to confirm the disease, corresponding to 18.7% of all cases. Although few histopathological exams were performed (only 2,4%), the presence of parasites were confirmed in the ulcerated lesions from the evaluated patients. One patient presented a cutaneous lesion on the ear with severe ulceration on the extremity observed before treatment (Fig. 3A). After treatment the lesion showed an extensive, nodular, and ulcerated skin (Fig. 3B). Before treatment the epidermis exhibited irregular acanthosis and a marked lymphohistiocytic inflammatory infiltrate in the dermis (Fig. 3C). A typical ACL manifestation showing a single ulcerated lesion with elevated borders, granular centre is observed in another patient’s forearm (Fig. 3D). After treatment, the presence of a scar indicated lesion resolution (Fig. 3E). Before treatment, the lesion presented a chronic inflammatory process with vacuolated cells containing an amastigote form (black circle) of Leishmania spp. (Fig. 3F). The lesion histopathological findings also indicated an accentuated irregular acanthosis and the superficial and middle dermis with a marked inflammatory infiltrate. In addition, the presence of neutrophil exocytosis in the epidermal layer was observed, configuring a typical finding in lesions caused by Leishmania spp. [Supplementary data (Fig. 2A)]. The dermis and subcutaneous tissue contained a lymphohistiocytic inflammatory infiltrate, and granulomas containing Langerhans multinucleated giant cells [Supplementary data (Fig. 2B-C)]. The drug of first choice for treatment of most patients was the pentavalent antimony [Supplementary data (Table I)]. There was a low percentage of co-infection with HIV, only positive in two out of the 166 cases. However, the number of cases that were not tested for HIV was significant (eight cases). Regarding the therapeutic evolution, 99.4% of cases progressed to cure and there was one case of transfer. There was no record of deaths from ACL during the period investigated [Supplementary data (Table I)].

Fig. 3:
American cutaneous leishmaniasis (ACL) lesions in patients from Altos, Piauí. (A) Cutaneous lesion on the ear with intense ulceration on the extremity. (B) Extensive, nodular, ulcerated skin lesion after treatment. (C) Biopsy of the patient’s ear before treatment with epidermis exhibiting irregular acanthosis. In the dermis there is a marked lymphohistiocytic inflammatory infiltrate. (HE, 20X). (D) Single ulcerated lesion with high borders, granular base, on the patient’s forearm. (E) Appearance of the lesion after treatment. (F) Chronic inflammatory process with vacuolated cells containing an amastigote form (black circle) of Leishmania sp. (HE, 1000X).

The clinical data of AVL cases show that 94.7% of registered cases were notified as new cases and there were two cases classified as recurrence. Among the clinical manifestations, the most frequent was fever (97.3%) followed by weakness, enlarged spleen, pallor, enlarged liver and weight loss. Symptoms such as jaundice, cough, oedema, infection, and haemorrhage were observed in a smaller proportion, although relevant in terms of severity and clinical outcome. The most used diagnostic method was parasitological, used in 50% of cases, followed by clinical epidemiological, with 39.5% and immunological, with 10.5%. The most used initial drug was the pentavalent antimony, in 47.4% of the cases, while amphotericin B and liposomal amphotericin B corresponding to 28.9% and 23.7% of cases, respectively. Coinfection with HIV was detected in 7.9% of cases, but it is worth mentioning the percentage of patients that did not have this information (7.9%). Although the clinical outcome was cure for the largest percentage of patients, representing 73.7%, the fatality rate from AVL was 15.8% [Supplementary data (Table II)].

Spatial and temporal ACL and AVL cases in Altos - Regarding the spatial and temporal results of temporal distribution of AVL cases from 2008 to 2018, the maps indicated that there was also a heterogeneous distribution with high transmission foci in the years 2013 to 2015 (Fig. 4A). The spatial distribution of ACL cases was heterogeneous over the years. Although most areas were of low transmission intensity, there were areas with higher intensity of ACL cases, located in the northeast region of the city, from 2008 to 2012, mainly at the neighbourhoods of Ciana, Bacurizeiro, Batalhão and Centro, all located in the urban areas of Altos (Fig. 4B). The neighbourhoods of Tranqueira, Carrasco and São Luís, all located in urban areas in the northwest region of the city, presented the highest intensity of AVL reported cases over the studied years (Fig. 5A).

Fig. 4:
temporal distribution of leishmaniasis cases in the urban and rural areas of Altos, Piauí State, Brazil, 2008-2018. (A) AVL, American visceral leishmaniasis cases and the remote sensing of vegetation areas. (B) ACL, American cutaneous leishmaniasis cases and the remote sensing of vegetation areas.

Fig. 5:
spatial distribution of leishmaniasis in the urban and rural areas of Altos, Piauí State, Brazil, 2008-2018. (A1, A2) AVL, American visceral leishmaniasis clinical forms and the density of cases. (B1, B2) ACL, American cutaneous leishmaniasis clinical forms and the density of cases. Numbers indicate the following neighbourhoods: 1. Bacurizeiro, 2. Baixão do São José, 3. Baixão dos Paivas, 4. Batalhão, 5. Boa Fé, 6. Boca de Barro, 7. Carrasco, 8. Centro 9. Ciana, 10. Leite, 11. Maravilha, 12. Matadouro, 13. Santa Inês, 14. Santo Antônio, 15. São Luiz, 16. São Sebastião, and 17. Tranqueira.

Sand fly population and natural infection - The total number of captured sand fly specimens was 3,808 (69 females and 3,739 males) composed of 98.45% of Lu. longipalpis, the natural vector of AVL, in a ratio of 106,11 males for each female. We also captured 56 specimens of Ny. whitmani, the natural vector of ACL,²⁴ in a ratio of 0.64 males for each female, and three (03) male specimens of Evandromyia lenti (Table II). Eighty-six percent (86.3%) of the traps had captured sand flies, with positive collections in all neighbourhoods of the municipality during the almost two years of collection.

Most female sand flies were captured in the urban area of Altos. A total of 35 (20 non-engorged and 15 engorged) females were captured for evaluation of natural infection by Leishmania spp. [Supplementary data (Table III)].

TABLE II
Species of sand flies captured in the municipality of Altos / Piauí

Species	Sex n (%)
	Male	Female	Total	Ratio
Lutzomyia longipalpis	3.714 (97,53)	35 (0,92)	3.749 (98,45)	106,11
Nyssomyia whitmani	22 (0,58)	34 (0,89)	56 (1,47)	0,64
Evandromyia lenti	3 (0,08)	0 (0)	3 (0,08)	0
Total	3.739 (98,19)	69 (1,81)	3.808 (100)	54,18

• n: number.

Of note, one sand fly tested positive to natural infection by multiplex PCR assay, and subsequently submitted to genotyping by cloning and sequencing of the hsp 70 gene. Sequencing results identified this female sand fly harbouring two species of parasites: L. infantum, the etiological agent of AVL, and L. braziliensis, etiological agent of ACL (Table III). Our protocol uses the kDNA as target for detecting DNA of the Leishmania genus in sand flies due to its high sensitivity.¹⁸ The hsp 70 gene is used to genotype the parasite following a positive kDNA result. Considering that the hsp 70 gene is present in low copy numbers in the Leishmania genome, it is not an ideal target for parasite DNA screening in the vector. So, for the correct detection and identification of Leishmania spp. in sand flies, a first detection step is necessary using PCR directed to kDNA and after, the parasite genotyping by nested-PCR of the hsp 70 gene, followed by cloning and sequencing of an internal fragment of this gene.²⁵

TABLE III
Detection of natural infection of sand flies by Leishmania spp.

Samples	Sequence	Description	Scientific name	Max score	Total score	Query cover	value	Per. ident	Accession
S - 62 clone 1	GGAGAACAACGCGTACTCGATGAAGAACACGCTCGGCGACTCGAACGTGTCCGGCAAGCTGGACGATAGCGACAAGGCCACGCTGAACAAGGAGATCGACGTGACGCTGGAGTGGCTGAGCAGCAACCAGGAGGCGTCGAAGG	Leishmania infantum isolate ph06 putative heat-shock protein hsp70 gene, partial cds	Leishmania infantum	254	254	100%	3E-63	98.60%	MF137828.1
S - 62 clone 2	AATTCGATTGGAGAACTACGCGTACTCGATGAAGAACACGGTCTCCGACACGAACGTGTCCGGCAAGCTGGAGGAGAGCGACAGGTCCGCGCTGAACTCGGCGATCGACACGGCGCTGGAGTGGCTGAACAGCAACCAGGAGGCGTCGAAGGAAAT	Leishmania braziliensis voucher LBCE 18678 heat shock protein 70 (HSP70) gene, partial cds	Leishmania braziliensis	270	270	93%	3E-68	100.00%	MN395479.1

• Max: maximum; Per: percentage; Ident: identity.

Sand fly distribution in the urban area of the city, showed males and females scattered in several neighbourhoods, both at the most central and peripheral areas. More specimens of Lu. longipalpis were collected compared to the other species (Fig. 6). The presence of Ny. whitmani was detected in the peri-urban neighbourhood bordering the rural area, and rural area with closed and dense forest vegetation, characteristic of the São Bento locality (Fig. 6). Although not statistically significant, it is possible to notice a positive correlation between the number of Ny. whitmani males and variables such as temperature and rainfall and a negative correlation with relative humidity, demonstrating that the decrease in humidity and the increase in rainfall and temperature could influence the abundance of this species [Supplementary data (Table IV)]. Between January 2019 and January 2021, the vector density was higher at the end of the rainy season, corresponding to the months of May and June (2020), with the predominance of Lu. longipalpis, representing 98.45% of specimens (3749/ 3808) [Supplementary data (Fig. 1)].

Fig. 6:
evaluation of sand flies distribution in the rural and urban areas of Altos, Piauí State, Brazil. (A) Lutzomyia longipalpis male prevalence in the rural area. As the circle increases, the greater is the number of sand flies captured. (B) Lu. longiplapis male prevalence in urban area. (C) Nyssomyia whitmani male prevalence in rural area. (D) Presence of both Lu. longipalpis and Ny. whitmani in the urban area with a prevalence of Lu. longipalpis.

The dispersion distance of sand flies can vary between 200 m and 800 m, so we constructed a potential buffer distance of 800 m around the areas of positive collection points for the presence of Lu. longipalpis. Importantly, both ACL and AVL cases are located within the potential buffer distance of Lu. longipalpis dispersion (Fig. 7). This correlation between flight dispersion distance of Lu. longipalpis and the location of AVL cases reinforce the active transmission of AVL in the municipality of Altos. The registered cases of ACL and AVL are located within the potential flight dispersion distance of Lu. longipalpis.

Fig. 7:
potential buffer distance of Lutzomyia longipalpis dispersion in the rural and urban areas of Altos, Piauí State, Brazil. Potential buffer distance of Lu. longipalpis dispersion in areas of (A) human visceral leishmaniasis occurrence and (B) human American cutaneous leishmaniasis (ACL) occurrence.

DISCUSSION

This study demonstrated and further characterised the transmission of AVL and ACL in Altos, a small town with an ongoing urbanisation process.¹¹ Altos is the second municipality in Piauí State in the number of settlements registered in the National Institute of Colonisation and Agrarian Reform (INCRA), indicating an increased human occupation of natural areas and consequent exposure to potential vectors. The growing urbanisation process combined with disorderly occupation and predatory exploitation of the environment, in addition to limited access to treatment and lack of sanitation can contribute to the prevalence of leishmaniasis.^1,6,7 The transmission of Leishmania involves an environment that promotes close interactions of different species of sand flies, hosts and reservoirs that increases with urbanisation.⁶

ACL and AVL cases in Altos indicate that the disease affects both men and women similarly. This data is in accordance with previous studies, reported in Paraná State²⁶ and in the city of Barbalha, in the northeast of Brazil.²⁷

The most frequent clinical manifestations of patients with AVL were fever, weakness, enlargement of the spleen and liver. These results are in accordance with a study performed in Campo Grande where fever, splenomegaly and hepatomegaly were present in 95%, 85% and 78% of AVL cases, respectively. Fever and hepatosplenomegaly were present in 69% of cases.²⁸ In an endemic area for AVL in Maranhão, the most reported symptom was also fever, in 97.7% of the cases. The parasitological diagnosis with parasite visualisation was performed in 53.7% of cases.

Patients with ACL present ulcerated lesions with hyperplasia, ulceration, inflammation, and a dense and diffuse dermal infiltrate with identification of amastigote forms of the parasite, typical findings in ACL lesions.^29,30,31 Although almost all ACL cases were characterised by an ulcer with elevated borders, it is worth emphasising the epidemiological importance of occurrence of mucocutaneous cases in Altos considering its potential for tissue destruction, deformity, and impact on the quality of life of those affected. The percentage of mucocutaneous cases was lower than the national average (5.56%) in 2018 and other endemic countries such as Spain (11%) and Nicaragua (10%).^32,33 Late diagnosis still represents a major limitation for both ACL and AVL treatment and control. The reported cases of ACL were diagnosed based on clinical and epidemiological criteria, in contrast to other endemic areas, where laboratory methods are the reference method for disease diagnosis.^27,34 Although we have not identified the Leishmania species responsible for ACL cases, we detected a vector harbouring both L. infantum and L. braziliensis, responsible for AVL and ACL cases, respectively. However, at this moment, we cannot exclude the possibility of L. infantum causing cutaneous lesions. Cases of cutaneous leishmaniasis caused by L. infantum are not common but have been previously reported in Brazil and Turkey.^35,36,37,38

Pentavalent antimony was chosen for the initial therapy for most cases, and still represents the first choice of treatment for ACL and AVL considering the reduced therapeutic options available for this treatment.³⁹ Today, miltefosine is the first line of treatment for ACL, characterised by better results regarding the outcome of cure and less toxicity compared with pentavalent antimony.⁴⁰

The temporal and spatial distribution of AVL and ACL cases in Altos show a reduction in the number of risk areas, but the presence of permanent disease transmission foci is observed especially in the urban area. This observation highlights the epidemiological importance of control strategies.^26,34 Determination of AVL and ACL cases clusters can provide important information to guide active surveillance and decrease transmission of both diseases. This was observed in a previous study in Acre state, Brazil. Analysis of the spatial distribution of ACL cases, showed a decreasing trend in the number of cases over the years, with high-risk clusters in six municipalities, concentrating 67% of ACL cases.³⁴

Here, we show that the collected sand fly species were Lu. longipalpis, Ny. whitmani and Ev. lenti. Importantly, we detected the presence of DNA from two different parasites species, L. braziliensis and L. infantum, in a Lu. longipalpis female sand fly. Several sand fly species have been described as vectors of L. braziliensis and there is evidence of its susceptibility to L. braziliensis infection demonstrated in laboratory reared sand flies.^38,41Lu. longipalpis is responsible for the establishment of L. infantum in Latin America but it is also considered a permissive vector, supporting development of different Leishmania species under experimental conditions.^42,43,44 The detection of L. braziliensis’ DNA in Lu. longipalpis has been previously described in the South-Easten region of Brazil as well as in laboratory conditions, where 70% of Lu. longipalpis females developed late-stage L. braziliensis.^45,46 Although our results indicate that Lu. longipalpis is the most abundant vector in the area we do not have enough evidence to incriminate Lu. longipalpis as a new vector of ACL.

In nature, the dispersion distance of sand flies can vary between 200 m and 800 m.⁴⁷ In the municipality of Altos, we analysed the potential buffer distance of dispersion surrounding the sand fly positive collection areas with the presence of Lu. longipalpis. The analysed map from 2008 to 2018 showed more cases of ACL than AVL, where most of ACL cases occurred within the Lu. longipalpis buffer distance of dispersion, both in urban and rural areas. This information suggests that transmission of L. braziliensis in this region might have a participation of Lu. longipalpis since the number of Ny. whitmani captured was low. However, we cannot exclude the possibility of the low number of Ny. whitmani and the high male:female ratio of the species captured to be related to the field sampling methodology used and the distinct characteristics and biodiversity of the studied area.⁴⁸Ny. whitmani is known to be important for the sylvatic cycle of ACL transmission in the north of Brazil but it can invade the human habitat and adapt to spaces altered by man, frequently detected in anthropic environments in the Northeast region.^49,50 In Altos, Ny. whitmani was frequently detected in rural areas but a small number could be captured in urban areas suggesting adaptation to the peridomiciliary environment.⁵¹ More recently, this sand fly species was also identified in Teresina, the capital of Piauí, and other regions of the state.⁹ Taken together, our results characterise the dynamics of the sand fly populations and contributed to the understanding of ACL epidemiology and transmission in an endemic area where AVL and ACL are both present. The evidence that Lu. longipalpis and Ny. whitmani coexist in this area emphasises the importance of further investigations to reinforce the detection of natural infections. Since Lu. longipalpis can be experimentally infected with L. infantum and L. braziliensis producing infective forms, investigation of the possibility of L. braziliensis transmission by Lu. longipalpis is critical in an area with favourable conditions for the spreading of leishmaniasis. Moreover, the establishment of an efficient method of diagnosis in the initial stages of the disease is important since leishmaniasis persistence is often related to late diagnosed cases or incomplete treatment of ACL lesions.^52,53

The presence of ACL and AVL transmission highlights the urgency of planning and executing more active health policies for entomological surveillance, prevention, and control of leishmaniasis in the municipality.

ACKNOWLEDGEMENTS

To the Fundação Municipal de Saúde de Altos, Piauí, for all the support.

REFERENCES

• ¹
  Alvar J, Vélez ID, Bern C, Herrero M, Desjeux P, Cano J, et al. Leishmaniasis worldwide and global estimates of its incidence. PLoS One. 2012; 7: e35671.
• ²
  WHO - World Health Organization. Leishmaniasis. In: World Health Organization [Internet]. 2022 [cited 22 Aug 2022]. Available from: https://www.who.int/news-room/fact-sheets/detail/leishmaniasis
  » https://www.who.int/news-room/fact-sheets/detail/leishmaniasis
• ³
  Werneck GL. Forum: geographic spread and urbanization of visceral leishmaniasis in Brazil. Introduction. Cad Saude Publica. 2008; 24: 2937-40.
• ⁴
  Fonseca ES, D'Andrea LAZ, Taniguchi HH, Hiramoto RM, Tolezano JE, Guimaraes RB. Spatial epidemiology of American cutaneous leishmaniasis in a municipality of west Sao Paulo State, Brazil. J Vector Borne Dis. 2014; 51(4): 271-5.
• ⁵
  Duarte RV, Monteiro JCL, Cruz TC, Ribeiro LM, Morais MHF, Carneiro M, et al. Influence of climatic variables on the number of cases of visceral leishmaniasis in an endemic urban area. J Glob Health Econ Policy. 2022; 2: e2022011.
• ⁶
  Costa CHN, Pereira HF, Araújo MV. Epidemia de leishmaniose visceral no Estado do Piauí, Brasil, 1980-1986. Rev Saude Publica. 1990; 24: 361-72.
• ⁷
  Costa CHN, Vieira JBF. Mudanças no controle da leishmaniose visceral no Brasil. Rev Soc Bras Med Trop. 2001; 34: 223-8.
• ⁸
  Figueiredo ABF, Werneck GL, Cruz MSP, Silva JP, Almeida AS. Uso e cobertura do solo e prevalência de leishmaniose visceral canina em Teresina, Piauí, Brasil: uma abordagem utilizando sensoriamento remoto orbital. Cad Saude Publica. 2017; 33(10): e00093516.
• ⁹
  Andrade Filho JD, Silva ACL, Falcão AL. Phlebotomine sand flies in the State of Piauí, Brazil (Diptera: Psychodidae: Phlebotominae). Mem Inst Oswaldo Cruz. 2001; 96(8): 1085-7.
• ¹⁰
  Perez TD, Figueiredo FB, Velho Junior AAM, Silva VL, Madeira MF, Brazil RP, et al. Prevalence of American trypanosomiasis and leishmaniases in domestic dogs in a rural area of the municipality of São João do Piauí, Piauí State, Brazil. Rev Inst Med Trop Sao Paulo. 2016; 58: 79.
• ¹¹
  Batista FMA, Machado FFOA, Silva JMO, Mittmann J, Barja PR, Simioni AR. Leishmaniose: perfil epidemiológico dos casos notificados no Estado do Piauí entre 2007 e 2011. Revista UNIVAP. 2014; 20: 44-55.
• ¹²
  PAHO/WHO - Pan American Health Organization/World Health Organization. Leishmaniasis in the Americas. Recommendations for the treatment; 2018 - PAHO/WHO | Pan American Health Organization. In: PAHO [Internet]. 2018 [cited 6 Jun 2023]. Available from: https://www.paho.org/en/documents/leishmaniasis-americas-recommendations-treatment-2018
  » https://www.paho.org/en/documents/leishmaniasis-americas-recommendations-treatment-2018
• ¹³
  Vasconcelos SA. Identificação dos vetores da leishmaniose tegumentar americana em Altos, Estado do Piauí [Dissertação de Mestrado]. Rio de Janeiro: Fundação Oswaldo Cruz; 2017. Available from: https://www.arca.fiocruz.br/handle/icict/6877.
• ¹⁴
  IBGE - Instituto Brasileiro de Geografia e Estatística. Panorama de Altos - PI. In: IBGE [Internet]. 2021 [cited 31 Oct 2021]. Available from: https://cidades.ibge.gov.br/brasil/pi/altos/panorama
  » https://cidades.ibge.gov.br/brasil/pi/altos/panorama
• ¹⁵
  SINAN - Sistema de Informação de Agravos de Notificação. Doenças e Agravos de Notificação - De 2007 em diante (SINAN). Leishmaniose Tegumentar Americana. In: Sistema de Informação de Agravos de Notificação [Internet]. 2022 [cited 22 Jul 2022]. Available from: http://tabnet.datasus.gov.br/cgi/tabcgi.exe?sinannet/cnv/leishvbr.def
  » http://tabnet.datasus.gov.br/cgi/tabcgi.exe?sinannet/cnv/leishvbr.def
• ¹⁶
  Galati EAB. Morfologia e taxonomia: morfologia, terminologia de adultos e identificação dos táxons da América. In: Rangel EF, Lainson R, editors. Flebotomíneos do Brasil. Rio de Janeiro: Fiocruz; 2003. p. 53-175.
• ¹⁷
  Marcondes CB. A proposal of generic and subgeneric abbreviations for Phlebotomine sandflies (Diptera: Psychodidae: Phlebotominae) of the Word. Entomological News. 2007; 118: 351-6.
• ¹⁸
  Pita-Pereira D, Alves CR, Souza MB, Brazil RP, Bertho AL, Barbosa AF, et al. Identification of naturally infected Lutzomyia intermedia and Lutzomyia migonei with Leishmania (Viannia) braziliensis in Rio de Janeiro (Brazil) revealed by a PCR multiplex non-isotopic hybridisation assay. Trans R Soc Trop Med Hyg. 2005; 99: 905-13.
• ¹⁹
  Passos VMA, Lasmar EB, Gontijo CMF, Fernandes O, Degrave W. Natural infection of a domestic cat (Felis domesticus) with Leishmania (Viannia) in the metropolitan region of Belo Horizonte, State of Minas Gerais, Brazil. Mem Inst Oswaldo Cruz. 1996; 91(1): 19-20.
• ²⁰
  Lins RMMA, Oliveira SG, Souza NA, de Queiroz RG, Justiniano SCB, Ward RD, et al. Molecular evolution of the cacophony IVS6 region in sandflies. Insect Mol Biol. 2002; 11: 117-22.
• ²¹
  Graça GC, Volpini AC, Romero GAS, Oliveira Neto MP, Hueb M, Porrozzi R, et al. Development and validation of PCR-based assays for diagnosis of American cutaneous leishmaniasis and identification of the parasite species. Mem Inst Oswaldo Cruz. 2012; 107(5): 664-74.
• ²²
  Zampieri RA, Laranjeira-Silva MF, Muxel SM, Stocco de Lima AC, Shaw JJ, Floeter-Winter LM. High resolution melting analysis targeting hsp70 as a fast and efficient method for the discrimination of Leishmania species. PLoS Negl Trop Dis. 2016; 10: e0004485.
• ²³
  Tamura K, Dudley J, Nei M, Kumar S. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol. 2007; 24: 1596-9.
• ²⁴
  Costa SM, Cechinel M, Bandeira V, Zannuncio JC, Lainson R, Rangel EF. Lutzomyia (Nyssomyia) whitmani s.I. (Antunes & Coutinho, 1939) (Dipetra: Psychodidae: Phlebotominae): geographical distribution and the epidemiology of American cutaneous leishmaniasis in Brazil - Mini-review. Mem Inst Oswaldo Cruz. 2007; 102(2): 149-53.
• ²⁵
  Zhang Z, Schwartz S, Wagner L, Miller W. A greedy algorithm for aligning DNA sequences. J Comput Biol. 2000; 7: 203-14.
• ²⁶
  Melo HA, Rossoni DF, Teodoro U. Spatial distribution of cutaneous leishmaniasis in the state of Paraná, Brazil. PLoS One. 2017; 12: e0185401.
• ²⁷
  Grangeiro Jr CRP, Pimentel JVC, Teixeira Jr AG, Jesus AF, Galvão TCF, Souza LAA, et al. American cutaneous leishmaniasis in a northeast Brazilian city: clinical and epidemiological features. Rev Soc Bras Med Trop. 2018; 51: 837-42.
• ²⁸
  Furlan MBG. Epidemia de leishmaniose visceral no Município de Campo Grande-MS, 2002 a 2006. Epidemiol Serv Saude. 2010; 19(1): 15-24.
• ²⁹
  Handler MZ, Patel PA, Kapila R, Al-Qubati Y, Schwartz RA. Cutaneous and mucocutaneous leishmaniasis: differential diagnosis, diagnosis, histopathology, and management. J Am Acad Dermatol. 2015; 73(6): 911-26; 927-8.
• ³⁰
  Biddlestone LR, Hepburn NC, McLaren KM. A clinico-pathological study of cutaneous leishmaniasis in British troops from Belize. Trans R Soc Trop Med Hyg. 1994; 88: 672-6.
• ³¹
  Thomaz C, Mello CX, Espíndola OM, Shubach AO, Quintella LP, Oliveira RVC, et al. Comparison of parasite load by qPCR and histopathological changes of inner and outer edge of ulcerated cutaneous lesions of cutaneous leishmaniasis. PLoS One. 2021; 16: e0243978.
• ³²
  Garrido-Jareño M, Torralba-Sahuquillo A, Chouman-Arcas R, Castro-Hernandez I, Molina-Moreno JM, Llavador-Ros M, et al. Cutaneous and mucocutaneous leishmaniasis: experience of a Mediterranean hospital. Parasit Vectors. 2020; 13: 24.
• ³³
  Hernández-Bojorge SE, Blass-Alfaro GC, Rickloff MA, Gómez-Guerrero MJ, Izurieta R. Epidemiology of cutaneous and mucocutaneous leishmaniasis in Nicaragua. Parasite Epidemiol Control. 2020; 11: e00192.
• ³⁴
  Melchior LAK, Brilhante AF, Chiaravalloti-Neto F. Spatial and temporal distribution of American cutaneous leishmaniasis in Acre state, Brazil. Infect Dis Poverty. 2017; 6: 99.
• ³⁵
  Lyra MR, Pimentel MIF, Madeira MF, Antonio LF, Lyra JPM, Fagundes A, et al. First report of cutaneous leishmaniasis caused by Leishmania (Leishmania) infantum chagasi in an urban area of Rio de Janeiro, Brazil. Rev Inst Med Trop São Paulo. 2015; 57(5): 451-4.
• ³⁶
  Castro LS, França AO, Ferreira EC, Hans Filho G, Higa Júnior MG, Gontijo CMF, Pereira AAS, Dorval MEMC. Leishmania infantum as a causative agent of cutaneous leishmaniasis in the State of Mato Grosso do Sul, Brazil. Rev Inst Med Trop São Paulo. 2016; 58: 23.
• ³⁷
  Ok UZ, Balcioglu IC, Ozkan AT, Ozensoy S, Ozbel Y. Leishmaniasis in Turkey. Acta Trop. 2002; 84(1): 43-8.
• ³⁸
  Brazil RP. Biologia de flebotomíneos do Brasil. Flebotomíneos do Brasil. Rio de Janeiro: Editora Fiocruz; 2003. p. 257-74.
• ³⁹
  Pradhan S, Schwartz RA, Patil A, Grabbe S, Goldust M. Treatment options for leishmaniasis. Clin Exp Dermatol. 2022; 47: 516-21.
• ⁴⁰
  Rubiano LC, Miranda MC, Arenas SM, Montero LM, Rodríguez-Barraquer I, Garcerant D, et al. Noninferiority of miltefosine versus meglumine antimoniate for cutaneous leishmaniasis in children. J Infect Dis. 2012; 205: 684-92.
• ⁴¹
  Alexandre J, Sadlova J, Lestinova T, Vojtkova B, Jancarova M, Podesvova L, et al. Experimental infections and co-infections with Leishmania braziliensis and Leishmania infantum in two sand fly species, Lutzomyia migonei and Lutzomyia longipalpis. Sci Rep. 2020; 10: 3566.
• ⁴²
  Volf P, Peckova J. Sand flies and Leishmania: specific versus permissive vectors. Trends Parasitol. 2007; 23: 91-2.
• ⁴³
  Lainson R, Rangel EF. Lutzomyia longipalpis and the eco-epidemiology of American visceral leishmaniasis, with particular reference to Brazil - A Review. Mem Inst Oswaldo Cruz. 2005; 100(8): 811-27.
• ⁴⁴
  Dvorak V, Shaw J, Volf P. Parasite biology: the vectors. In: Bruschi F, Gradoni L, editors. The leishmaniases: old neglected tropical diseases. Cham: Springer International Publishing; 2018. p. 31-77.
• ⁴⁵
  Lana RS, Michalsky ÉM, Fortes-Dias CL, França-Silva JC, Lara-Silva FO, Lima ACVMR, et al. Phlebotomine sand fly fauna and Leishmania infection in the vicinity of the Serra do Cipó National Park, a natural Brazilian heritage site. Biomed Res Int. 2015; 2015: 385493.
• ⁴⁶
  Hlavacova J, Votypka J, Volf P. The effect of temperature on Leishmania (Kinetoplastida: Trypanosomatidae) development in sand flies. J Med Entomol. 2013; 50: 955-8.
• ⁴⁷
  Morrison AC, Ferro C, Pardo R, Torres M, Wilson ML, Tesh RB. Nocturnal activity patterns of Lutzomyia longipalpis (Diptera: Psychodidae) at an endemic focus of visceral leishmaniasis in Colombia. J Med Entomol. 1995; 32: 605-17.
• ⁴⁸
  Ortiz GS, Borges DA, Trinca LA, Galati EAB, Gordon U, Geier M, et al.Comparison of BG-Lure and BG-Sweetscents attractants for field sampling of phlebotomine sand flies.. Acta Trop. 2020; 202: 105224.
• ⁴⁹
  Aguiar GM, Azevedo ACR, Medeiros WM, Alves JRC, Rendeiro V. Aspectos da ecologia dos flebotomíneos (Diptera: Psychodidae: Phlebotominae) em área de ocorrência de leishmaniose tegumentar, Município de Angra dos Reis, orla marítima do estado do Rio de Janeiro, Brasil. Rev Inst Med Trop São Paulo. 2014; 56: 143-9.
• ⁵⁰
  Vieira VR, Azevedo ACR, Alves JRC, Guimarães AE, Aguiar GM. Ecological Aspects of phlebotomine sand flies (Diptera, Psychodidae, Phlebotominae) in areas of American cutaneous leishmaniasis, in the municipality of Paraty, Rio de Janeiro, Brazil. I-Index of abundance by location and type of capture. J Med Entomol. 2015; 52: 886-95.
• ⁵¹
  Rangel EF, Lainson R. Proven and putative vectors of American cutaneous leishmaniasis in Brazil: aspects of their biology and vectorial competence. Mem Inst Oswaldo Cruz. 2009; 104(7): 937-54.
• ⁵²
  David CV, Craft N. Cutaneous and mucocutaneous leishmaniasis. Dermatol Ther. 2009; 22: 491-502.
• ⁵³
  Machado-Coelho GLL, Caiaffa WT, Genaro O, Magalhães PA, Mayrink W. Risk factors for mucosal manifestation of American cutaneous leishmaniasis. Trans R Soc Trop Med Hyg. 2005; 99: 55-61.

Publication Dates

• Publication in this collection
  05 Feb 2024
• Date of issue
  2024

History

• Received
  04 Oct 2023
• Accepted
  26 Dec 2023