Effects of Vitamin A and K³ on Immune Function and Intestinal Antioxidant Capacity of Aged Laying Hens

ABSTRACT

This study was conducted to investigate effects of vitamin A (VA) and vitamin K₃ (VK₃) on immune function and intestinal antioxidant capacity of aged laying hens. In a 3 × 3 factorial arrangement, the diets of 1080 Roman Pink laying hens (87 weeks old) was formulated with deficient, adequate and excess VA and VK₃, including 0, 7000 and 14000 IU/kg VA and 0, 2.0 and 4.0 mg/kg VK₃ for 8 weeks. Interactive effects between VA and VK₃ were observed that VA and VK₃ decreased the splenetic mRNA expression of inducible nitric oxide synthase (iNOS) and tumour necrosis factor α (TNF-α), but increased the plasma immunoglobulin G (IgG) content and jejunal mRNA expression of nuclear factor-like 2 (Nrf2). Hens fed adequate or excess VA had higher spleen index, mRNA expression of interleukin-10 (IL-10) in spleen, sIgA content, catalase (CAT), glutathione peroxidase and total dismutase (T-SOD) activity, and mRNA expression of polymeric immunoglobulin receptor (pIgR) in jejunum and lower mRNA expression of IL-1β in jejunum and iNOS, TNF-α in spleen. Furthermore, adequate or excess VK₃ significantly increased plasma IgG content, the CAT, T-SOD and total antioxidant capacity activities, up-regulated the mRNA expression of pIgR, Nrf2, SOD1 and CAT in jejunum and down-regulated the mRNA expression of iNOS and TNF-α in spleen.

In conclusion, dietary addition of adequate VA (7000 IU/kg) and VK₃ (2.0 mg/kg) improved the immune function and intestine antioxidant capacity of aged laying hens and excess levels did not exhibit superior effects.

Keywords:
Antioxidant capacity; immune function; jejunum; laying hens; lipid-soluble vitamin

INTRODUCTION

As laying hens age over 70 weeks old, laying performance and egg quality are generally impaired, which results in a great economic loss (Roberts, 2004; Molnar et al., 2017; Rattanawut et al., 2018). Importantly, the main reasons for poor production of old layers are attenuated antioxidant capacity and weak immune system (Claudio et al., 2000; Holmes et al., 2003; Wan et al., 2017). A previous study showed that digestion, absorption and immune problems were caused by reduced intestinal health in old laying hens (Jing et al., 2014). Thus, it is imperative to explore solutions from the nutritive perspective to enhance intestinal health, improve laying performance and extend the laying period of old laying hens (Zhang et al., 2020).

Therefore, lots of efforts are being made to improve the laying performance of aged laying hens using nutritional interventions (Gan et al., 2020). Because of their beneficial effects on antioxidant activity, reproduction and other physiological mechanisms (Combs & McClung, 2016), vitamins have justifiably attracted attention of experts in the laying hen industry. Gan et al. (2020) reported that dietary vitamins exert critical effects on eliminating free radicals and improving antioxidant levels and immune functions.

As essential lipid-soluble vitamin for laying hens (Guo et al., 2021), vitamin A (VA) plays an important role in maintaining the normal visual function of animals and the structural integrity of epithelial tissue (Liang et al., 2019) and supporting the differentiation of epithelial cells (Brody, 1993). VA ensures normal immune function (Kheirouri & Alizadeh, 2014), thus maintaining a normal intestinal environment and enhancing antioxidant function (Pedro et al., 2018). It was reported that VA deficiency results in decreased immune response (Friedman & Sklan, 1989) and disturbed immunoglobulin metabolism (Davis and Sell, 1989). However, excess VA intake also has a detrimental effect on the immune function of birds (Friedman et al., 1991). Vitamin K (VK) is a cofactor in glutamyl residue carboxylation during the post-translational modification of osteocalcin, a protein associated specifically with bone formation, and other bone matrix proteins (Fleming et al., 2003). McDowell (2000) reported that adding VK to the broiler’s diet can be beneficial in the early days of growth for strengthening their immune system, blood clotting and calcium accumulation (Abbasi et al., 2017). Furturemore, VK, like VA, is a potential antioxidant (Vervoort et al., 1997; Huang et al., 2018).

In recent years, although additional vitamins in the diet of old laying hens has attracted a lot of interest in old laying hens, a few studies have reported the addition of VA and VK₃. Whether and how addition of VA and VK₃ maintained intestinal health to enhance laying performance is still uncertain. Thus, the main objective of this study was to investigate effects of VA and VK₃ on immune function and intestinal antioxidant capacity of aged laying hens to provide a theoretical basis for addition of VA and VK₃.

MATERIAL AND METHODS

All animal procedures used in the present study were performed in compliance with Hubei Provincial Regulations for Laboratory Animals (011043145-029-2013-000009), and were approved by the Institutional Animal Care and Use Committee of Wuhan Polytechnic University (Number: 20190513).

Experimental design and bird management

The study was conducted using a 3 × 3 completely randomized design, and the diets of 1080 Roman Pink laying hens (87 weeks old, German Roman company) was formulated with different concentrations of VA (Retinyl acetate, providing 500000 IU/kg retinol) and VK₃ (menadione sodium bisulfite, providing 50% menadione), including 0, 7000 and 14000 IU/kg VA and 0, 2.0 and 4.0 mg/kg VK₃. The diets in nine groups, formulated using a cross-over design, were randomly assigned to hens with eight replicates, each with five adjacent cages (three birds per cage). The size of each cage (equipped with two nipple drinkers and one feeder) was 50 × 50 × 60 cm³. An enclosed, ventilated, and conventional house (room temperature: 22 ± 2 ºC, relative humidity: 60-70%) with 16 h lighting was provided for all laying hens to keep them in the same environmental conditions. Feed and water were offered ad libitum. The composition and nutrient levels of basal diet without addition of VA and VK₃ were shown in Table 1. The experiment lasted 10 weeks, consisting of a 2-week acclimation period with a basal diet containing 1320 IU/kg of VA and 0.5 mg/kg of VK₃ and a 8-week experimental period.

Table 1
The composition and nutrient levels of basal diet for laying hens.

Item	Value	Item	Value
Ingredients (%, unless otherwise indicated)		Calculated nutrient levels (g kg-1)
Corn	55.40	Metabolic energy (MJ/kg)	11.5
Soybean meal	14.12	Crude protein	162
Soybean oil	0.60	Calcium	39.8
Corn DDGS	6.00	Available phosphorus	3.0
Rice DDGS	2.00	Lysine	74
Corn gluten meal	2.00	Methionine + Cystine	6.1
Hydrolyzed feather meal	1.50	Threonine	4.9
Sprayed corn husks	5.00
Dicalcium phosphate	0.70
Limestone	10.3
Sodium chloride	0.10
Sodium hydrogen carbonate	0.25
L-Threonine	0.05
L-Lysine	0.35
Liquid DL-Methionine	0.20
Choline chloride	0.15
` premix1, 3	0.02
Trace mineral premix2	0.10
Compound enzyme preparations	0.02
Canthaxanthin	0.01
Betaine hydrochloride	0.02
Encapsulated vitamin C	0.01
Montmorillonite	0.10
Zeolite powder	1.00
Total	100.00

• DDGS: distiller’s dried grains with solubles.
• ¹
  The vitamin premix supplied the following per kilogram of diet: vitamin D₃, 2 500 IU; vitamin E, 30 IU; vitamin B₁, 2 mg; vitamin B₂, 6 mg; vitamin B₁₂, 0.025 mg; biotin, 0.0325 mg; folic acid, 1.25 mg; pantothenic acid, 12 mg; nicotinic acid, 50 mg.
• ²
  The trace mineral premix supplied the following per kilogram of diet: copper, 8 mg; iron, 80 mg; zinc, 75 mg; manganese, 100 mg; selenium, 0.15 mg; iodine, 0.35 mg.
• ³
  A 3×3 factorial randomized complete block design was employed, and all birds were acclimated on a basal diet with 1 320 IU/kg of vitamin A and 0.5 mg/kg of vitamin K₃ for 2 weeks. At week 90, deficient, adequate and excess vitamins A (0, 7 000 and 14 000 IU/kg) and K₃ (0, 2.0 and 4.0 mg/kg) were supplemented into the basal diets using cross-over design. Retinyl acetate (providing 500 000 IU/kg retinol) and menadione sodium bisulfite (providing 50% menadione) was chosen as the vitamins A and K₃ sources, respectively.

Sample collection

At the end of the experiment (8 weeks), one bird from each replicate (8 birds per group) were randomly selected and marked. After 12 h feed withdrawal (water was offered ad libitum), the fasting body weight of laying hens was recorded. Blood samples collected from the wing vein into ethylenediamine tetraacetic acid-coated tube were centrifuged for 10 min (3000 g, 4 ºC) to obtain plasma which were aspirated by pipette, stored in 1.5-ml tubes at -80 ºC until analyses and thawed at 4 ºC before analysis. Then, hens were sacrificed humanely by cervical dislocation. The spleen samples drained with filter paper were weighed and quickly snap-frozen in liquid N₂ and then stored in -80 ºC for the mRNA level analysis. The portion of jejunum samples were collected immediately and stored at -80 ºC for the assay of immune function and antioxidant capacity.

Calculation of spleen index

$Spleenindex\left(g/kg\right)=1000\times spleenweight\left(g\right)/livebodyweight\left(kg\right)$

Detection of immunoglobulin and anti-oxidant status activity

The jejunum was homogenized in 10 % (w/v) ice-cold physiological saline and then centrifuged for 10 min at 4 °C (3000 g). The supernatant was collected to measure the content of secretory immunoglobulin A (sIgA) using the ELISA kits (Bethyl Laboratories) and the activities of antioxidant enzymes (, total antioxidant capacity (T-AOC), catalase (CAT), total dismutase (T-SOD), and glutathione peroxidase (GSH-Px)) and malondialdehyde (MDA) content were analyzed using analysis kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) according to the manufacturer’s directions. The plasma was used to determine the content of immunoglobulin A, G and M (IgA, IgG and IgM) using the ELISA kits (Bethyl Laboratories). A microplate reader (SpectraMax M5, Molecular Devices) was used in the determination.

RNA extraction, reverse transcription and real-time quantitative PCR

Total RNA was extracted from jejunum and spleen using Trizol reagent (Invitrogen Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s instructions. The concentration of each extracted RNA sample was determined using a Nano Drop Spectrophotometer (Thermo Scientific, Wilmington, DE, USA), and the RNA integrity was verified by agarose gel electrophoresis. Reverse transcription was performed from 1 µg total RNA using a prime-Scripte® RT reagent Kit (TaKaRa). The primer sequences for immune function-related genes (interleukin (IL); inducible nitric oxide synthase (iNOS); Polymeric immunoglobulin receptor (pIgR); tumour necrosis factor α (TNF-α)), antioxidative genes (nuclear factor (erythroid 2)-like 2 (Nrf2); CAT; SOD1; GSH-Px) and β-actin are listed in Table 2. The quantitative real-time polymerase chain reaction (PCR) system (ABI 7500; Applied Biosystems, Foster City, CA, USA) following the protocol of SYBR Premix Ex Taq^TM kit (TaKaRa) was performed with the following thermal procedure: 95 ºC for 30 s, followed by 40 cycles of 95 ºC for 5 s, and 60 ºC for 34 s, then 95 ºC for 15 s, 60 ºC for 60 s and 95 ºC for 15 s. There were eight samples for each group, and each sample was performed in triplicate, and no template control was included. The mRNA levels were standardized as the ratio to β-actin in arbitrary units by the 2^−ΔΔCt method (Livak & Schmittgen, 2001).

Table 2
Primers used for real-time quantitative fluorescence PCR analysis.

Gene name	Accession number	Forward sequence (5’-3’)	Reverse sequence (5’-3’)
β-actin	NM_205518	GAGAAATTGTGCGTGACATCA	CCTGAACCTCTCATTGCCA
IL-1β	NM_204524.1	AAGCCTCGCCTGGATTCTGA	TCAGGTCGCTGTCAGCAAAG
IL-6	NM_204628.1	CCCAAGGTGACGGAGGAGGACGGCT	TCCAGGTAGGTCTGAAAGGCGAACA
IL-8	NM_205498.1	ATGAACGGCAAGCTTGGA	TCCAAGCACACCTCTCTTC
IL-10	NM_001004414.2	CGGGGAGCTGAGGGTGAA	GTGAAGAAGCGGTGACAGC
pIgR	XM_031689889.1	ATGACACGCTTCTTCATCTTCGTCTGCC	CTAGGCTTCTCTGGGGCCGTCCTG
iNOS	U46504	CAGCTGATTGGGTGTGGAT	TTTCTTTGGCCTACGGGTC
TNF-α	NM_204267.1	TGTGTATGTGCAGCAACCCG	AACAACCAGCTATGCACCCC
Nrf2	NM_205117.1	ATCACCTCTTCTGCACCGAA	GCTTTCTCCCGCTCTTTCTG
CAT	NM_001031215.2	GGTTCGGTGGGGTTGTCTTT	CACCAGTGGTCAAGGCATCT
SOD1	NM_205064.1	GGTGCTCACTTTAATCCTG	CTACTTCTGCCACTCCTCC
GSH-Px1	NM_001277853.2	GACCAACCCGCAGTACATCA	GAGGTGCGGGCTTTCCTTTA
GSH-Px3	NM 001163232.2	AAGTGCCAGGTGAACGGGAAGG	AGGGCTGTAGCGGCGGAAAG

• IL: interleukin; pIgR: Polymeric immunoglobulin receptor; iNOS: inducible nitric oxide synthase; TNF-α: tumour necrosis factor α; Nrf2: nuclear factor (erythroid 2)-like 2; CAT: catalase; SOD1: superoxide dismutase 1; GSH-Px: glutathione peroxidase.

Statistical analysis

The results were analyzed by 2-factorial ANOVA using Univariate General Linear Model using SPSS version 21.0 (SPSS Inc., Chicago, IL, USA). Differences among all treatments were separated by Duncan’s multiple test. Results are presented as the mean ± pooled SEM. p<0.05 was considered statistically significant.

RESULTS

Spleen index and immunoglobulin levels

As shown in Table 3, hens fed adequate VA (7000 IU/kg) had the highest spleen index (p<0.01) and sIgA content in jejunum (p<0.05). Similar case for VK₃ was observed that adequate VK₃ (2.0 mg/kg) elevated plasma IgG content in contrast to deficient (0 mg/kg) and excess VK₃ (4.0 mg/kg) at week 97 (p<0.01). VA and VK₃ exhibited interactive effects on the plasma IgG content (p<0.05). Deficient or adequate VA and adequate VK₃ significantly increased the plasma IgG content. Furthermore, VA and VK₃ did not show significant effects on the IgA and IgM content in plasma (p>0.05).

Table 3
Effects of VA and VK₃ on the spleen index and immunoglobulin of aged Roman Pink hens at 97 weeks of age.¹

Item	VA (IU/kg)											SEM	p-value
	0				7000				14000
	VK3 (mg/kg)				VK3 (mg/kg)				VK3 (mg/kg)
	0	2.0	4.0		0	2.0	4.0		0	2.0	4.0		VA	VK3	Interaction
Spleen index, (g/kg)	0.56	0.53	0.54		0.72	0.68	0.56		0.63	0.66	0.59	0.043	0.008	0.107	0.384
Jejunum
sIgA, (µg/mL)	169.15	150.00	151.59		188.75	208.40	165.52		171.96	161.79	160.11	14.175	0.035	0.288	0.490
Plasma
IgA, (µg/mL)	367.64	380.94	440.55		476.32	503.71	458.36		374.24	532.37	380.38	49.557	0.137	0.262	0.280
IgG, (mg/mL)	18.88b	27.76a	18.17b		19.80b	28.16a	16.10b		16.01b	20.88b	21.54b	2.091	0.404	< 0.001	0.042
IgM, (mg/mL)	0.87	0.81	0.83		0.77	0.63	0.82		0.68	0.81	0.52	0.101	0.141	0.834	0.244

• ¹
  Results are presented as the mean ± pooled SEM (n = 8).
• ^a-d
  Values within a row with different superscripts differ significantly at p<0.05.
• VA: Vitamin A; VK₃: vitamin K₃; sIgA: secretory immunoglobulin A; IgA, IgG and IgM: immunoglobulin A, G and M.

Immune function-related gene expression in the jejunum and spleen

Compared with deficient VA (0 IU/kg), adequate and excess (14000 IU/kg) VA significantly down-regulated the mRNA expression of IL-1β in jejunum (Table 4), iNOS, TNF-α in spleen (Table 5) (p<0.01) and up-regulated expression of pIgR mRNA in jejunum (p<0.05). Adequate VA had the highest expression of IL-10 mRNA in spleen (p<0.05). Compared with deficient and adequate VK₃, excess VK₃ increased the mRNA expression of pIgR in jejunum (p<0.01) and decreased the mRNA expression of iNOS (p<0.05) and TNF-α (p<0.01) in spleen. Interactive effects between VA and VK₃ were observed that adequate VA and excess VK₃ decreased the splenetic mRNA expression of iNOS (p<0.05) and TNF-α (p<0.01).

Table 4
Effects of VA and VK₃ on the immune function-related gene expression in jejunum of aged Roman Pink hens at 97 weeks of age.¹

Item	VA (IU/kg)											SEM	P-value
	0				7000				14000
	VK3 (mg/kg)				VK3 (mg/kg)				VK3 (mg/kg)
	0	2.0	4.0		0	2.0	4.0		0	2.0	4.0		VA	VK3	Interaction
IL-1β	0.99	0.95	1.00		0.68	0.57	0.57		0.73	0.56	0.63	0.097	< 0.001	0.420	0.952
IL-8	1.00	0.79	0.55		0.68	0.66	0.48		0.69	0.65	0.61	0.155	0.361	0.179	0.810
pIgR	1.00	1.18	1.09		1.02	1.23	1.96		1.17	1.14	1.77	0.158	0.045	0.001	0.058
iNOS	1.01	1.18	1.12		0.94	0.94	1.15		1.05	0.92	1.07	0.106	0.492	0.357	0.540
TNF-α	0.99	1.38	1.51		1.32	1.24	1.51		1.20	1.46	1.10	0.142	0.662	0.156	0.082

• ¹
  Results are presented as the mean ± pooled SEM (n = 8).
• ^a-d
  Values within a row with different superscripts differ significantly at p<0.05.
• VA: Vitamin A; VK₃: vitamin K₃; IL: interleukin; iNOS: inducible nitric oxide synthase; pIgR: polymeric immunoglobulin receptor; TNF-α: tumour necrosis factor α.

Table 5
Effects of VA and VK₃ on the immune function-related gene expression in spleen of aged Roman Pink hens at 97 weeks of age.¹

Item	VA (IU/kg)											SEM	p-value
	0				7000				14000
	VK3 (mg/kg)				VK3 (mg/kg)				VK3 (mg/kg)
	0	2.0	4.0		0	2.0	4.0		0	2.0	4.0		VA	VK3	Interaction
IL-1β	1.00	0.72	0.73		0.98	0.90	1.01		0.84	0.89	0.85	0.109	0.255	0.502	0.492
IL-6	1.00	0.84	1.05		0.97	0.84	0.90		1.11	0.89	0.98	0.171	0.800	0.480	0.984
IL-8	0.99	1.20	1.29		1.11	1.26	1.15		1.24	1.13	1.27	0.111	0.816	0.406	0.449
IL-10	1.01	0.90	0.92		1.44	1.17	1.05		1.15	0.96	0.92	0.130	0.036	0.083	0.842
iNOS	0.99a	0.93ab	0.85abc		0.93ab	0.87abc	0.66d		0.76cd	0.77cd	0.81bc	0.046	0.002	0.012	0.028
TNF-α	0.99a	0.60b	0.58bc		0.58b	0.60b	0.46d		0.60b	0.56bc	0.50cd	0.026	< 0.001	< 0.001	< 0.001

• ¹
  Results are presented as the mean ± pooled SEM (n = 8).
• ^a-d
  Values within a row with different superscripts differ significantly at p<0.05.
• VA: Vitamin A; VK₃: vitamin K₃; IL: interleukin; iNOS: inducible nitric oxide synthase; TNF-α: tumour necrosis factor α.

Jejunal antioxidant status

As presented in Table 6, compared with deficient and adequate VA, excess VA increased CAT and T-SOD activity in jejunum (p<0.01). Laying hens fed adequate and excess VA had higher GSH-Px activity than that of hens fed deficient VA (p<0.01). Furthermore, excess VK₃ significantly increased the T-SOD activities (p<0.01) and adequate VK₃ increased the CAT activity in jejunum (p<0.05) in contrast to deficient VK₃ while adequate VK₃ had the highest T-AOC activities (p<0.01) in jejunum. VA and VK₃ did not significantly affect the MDA activity in jejunum at week 97 (p>0.05).

Table 6
Effects of VA and VK₃ on the antioxidant status in jejunum of aged Roman Pink hens at 97 weeks of age.¹

Item	VA (IU/kg)											SEM	p-value
	0				7000				14000
	VK3 (mg/kg)				VK3 (mg/kg)				VK3 (mg/kg)
	0	2.0	4.0		0	2.0	4.0		0	2.0	4.0		VA	VK3	Interaction
MDA, ng/mgprot	1.28	1.22	1.04		1.14	0.88	0.96		1.21	1.29	1.33	0.178	0.152	0.766	0.780
T-AOC, U/mgprot	0.55	0.64	0.67		0.51	0.68	0.70		0.56	0.58	0.67	0.037	0.696	< 0.001	0.476
CAT, U/mgprot	3.45	3.12	2.58		2.64	3.70	2.89		4.28	4.63	3.95	0.298	< 0.001	0.030	0.213
T-SOD, U/mgprot	717.01	698.15	818.17		640.52	796.61	834.72		990.54	1064.54	1075.60	45.930	< 0.001	0.008	0.362
GSH-Px, U/mgprot	29.77	30.64	30.75		46.81	45.20	44.62		45.39	50.87	41.12	5.662	0.002	0.764	0.901

• ¹
  Results are presented as the mean ± pooled SEM (n = 8).
• ^a-d
  Values within a row with different superscripts differ significantly at p<0.05.
• VA: Vitamin A; VK₃: vitamin K₃; MDA: malondialdehyde; T-AOC: total antioxidant capacity; CAT: catalase; T-SOD: total dismutase; GSH-Px: glutathione peroxidase.

Antioxidative gene expression in the jejunum

VA and VK₃ did not significantly affect the gene expression of GSH-Px1 and GSH-Px2 in jejunum at week 97 (p>0.05) (Table 7). Compared with deficient and adequate VA, excess VA increased the mRNA expression of Nrf2 in jejunum (p<0.01). Adequate and excess VK₃ significantly increased the mRNA expression of Nrf2, SOD1 and CAT in contrast to deficient VK₃ in jejunum (p<0.01). Moreover, excess VA and adequate VK₃ had the highest expression of Nrf2 mRNA in jejunum (p<0.01).

Table 7
Effects of VA and VK₃ on the antioxidative gene expressions in jejunum of aged Roman Pink hens at 97 weeks of age.¹

Item	VA (IU/kg)											SEM	P-value
	0				7000				14000
	VK3 (mg/kg)				VK3 (mg/kg)				VK3 (mg/kg)
	0	2.0	4.0		0	2.0	4.0		0	2.0	4.0		VA	VK3	Interaction
Nrf2	1.00d	0.98d	1.35bc		0.90d	1.12cd	1.55ab		1.20cd	1.72a	1.38bc	0.110	0.003	< 0.001	0.006
CAT	1.00	1.73	1.32		1.24	1.79	2.13		1.16	2.23	1.47	0.222	0.122	0.001	0.182
SOD1	1.00	1.49	1.45		1.21	1.29	1.72		1.10	1.40	1.42	0.129	0.570	0.001	0.322
GSH-Px1	0.93	0.92	0.91		0.96	0.92	1.23		1.18	0.98	0.95	0.088	0.202	0.397	0.072
GSH-Px3	0.93	0.58	0.78		0.66	0.71	0.80		0.73	0.71	0.81	0.084	0.836	0.142	0.160

• ¹
  Results are presented as the mean ± pooled SEM (n = 8).
• ^a-d
  Values within a row with different superscripts differ significantly at p<0.05.
• VA: Vitamin A; VK₃: vitamin K₃; Nrf2: nuclear factor (erythroid 2)-like 2; CAT: catalase; SOD1: superoxide dismutase 1; GSH-Px: glutathione peroxidase.

DISCUSSION

The old laying hens usually have decreased immune capacity, intestinal dysfunction, poorer egg quality, and production performance (Claudio et al., 2000; Liu et al., 2016; Zhu et al., 2019). Although many studies have examined the effects of the interactions among lipid-soluble vitamins on immunity, growth, and development in broilers and layers, few studies have explored the effects of interaction between VA and VK in the diet of aged laying hens. In our present study, it was found that although VA and VK₃ did not significantly affect the laying performance of aged Roman Pink laying hens, they improved the eggshell quality and yolk color as well as the antioxidative status in eggshell gland, which has been reported by Guo et al. (2021). Therefore, the immune function and intestine antioxidant capacity were determined in present study to see whether VA and VK have beneficial effects on intestinal health of aged laying hens.

The spleen index can reflect the immune function of the body to some extent. Immunoglobulins is a specific binding antibody produced by the immune response of plasma cells converted from B lymphocytes that can match the corresponding antigen. IgA, IgG and IgM are important immunoglobulins in poultry. In present study, adequate VA increased the spleen index and sIgA content in jejunum while adequate VK₃ increased plasma IgG content. Interactive effects between two vitamins on plasma IgG content were observed that hens fed deficient or adequate VA and adequate VK₃ had higher plasma IgG content. Wang et al. (2015) found that fat-soluble vitamin contents in colostrum of cows may be changed in similar patterns and high colostral vitamin A is related with high colostral IgG. Hu et al. (2020) reported that gelatin and starch vitamin A supplementation both highly increased serum IgA and IgM level. This discrepancy may be because of the differences in the domestic animal species, age and measuring area. The influence of VK₃ on the immunoglobulin content of poultry was little reported.

Owing to the significant effects of VA and VK₃ on immunoglobulin and spleen index, the expressions of immune function-related genes in jejunum and spleen were detected. The pro-inflammatory cytokines are responsible for different phenomena underlying the inflammatory response including proliferation, differentiation, stimulation and activation of immune cells (Dinarello, 2000), including IL-1β, IL-6, IL-8 and TNF-α (Howren et al., 2009; Felger & Lotrich, 2013; Patil et al., 2018). IL-10 is a prototypical anti-inflammatory cytokine that acts via several mechanisms to ultimately minimize inflammation both within the periphery and in the central nervous system, and is one of the most potent anti-inflammatory cytokines (Lobo-Silva et al., 2016). Moreover, pIgR is one of the most vital components of mucosal immunity that plays an important role in mediating the transcytosis of polymeric immunoglobulins to protect organisms against pathogen invasion (Xu et al., 2021). iNOS is mainly produced by macrophages, and generates large amounts of NO at short intervals (Michel & Feron, 1997), which has a critical role in the immune system by acting as a cytotoxic and tumoricidal agent (Lin et al., 1996). In current study, hens fed adequate or excess VA had the decreased expression of IL-1β mRNA in jejunum and increased expression of IL-10 mRNA in spleen. VA and VK₃ showed main effects on the mRNA expression of iNOS and TNF-α in spleen with interactive effects being observed. Both adequate or excess VA and VK₃ increased the mRNA expression of pIgR in jejunum. Wang et al. (2020) reported that there were interactions between maternal and offspring VA on splenic IL-2, IL-1β and IFN-γ expression. Furthermore, Hatanaka et al. (2014) reported that VK₃ and VK₅ significantly inhibited the production of TNF-α, IL-4, IL-6, and IL-10 from the activated PBMCs at 10-100 µM. Abbasi et al. (2017) implies that appropriate levels of Vitamins D and K in ovo injection has beneficial effects on growth performance, immune system and bone development. The literature about VA and VK₃ supplementation on the diet of aged laying hens is limited and the underlying mechanism in improvement of immune function-related genes expression by VA and VK₃ supplementation in the current study needs further investigation.

VA and carotenoids improve the activity of antioxidant enzymes and maintain balance between oxidation and reduction (Palace et al., 1999). GSH-PX, SOD and CAT are important antioxidant enzymes and T-AOC is a comprehensive indicator of the functional status of antioxidant systems and is a result of the interaction of antioxidant enzymes in the body (Liang et al., 2019). In present study, although there were no interactive effect between VA and VK₃ on antioxidant capacity, excess VA or VK₃ increased the activities of T-SOD and CAT in jejunum. Furthermore, adequate and excess VA and VK₃ increased the activities of GSH-Px and T-AOC, respectively. Consistently, Hong et al. (2013) found that adding 3,000 IU/kg VA to the diet increased T-AOC, activities of T-SOD, GSH-Px, and CAT and decreased MDA content in serum of yellow feather broilers aged 43 to 63 D. Conversely, Hu et al. (2020) reported that dietary VA supplementation had no significant effects on serum T-AOC and SOD on d 21 and 42, but significantly increased serum GSH-Px activity. Wang et al. (2020) reported that maternal or offspring VA did not affect the activities of T-SOD and GSH-Px or the content of MDA. The influence of VK₃ on the antioxidant enzymes of poultry was little reported.

In addition to the activities of antioxidant enzymes mentioned above, we also detected the expressions of antioxidant enzymes and the regulating factor of antioxidant reaction in the jejunum. Transcription factor Nrf2 is a major regulator of cellular antioxidant defence, which controls the basic expression and induced expression of a series of antioxidant response elements-dependent genes to regulate redox homeostasis (Ma, 2013). In present study, excess VA up-regulated the mRNA expression of Nrf2 in jejunum while adequate and excess VK₃ not only increased the mRNA expression of Nrf2 but also CAT and SOD1 in jejunum. Moreover, interactive effect between two vitamins on Nrf2 expression in jejunum was observed. This suggests that VA and VK₃ might modulate the antioxidative capacity of laying hens in a Nrf2-dependent way, but the underlying mechanisms need further investigation.

CONCLUSION

In conclusion, dietary addition of adequate VA (7000 IU/kg) and VK₃ (2.0 mg/kg) can improve the immune function by increasing the immunoglobulin levels, and inhibiting the expressions of pro-inflammatory factors, and can also improve intestine antioxidant capacity by increasing the activity and expressions of antioxidant enzymes in aged laying hens and excess levels did not exhibit superior effects. Further research should be done in future.

ACKNOWLEDGEMENTS

This work was supported by the National Key R&D Program of China (grant number 2016YFD0501202-04) and Key Laboratory of Animal Feed and Nutrition of Zhejiang Province (202101) and the Project of Guanggu Science and Technology Innovation Large Corridor (2021BGE028).

REFERENCES

• Abbasi T, Shakeri M, Zaghari M, Kohram H. Growth performance parameters, bone calcification and immune response of in ovo injection of 25-hydroxycholecalciferol and vitamin K in male ross 308 broilers. Theriogenology 2017;90:260-5.
• Brody T. Vitamins and nutritional biochemistry. San Diego: Academic Press; 1993. p.403-10.
• Claudio F, Massimiliano B, Silvana V, Fabiola O, Maria DL, Enzo O, et al. Inflamm-aging: an evolutionary perspective on immunosenescence. Annals of the New York Academy of Sciences 2000;908:244-54.
• Combs JGF, Mcclung JP. The vitamins: fundamental aspects in nutrition and health. Amsterdam: Elsevier; 2016.
• Davis CY, Sell JL. Immunoglobulin concentrations in serum and tissues of vitamin A-deficient broiler chicks after Newcastle disease virus vaccination. Poultry Science 1989;68:136-44.
• Dinarello CA. Proinflammatory cytokines. Chest 2000;118:503-8.
• Felger JC, Lotrich FE. Inflammatory cytokines in depression: neurobiological mechanisms and therapeutic implications. Neuroscience 2013;246:199-229.
• Fleming RH, McCormack HA, McTeir L, Whitehead CC. Effects of dietary particulate limestone, vitamin K3 and fluoride and photostimulation on skeletal morphology and osteoporosis in laying hens. British Poultry Science 2003;44:683-9.
• Freidman A, Meidovaky A, Leitner G, Sklan D. Decreased resistance and immune response to Escherichia coli infection in chicks with low or high intakes of vitamin A. Journal of Nutrition 1991;121:395-400.
• Friedman A, Sklan D. Impaired T-lymphocyte immune response in vitamin A depleted rats and chicks. British Journal of Nutrition 1989;62:439-49.
• Gan LP, Zhao YZ, Mahmood T, Guo YM. Effects of dietary vitamins supplementation level on the production performance and intestinal microbiota of aged laying hens. Poultry Science 2020;99:3594-605.
• Guo S, Niu J, Xv J, Fang B, Zhang Z, Zhao D, et al. Interactive effects of vitamins A and K on laying performance, egg quality, tibia attributes and antioxidative status of aged Roman Pink laying hens. Animal 2021;15:100242.
• Hatanaka H, Ishizawa H, Nakamura Y, Tadokoro H, Tanaka S, Onda K, et al. Effects of vitamin K3 and K5 on proliferation, cytokine production, and regulatory T cell-frequency in human peripheral-blood mononuclear cells. Life Science 2014;99:61-8.
• Holmes DJ, Thomson SL, Wu J, Ottinger MA. Reproductive aging in female birds. Experimental Gerontology 2003;38:751-6.
• Hong P, Jiang ZY, Jiang SQ, Zhou GL, Zheng CT, Lin YC. VA supplemental level: effects on growth performance and antioxidant Parameters of yellow-feathered broilers aged from 43 to 63 Days. Chinese Journal of Animal Nutrition 2013;25:415-26.
• Howren MB, Lamkin DM, Suls J. Associations of depression with C-reactive protein, IL-1, and IL-6: a meta-analysis. Psychosomatic Medicine 2009;71:171-86.
• Hu YH, Zhang L, Zhang Y, Xiong HT, Wang FQ, Wang YZ, et al. Effects of starch and gelatin encapsulated vitamin A on growth performance, immune status and antioxidant capacity in weaned piglets. Animal Nutrition 2020;6:130-3.
• Huang Z, Liu Y, Qi G, Brand D, Zheng SG. Role of vitamin A in the immune system. Journal of Clinical Medicine 2018;7:258.
• Jing M, Munyaka PM, Tactacan GB, Rodriguez-Lecompte JC, House JD. Performance, serum biochemical responses, and gene expression of intestinal folate transporters of young and older laying hens in response to dietary folic acid supplementation and challenge with Escherichia coli lipopolysaccharide. Poultry Science 2014;93:122-31.
• Kheirouri S, Alizadeh M. Decreased serum and mucosa immunoglobulin a levels in vitamin A and zinc-deficient mice. Central European Journal of Immunology 2014;39:165-69.
• Liang JR, Dai H, Yang HM, Yang Z, Wang ZY. The effect of dietary vitamin A supplementation in maternal and its offspring on the early growth performance, liver vitamin A content, and antioxidant index of goslings. Poultry Science 2019;98:6849-56.
• Lin AW, Chang CC, McCormick CC. Molecular cloning and expression of an avian macrophage nitric-oxide synthase cDNA and the analysis of the genomic 5'-flanking region. Journal of Biological Chemistry 1996;271:11911-9.
• Liu F, Cottrell JJ, Furness JB, Rivera LR, Kelly FW, Wijesiriwardana U, et al. Selenium and vitamin E together improve intestinal epithelial barrier function and alleviate oxidative stress in heat-stressed pigs. Experimental Physiology 2016;101:801-10.
• Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2-DDCT method. Methods 2001;25:402-8.
• Lobo-Silva D, Carriche GM, Castro AG, Roque S, Saraiva M. Balancing the immune response in the brain: IL-10 and its regulation. Journal of Neuroinflamm 2016;13:297.
• Ma Q. Role of Nrf2 in oxidative stress and toxicity. Annual Review of Pharmacology and Toxicology 2013;53:401-26.
• McDowell LR. Vitamins in animal and human nutrition. Iowa: Iowa State University Press; 2000. p.227-58.
• Michel T, Feron O. Nitric oxide synthases: which, where, how, and why? Journal of Clinical Investigation 1997;100:2146-52.
• Molnar A, Maertens L, Ampe B, Buyse J, Zoons J, Delezie E. Supplementation of fine and coarse limestone in different ratios in a split feeding system: effects on performance, egg quality, and bone strength in old laying hens. Poultry Science 2017;96:1659-71.
• Palace VP, Khaper N, Qin Q, Singal PK. Antioxidant potentials of vitamin A and carotenoids and their relevance to heart disease. Free Radical Biology and Medicine 1999;26:746-61.
• Patil T, More V, Rane D, Mukherjee A, Suresh R, Patidar A, et al. Pro-inflammatory cytokine Interleukin-1b (IL-1b) controls Leishmania infection. Cytokine 2018;112:27-31.
• Pedro DM, Daniel P, Juliana DA, Juliana Rêgo, Francisco R, Aldo L. Modulation of intestinal immune and barrier functions by vitamin A: implications for current understanding of malnutrition and enteric infections in children. Nutrients 2018;1128:2-14.
• Rattanawut J, Pimpa O, Yamauchi KE. Effects of dietary bamboo vinegar supplementation on performance, eggshell quality, ileal microflora composition, and intestinal villus morphology of laying hens in the late phase of production. Animal Science Journal 2018;89:1572-80.
• Roberts JR. Factors affecting egg internal quality and egg shell quality in laying hens. Journal of Poultry Science 2004;41:161-77.
• Vervoort LMT, Ronden JE, Thijssen HHW. The potent antioxidant activity of the vitamin K cycle in microsomal lipid peroxidation. Biochemical Pharmacology 1997;54:871-6.
• Wan QL, Shi X, Liu J, Ding AJ, Pu YZ, Li Z, Wu GS, Luo HR. Metabolomic signature associated with reproduction-regulated aging in Caenorhabditis elegans. Aging 2017;9:447-463.
• Wang M, Ikeda S, Yoshioka H, Nagase H, Kitamura S, Itoyama E, et al. Relationships between immunoglobulin and fat-soluble vitamins in colostrum of Japanese Black multiparous cows. Animal Science Journal 2015;86:673-8.
• Wang Y, Li L, Gou Z, Chen F, Jiang S. Effects of maternal and dietary vitamin A on growth performance, meat quality, antioxidant status, and immune function of offspring broilers. Poultry Science 2020;99:3930-40.
• Xu G, Zhang J, Ma R, Wang C, Cheng H, Gong J, et al. The immune response of pIgR and iig to Flavobacterium columnare in grass carp (Ctenopharyngodon idellus). Fish and Shellfish Immunology 2021; 117:320-7,
• Zhang JC, Chen P, Zhang C, Khalil MM, Zhang NY, Qi DS, et al. Yeast culture promotes the production of aged laying hens by improving intestinal digestive enzyme activities and the intestinal health status. Poultry Science 2020;99:2026-32.
• Zhu L, Liao R, Wu N, Zhu G, Yang C. Heat stress mediates changes in fecal microbiome and functional pathways of laying hens. Applied Microbiology and Biotechnology 2019;103:461-72.

Publication Dates

• Publication in this collection
  23 Sept 2022
• Date of issue
  2022

History

• Received
  23 Sept 2021
• Accepted
  01 June 2022