A 37-kb restriction map of the human immunoglobulin lambda variable locus, VB cluster, harboring four functional genes and two non-coding V<FONT FACE=Symbol>l</font> sequences

Abstracts

The human immunoglobulin lambda variable locus (IGLV) is mapped at chromosome 22 band q11.1-q11.2. The 30 functional germline v-lambda genes sequenced untill now have been subgrouped into 10 families (V<FONT FACE="Symbol">l</font>1 to V<FONT FACE="Symbol">l</font>10). The number of V<FONT FACE="Symbol">l</font> genes has been estimated at approximately 70. This locus is formed by three gene clusters (VA, VB and VC) that encompass the variable coding genes (V) responsible for the synthesis of lambda-type Ig light chains, and the J<FONT FACE="Symbol">l</font>-C<FONT FACE="Symbol">l</font> cluster with the joining segments and the constant genes. Recently the entire variable lambda gene locus was mapped by contig methodology and its one- megabase DNA totally sequenced. All the known functional V-lambda genes and pseudogenes were located. We screened a human genomic DNA cosmid library and isolated a clone with an insert of 37 kb (cosmid 8.3) encompassing four functional genes (IGLV7S1, IGLV1S1, IGLV1S2 and IGLV5a), a pseudogene (V<FONT FACE="Symbol">l</font>A) and a vestigial sequence (vg1) to study in detail the positions of the restriction sites surrounding the V<FONT FACE="Symbol">l</font> genes. We generated a high resolution restriction map, locating 31 restriction sites in 37 kb of the VB cluster, a region rich in functional V<FONT FACE="Symbol">l</font> genes. This mapping information opens the perspective for further RFLP studies and sequencing

O locus lambda variável (IGLV) situa-se no cromossomo 22 banda q11.1-q11.2. Os 30 genes v-lambda germinativos e funcionais sequenciados até o momento foram distribuídos em 10 famílias (V<FONT FACE="Symbol">l</font>1 a V<FONT FACE="Symbol">l</font>10). O número de genes V<FONT FACE="Symbol">l</font> está próximo de 70. Este locus é formado por três grupamentos gênicos (VA, VB e VC) que contêm os genes codificadores das regiões variáveis (V) da cadeia leve tipo lambda e o grupamento J<FONT FACE="Symbol">l</font>-C<FONT FACE="Symbol">l</font> com os segmentos de junção (J) e genes das regiões constantes (C). Recentemente o locus IGLV foi mapeado (mapa físico) pela técnica dos "contigs" e seu um megabase de DNA totalmente seqüenciado, posicionando todos os genes V<FONT FACE="Symbol">l</font> funcionais e os pseudogenes. Neste trabalho, nós isolamos um clone de cosmídeo com 37 kb de inserto (cosmídeo 8.3) de uma biblioteca genômica humana preparada no vetor Lorist-6. Este cosmídeo contém quatro genes V<FONT FACE="Symbol">l</font> funcionais (IGLV7S1, IGLV1S1, IGLV1S2 e IGLV5a), um pseudogene (V<FONT FACE="Symbol">l</font>A) e uma seqüência vestigial (vg1) e nos permitiu estudar com detalhe as posições de sítios de restrição em torno dos genes V<FONT FACE="Symbol">l</font>. Geramos um mapa de restrição de alta resolução, localizando 31 sítios de restrição no grupamento gênico VB, uma região rica em genes V<FONT FACE="Symbol">l</font> funcionais. Estas informações sobre mapeamento abrem a perspectiva para estudos sobre RFLP e seqüenciamento

A 37-kb restriction map of the human immunoglobulin lambda variable locus, VB cluster, harboring four functional genes and two non-coding V

Geraldo A.S. Passos Jr.^1,2 and Marie-Paule Lefranc³

¹

² Grupo de Imunogenética Molecular, Departamento de Genética, Faculdade de Medicina de Ribeirão Preto, USP, 14040-900 Ribeirão Preto, SP, Brasil. Fax: [phone]. E-mail: [e-mail], E-mail: [e-mail]. Send correspondence to G.A.S.P. Jr.

³ Laboratoire d’Immunogénétique Moléculaire, Institut de Génétique Moléculaire de Montpellier (CNRS et Université de Montpellier, France).

ABSTRACT

The human immunoglobulin lambda variable locus (IGLV) is mapped at chromosome 22 band q11.1-q11.2. The 30 functional germline v-lambda genes sequenced untill now have been subgrouped into 10 families (Vl1 to Vl10). The number of Vl genes has been estimated at approximately 70. This locus is formed by three gene clusters (VA, VB and VC) that encompass the variable coding genes (V) responsible for the synthesis of lambda-type Ig light chains, and the Jl-Cl cluster with the joining segments and the constant genes. Recently the entire variable lambda gene locus was mapped by contig methodology and its one- megabase DNA totally sequenced. All the known functional V-lambda genes and pseudogenes were located.

We screened a human genomic DNA cosmid library and isolated a clone with an insert of 37 kb (cosmid 8.3) encompassing four functional genes (IGLV7S1, IGLV1S1, IGLV1S2 and IGLV5a), a pseudogene (VlA) and a vestigial sequence (vg1) to study in detail the positions of the restriction sites surrounding the Vl genes. We generated a high resolution restriction map, locating 31 restriction sites in 37 kb of the VB cluster, a region rich in functional Vl genes. This mapping information opens the perspective for further RFLP studies and sequencing.

INTRODUCTION

In response to the presence of foreign molecules, antigens, the B cells of vertebrates produce immu- noglobulins (Ig or antibodies) that neutralize these antigens based on the principle of complementarity. Structurally, the immunoglobulins are formed by two identical heavy chains (55 kd each) and two identical light chains (25 kd each) held together by disulfide bonds assuming a Y shape. Each heavy and light chain has a constant (C) region at the carboxy end and a variable (V) region at the amino end (Padlan, 1994).

Differences in the amino acid sequences of the heavy chain C regions in the base of the Y generate five immunoglobulin classes (IgG, IgM, IgA, IgE and IgD), but there are only two types of light chains, kappa (k) and lambda (l). Binding with the antigens occurs at the complementary determining regions (CDR 1, 2 and 3) located at the level of the V regions of each heavy and light chain (Kabat et al., 1991).

The generation of diversity at the V regions is assured by three mechanisms: i) an inherited repertoire of germline V genes, ii) somatic recombination of V genes with diversity (D), junctional (J) segments and iii) somatic mutations of rearranged V-J or V-D-J genes (Tonegawa, 1983). In man, 40% of the serum antibodies are of the l type, indicating the important role played by the l chains in the antibody response (Lai et al., 1989). The human IGLV locus is mapped at chromosome 22 band q11.1-q11.2 (McBride et al., 1982; de la Chapelle et al., 1983) and, based on the Southern hybridization studies, the number of the Vl genes has been estimated at approximately 70 (Lai et al., 1989).

The Vl germline sequences described so far comprise 10 pseudogenes (Heiter et al., 1981; Dariavach et al., 1987; Alexandre et al., 1989; Bauer and Blomberg, 1991; Combriato and Klobeck, 1991; Daley et al., 1992a,b; Vasicek and Leder, 1990), three vestigial sequences (Frippiat and Lefranc, 1994; Williams et al., 1996), one germline sequence (VlN.2) not assigned to any subgroup (Combriato and Klobeck, 1991) and 37 sequences with open-reading frame (ORF), 30 of which are functional: five VlI (Alexandre et al., 1989; Brockly et al., 1989; Siminovitch et al., 1989; Bernard et al., 1990; Daley et al., 1992a; Williams and Winter, 1993), five VlII (Brockly et al., 1989; Frippiat et al., 1990; Williams and Winter, 1993), eight VlIII (Combriato and Klobeck, 1991; Daley et al., 1992b; Williams and Winter, 1993), three VlIV, three VlV, one VlVI (Williams and Winter, 1993), two VlVII (Alexandre et al., 1989; Brockly et al., 1989; Winkler et al., 1992), one VlVIII (Winkler et al., 1992), one VlIX (Williams and Winter, 1993; Passos Jr. et al., 1994a) and one VlX (Stiernholm et al., 1994). The complex structure of the human immunoglobulin lambda variable locus (IGLV) was elucidated by means of contig methodology using overlapping YAC and cosmid clones; the Vl genes are arranged into three clusters (VA, VB and VC) that place the variable region coding genes within about an 800-kb region (Frippiat et al., 1995; Kawasaki et al., 1995). The physical map of the IGLV locus is available via Internet: http://imgt.cnusc.fr.8104 or www.ebi.ac.uk/imgt.

However, despite their importance for the humoral immune response and the above data, the molecular genetics of the l chains is less known than that of heavy (H) and kappa (k) chains. The data about genetic polymorphism and recombination and the possible role of the IGLV locus in auto-immune or lympho-proliferative diseases are still incomplete.

To further analyze the positions of the restriction sites surrounding the Vl genes of a region of the VB cluster we constructed a 37-kb detailed restriction map of a cosmid clone (cosmid 8.3; Passos et al., 1994a,b,c; Frippiat et al., 1995) that encompasses six immunoglobulin Vl sequences, including four functional genes (IGLV1S1 (Alexandre et al., 1989), IGLV1S2 (Bernard et al., 1990), IGLV7S1 (Daley et al., 1992a,b) and IGLV5a (Berinstein et al., 1988)), and two non-coding sequences (the pseudogene VlA and the vestigial sequence vg1; Alexandre et al., 1989).

The detailed restriction mapping data of the cosmid 8.3 presented here represent a reference for further studies on RFLP of normal human populations and patients with auto-immune or lympho-proliferative diseases.

MATERIAL AND METHODS

Isolation and characterization of the cosmid 8.3

The human genomic cosmid library was kindly provided by Dr. L. Buluwela. It was prepared in the Lorist-6 cosmid vector ligating HindIII DNA fragments of about 50 kb from the human Colo 320 cells to the HindIII cleaved vector (Buluwela et al., 1988).

This library was screened with the IGLV1S1 gene probe (Alexandre et al., 1989) and several positive clones were found. One of these clones, named cosmid 8.3, was amplified and its DNA was prepared using Qiagen purification columns (Diagen, Hilden, Germany) and digested with different restriction endonucleases (Boehringer, Mannheim). The restriction fragments were electrophoresed in 1% agarose gel and transferred to nylon membranes (Hybond N+, Amersham) according to standard procedures (Sambrook et al., 1989). The filters were hybridized with the ³²P-labeled Vl gene probes described below and washed under low stringency conditions. The probes used in the hybridizations were: the 5’ IGLV1S1 insert probe, pVl1VD0.2, which is a 216-bp PvuII-HindIII fragment isolated from clone lLY67VlI (Alexandre et al., 1989) cloned in pUC-18, that contains the 5’ region of the germline IGLV1S1 gene; the IGLV1S2 insert gene probe, pVl2EK0.3, which is a 300-bp HincII-KpnI fragment containing part of the IGLV2S2 gene cloned in pUC-18, and the IGLV7S1 insert gene probe, pVl7BL0.68, which is a 680-bp BamHI-BglII fragment isolated from pV3.3, a subclone of V4A (Daley et al., 1992b) and subcloned in pUC-12. The pseudogene VlA (Alexandre et al., 1989) and the gene IGLV5a (Berinstein et al., 1988) were identified by PCR as described below.

Polymerase chain reaction (PCR)

The cosmid 8.3 DNA was dissolved in 1x TE buffer (10 mM Tris-HCl, pH 7.5, with 1 mM EDTA) at a concentration of 100 ng/ml. The primers for the VlA pseudogene were 19-mer 5’ TAATCCGTGTGCTCAGGAA 3’ forward and 18-mer 5’ GGAGTGATCAGCCTTGTC 3’ reverse (Chuchana et al., 1991) and the primers for the IGLV5a gene were 37-mer 5’ GGAATTCAAGCTTCTGCAGATGGCCTGGACTCCTCTC 3’ forward and 25-mer 5’ GGAATTCGCTTTCTGTCTCACTTCC 3’ reverse (Berinstein et al., 1988).

The PCR amplifications were performed in a final volume of 30 ml with 100 ng of cosmid 8.3 DNA, 40 pmol of each primer, 200 mM of dNTPs and 2.5 units of Taq polymerase (Perkin Elmer Cetus, Norwalk, CT) in 100 ml of 1x PCR buffer (200 mM Tris-HCl, pH 8.3, at room temperature with 1.5 mM MgCl₂).

PCR profile: 94°C for 3 min, 55°C for 10 min. Thirty cycles each at: 72°C for 30 s, 94°C for 30 s, 55°C for 30 s, 72°C for 10 min. The PCR products were analyzed by 2% agarose gel electrophoresis.

Subcloning fragments of the cosmid 8.3

The cosmid 8.3 DNA was digested separately with EcoRI and HindIII. The fragments were separated by electrophoresis in 1% low-melting point agarose (Sea-Plaque GTG, FMC, USA) in 1x TAE buffer (40 mM Tris-acetate, pH 8.0, plus 1 mM EDTA). After electrophoresis the gel was stained with a diluted ethidium bromide solution and each DNA band trimmed from the gel under short time UV exposition. The blocks of agarose containing DNA fragments up to 8.0 kb were melted at 68°C for 10 min and placed at 37°C to prevent solidification.

The DNA fragments were ligated to pUC-18 or pT7T318U vectors cleaved with EcoRI or HindIII in an in-gel ligation reaction (1 ml of melted agarose containing the DNA fragment, 6.0 ml of deionized and autoclaved water, 1.0 unit (1.0 ml) of T4 DNA ligase (Boehringer Mannheim), 1.0 ml (20 ng) of vector and 1.0 ml of 10x ligation buffer. The mixture was left to stand at room temperature (25°C), for 18 h). The ligations were transfected to E. coli TG1 (Hanahan, 1983) and plated onto X-gal + IPTG-containing medium. The white clones harboring the correct size insert were identified by plasmid mini-preparations and digestion with the corresponding restriction enzyme (Sambrook et al., 1989). Each positive clone was named according to the origin of the DNA, the restriction enzyme and the size of the insert.

Restriction mapping

The plasmid mini-preparations of each cosmid subclone were digested with the HindIII, EcoRI, BamHI, KpnI, XhoI and SalI restriction enzymes (single and double digestions) and the fragments separated by electrophoresis in 0.8% agarose gel, 1x TBE buffer with ethidium bromide. The gels were photographed under UV illumination and the molecular weight of each fragment was determined considering the presence of the vector.

The restriction fragments from the cosmid 8.3 exceeding 8.0 kb in size were not subcloned and the restriction data were obtained by direct in-gel digestion. The restriction map of cosmid 8.3 was assembled by overlapping these fragments and the maps of each subclone.

RESULTS AND DISCUSSION

We identified several positive clones by screening the human genomic cosmid library from Colo 320 cells DNA (Buluwela et al., 1988) with a specific Vl gene probe insert (IGLV1S1 gene probe, Alexandre et al., 1989), and from those presenting the strongest hybridization signal we selected the cosmid clone named 8.3 for further analysis. The digestion of the DNA from this cosmid with EcoRI and HindIII restriction enzymes permitted us to measure an insert of approximately 37.0 kb (Figure 1).

The Southern hybridization and PCR results with specific Vl gene probes and primers demonstrate that this insert encompasses the functional Vl genes IGLV1S1 (Alexandre et al., 1989), IGLV1S2 (Bernard et al., 1990), IGLV5a (Berinstein et al., 1988) and IGLV7S1 (Daley et al., 1992b), the pseudogene VlA and the vestigial sequence vg1 (Alexandre et al., 1989) (data not shown).

We digested the cosmid 8.3 DNA separately with EcoRI and with HindIII in order to construct a precise map locating the restriction sites surrounding the six Vl gene sequences. The EcoRI digestion produced fifteen 8.0- to 0.3-kb fragments. The 1.8-, 1.6-, 1.2- and 0.3-kb fragments corresponded to the Lorist-6 vector. HindIII digestion produced nine 16.0- to 1.0-kb fragments, and the entire Lorist-6 vector was liberated in a 5.0-kb fragment (Figure 1). The fragments below 8.0 kb were subcloned in pUC-18 or pT7T318U vectors (except for the Lorist-6 fragments).

We constructed the complete restriction map for the cosmid 8.3 by overlapping the restriction maps of each subclone (Figure 2). We located 31 restriction sites. The six Vl gene sequences are dispersed among 22.8 kb in the 37.0-kb insert. The functional gene IGLV7S1 is 11.0 kb upstream from the IGLV1S1 gene.

The restriction map of the cosmid 8.3 overlaps with the map of phage clones lLY67Vl1 (Alexandre et al., 1989) and #4 (Daley et al., 1992a) and YAC clones 366F5, 105H2 and 400B5 (Frippiat et al., 1995), conferring a phage-cosmid-YAC contig. This confirms the position of the gene IGLV1S2 5.0 kb downstream of gene IGLV1S1. There is still a possibility that these genes evolved by duplication due to the sequence similarity (> 80%) and the positions of the restriction sites surrounding these genes. The two non-coding sequences (pseudogene VlA and vestigial sequence vg1) are located 2.0 kb and 7.0 kb, respectively, downstream of gene IGLV7S1 (Alexandre et al., 1989; Chuchana et al., 1993). Gene IGLV5a is located 4.3 kb downstream of the IGLV1S2 gene (Frippiat et al., 1995).

Cosmid 8.3 is of particular interest since it covers a region of the cluster VB, IGLV locus, which is rich in functional Vl genes and two non-coding sequences (Figure 2, see cluster B). Several haplotypes were revealed by RFLP involving polymorphic insertion/deletion of genes IGLV1S1 and IGLV7S1 (Chuchana et al., 1993) and IGLV5a (Frippiat et al., 1995). Since these genes are present in cosmid 8.3, and with the more complete restriction map for this region and the collection of subclones of this cosmid, we can now do sequencing do perform RFLP studies of the normal human Brazilian population, and in patients with auto-immune or lympho-proliferative diseases.

While this paper was under revision, Kawasaki et al. (1997) published one-megabase sequencing of IGL locus representing the longest contiguous stretch of human DNA analyzed to date.

ACKNOWLEDGMENTS

This work was carried out in the Laboratoire d’Immunogénétique Moléculaire (LIGM), Institut de Génétique Moléculaire de Montpellier, France (CNRS and Université de Montpellier II), during a post-doctoral period of training of G.A.S.P. Jr who was the recipient of a fellowship from CAPES, Brasil. Research supported by the Centre National de la Recherche Scientifique, the Ministère de l’Enseignement Supérieur et de la Recherche, the Université Montpellier II and Association pour la Recherche sur le Cancer (France). G.A.S.P. Jr received grants from FAPESP (No. 95/9839-3) and CNPq-FAPESP (No. 96/5842-2). Publication supported by FAPESP.

RESUMO

O locus lambda variável (IGLV) situa-se no cromossomo 22 banda q11.1-q11.2. Os 30 genes v-lambda germinativos e funcionais sequenciados até o momento foram distribuídos em 10 famílias (Vl1 a Vl10). O número de genes Vl está próximo de 70. Este locus é formado por três grupamentos gênicos (VA, VB e VC) que contêm os genes codificadores das regiões variáveis (V) da cadeia leve tipo lambda e o grupamento Jl-Cl com os segmentos de junção (J) e genes das regiões constantes (C). Recentemente o locus IGLV foi mapeado (mapa físico) pela técnica dos "contigs" e seu um megabase de DNA totalmente seqüenciado, posicionando todos os genes Vl funcionais e os pseudogenes. Neste trabalho, nós isolamos um clone de cosmídeo com 37 kb de inserto (cosmídeo 8.3) de uma biblioteca genômica humana preparada no vetor Lorist-6. Este cosmídeo contém quatro genes Vl funcionais (IGLV7S1, IGLV1S1, IGLV1S2 e IGLV5a), um pseudogene (VlA) e uma seqüência vestigial (vg1) e nos permitiu estudar com detalhe as posições de sítios de restrição em torno dos genes Vl. Geramos um mapa de restrição de alta resolução, localizando 31 sítios de restrição no grupamento gênico VB, uma região rica em genes Vl funcionais. Estas informações sobre mapeamento abrem a perspectiva para estudos sobre RFLP e seqüenciamento.

REFERENCES

Alexandre, D., Chuchana, P., Brockly F., Blancher A., Lefranc, G. and Lefranc, M.P. (1989). First genomic sequence of a human Ig variable l gene belonging to subgroup I: functional genes, pseudogenes and vestigial sequences are interspersed in the IGLV locus. Nucleic Acids Res. 17: 3975.

Bauer, T.R. and Blomberg, B. (1991). The human l L chain Ig locus: recharacterization of Jcl6 and identification of a functional Jcl7. J. Immunol. 146: 2813-2820.

Berinstein, N., Levy, S. and Levy, R. (1988). Activation of an excluded immunoglobulin allele in a human B lymphoma cell line. Science 122: 337-339.

Bernard, F., Chuchana, P., Frippiat, J.P., Buluwela, L. and Lefranc, M.-P. (1990). Genomic sequence of IGLV1S2, a human immunoglobulin variable lambda gene belonging to subgroup I. Nucleic Acids Res. 18: 7139.

Brockly, F., Alexandre, D., Chuchana, P., Huck, S., Lefranc, G. and Lefranc, M.-P. (1989). First nucleotide sequence of a human immunoglobulin variable l gene belonging to subgroup II. Nucleic Acids Res. 17: 3976.

Buluwela, L., Albertson, D.G., Sherrington, P., Rabbitts, P.H., Spurr, N. and Rabbitts, T.H. (1988). The use of chromosomal translocations to study human immunoglobulin gene organization; mapping DH segments within 35 kb of Cm gene and identification of a new DH locus. EMBO J. 7: 2003-2010.

Chuchana, P., Alexandre, D., Lefranc, G. and Lefranc, M.-P. (1991). The IGLVA gene as an STS in the human immunoglobulin lambda light chain variable gene locus (located at 22q11). Nucleic Acids Res. 19: 4786.

Chuchana, P., Frippiat, J.-P., Blancher, A., Lefranc, G. and Lefranc, M.-P. (1993). Haplotypes of the human immunoglobulin lambda IGLV7S1 and IGLV1S1 genes defined by restriction-site polymorphism and insertion/ deletion of a 6 kb fragment. Am. J. Hum. Genet. 53: 518-525.

Combriato, G. and Klobeck, H.-G. (1991). Vl and Jl-Cl genes of the human immunoglobulin l light chain locus are separated by 14 kb and rearrange by a deletion mechanism. Eur. J. Immunol. 21: 1513-1522.

Daley, M.D., Olee, T., Peng, H.-Q., Soto-Gil, R.W., Chen, P.P. and Siminovitch, K.A. (1992a). Molecular characterization of the human immunoglobulin VlI germline gene repertoire. Mol. Immunol. 29: 1031-1042.

Daley, M.D., Peng, H-Q., Misener, V., Liu, X.-Y., Chen, P.P. and Siminovitch, K.A. (1992b). Molecular analysis of human immunoglobulin Vl germline genes: subgroups VlIII and VlIV. Mol. Immunol. 29: 1515-1518.

Dariavach, P., Lefranc, G. and Lefranc, M.-P. (1987). Human immunoglobulin Cl6 gene encodes the Kern+ Oz-l chain and Cl4 and Cl5 are pseudogenes. Proc. Natl. Acad. Sci. USA 84: 9074-9078.

de la Chapelle, A., Lenoir, A., Boue, G., Gallano, P., Huerre, C., Szajnert, M.F., Jeanpierre, M., Lalouel, M. and Kaplan, J.C. (1983). Lambda Ig constant region genes are translocated to chromosome 8 in a Burkitt’s lymphoma (8,22). Nucleic Acids Res. 11: 1133-1142.

Frippiat, J.-P. and Lefranc, M.P. (1994). Genomic organization of 34 kb of the human immunoglobulin lambda locus (IGLV): restriction map and sequences of new VlIII genes. Mol. Immunol. 31: 657-670.

Frippiat, J.-P., Chuchana, P., Bernard, F., Lefranc, G. and Lefranc, M.-P. (1990). First genomic sequence of a human Ig variable lambda gene belonging to subgroup III. Nucleic Acids Res. 18: 7134.

Frippiat, J.-P., Williams, S.C., Tomlinson, I.M., Cook, G.P., Cherif, D., LePaslier, D., Collins, J.E., Dunham, I., Winter, G. and Lefranc, M.-P. (1995). Organization of the human immunoglobulin lambda light-chain locus on chromosome 22q11.2. Hum. Mol. Genet. 4: 983-991.

Hanahan, D.J. (1983). Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166: 557-580.

Heiter, P.A., Hollis, G.F., Korsmeyer, S.F., Waldman, T.A. and Leder, P. (1981). Clustered arrangement of immunoglobulin l constant region genes in man. Nature 294: 536-540.

Kabat, E.A., Wu, T.T., Perry, H.M., Gottesman, K.S. and Foeller, C. (1991). Sequences of Proteins of Immunological Interest. US Department of Health and Human Services, NIH, Public Health Service, Washington, D.C.

Kawasaki, K., Minoshima, S., Schooler, K., Kudoh, J., Asakawa, S., de Jong, P.J. and Shimizu, N. (1995). The organization of the human immunoglobulin l gene locus. Genome Res. 5: 125-135.

Kawasaki, K., Minoshima, S., Nakato, E., Shibuia, K., Shintani, A., Schmeits, J.L., Wang, J. and Shimizu, N. (1997). One-megabase sequence analysis of the human immunoglobulin lambda gene locus. Genome Res. 7: 250-261.

Lai, E., Wilson, R. and Hood, L. (1989). Physical maps of the mouse and human immunoglobulin like loci. Adv. Immunol. 46: 1-59.

McBride, O.W., Heiter, P.A. and Hollis, G.F. (1982). Chromosomal location of human kappa and lambda immunoglobulin light chain constant region genes. J. Exp. Med. 155: 1480-1490.

Padlan, E. (1994). Anatomy of the antibody molecule. Mol. Immunol. 31: 169-217.

Passos Jr., G.A.S., Frippiat, J.-P. and Lefranc, M.-P. (1994a). Definition of a sequence-tagged site for the human immunoglobulin IGLV9S1 gene located at chromosome 22q11. Exp. Clin. Immunogenet. 11: 222-226.

Passos Jr., G.A.S., Frippiat, J.-P. and Lefranc, M.-P. (1994b). Organization of the human immunoglobulin V lambda locus located at chromosome 22q11: three functional genes and two non-coding sequences. 23th Annual Meeting of the Braz. Soc. Biochem. Mol. Biol., 14-17 May, Caxambú, MG, Brazil.

Passos Jr., G.A.S., Frippiat, J.-P. and Lefranc, M.-P. (1994c). Physical mapping of the human immunoglobulin V-lambda locus at chromosome 22q11. 40th National Congress of Genetics, Braz. Soc. Genet., 2-5 September, Caxambú, MG, Brazil.

Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor.

Siminovitch, K.A., Misener, V., Kwong, P.C., Song, Q.L. and Chen, P.P. (1989). A natural autoantibody is encoded by germline heavy and lambda light chain variable region genes without somatic mutation. J. Clin. Invest. 84: 1675-1678.

Stiernholm, N.B.J., Kuzniar, B. and Berinstein, N. (1994). Identification of a new human Vl gene family VlX. J. Immunol. 152: 4969-4975.

Tonegawa, S.

Nature 302

Vasicek, T.J. and Leder, P. (1990). Structure and expression of the human immunoglobulin l genes. J. Exp. Med. 172: 609-620.

Williams, S.C. and Winter, G. (1993). Cloning and sequencing of human immunoglobulin Vl segments. Eur. J. Immunol. 23: 1456-1461.

Williams, S.C., Frippiat, J.-P., Tomlinson, I.M., Ignativich, O., Lefranc, M.-P. and Winter, G. (1996). Sequence and evolution of the human germline Vl repertoire. J. Mol. Biol. 264: 220-232.

Winkler, T.H., Fehr, H. and Kalden, J. (1992). Analysis of immunoglobulin variable region genes from human IgG anti-DNA hybridomas. Eur. J. Immunol. 22: 1719-1728.

(Received April 25, 1997)

Figure 1 - Cosmid 8.3 DNA restriction fragments resolved on 1% agarose gel electrophoresis. M = Molecular weight marker fragments from l phage DNA digested with HindIII. H = Cosmid 8.3 digested with HindIII. R = Cosmid 8.3 digested with EcoRI.

Figure 2
- Restriction map of cosmid 8.3 and its location in the cluster B of the IGL locus, chromosome 22q11.1-q11.2. The entire IGL locus spans about 800 kb and the positions of the Vl genes in the clusters are not to scales (the 1-kb scale is valid only for cosmid 8.3). Vl genes: V7S1 = IGLV7a (acc X14614), V1S1 = IGLV1d (acc M94118), V1S2 = IGLV1e (acc M94116), V5a = IGLV5a (acc Z73668), VlA = VlA pseudogene, vg1 = vg1 vestigial sequence. Sequences not related to the Vl genes: BCRL2 and BCRL4 = BCR pseudogenes, VpreB = non Ig-like, GGT2 = g-glutamyl transpeptidase-like sequence. This figure was based on the IMGT data base available via Internet: http://imgt.cnusc.fr:8104 or www.ebi.ac.uk/imgt

Publication Dates

• Publication in this collection
  06 Oct 1998
• Date of issue
  Dec 1997

History

• Received
  25 Apr 1997