Isolation of Actinobacillus seminis from a goat with clinical epididymo-orchitis in Brazil

Isolation of Actinobacillus seminis from a goat with clinical epididymo-orchitis in Brazil

Fabrine Alexandre dos Santos^I; Edísio Oliveira de Azevedo^I; Sérgio Santos de Azevedo^I; Felício Garino Júnior^I; Rinaldo Aparecido Mota^II; Pomy de Cássia Peixoto Kim^II; Ana Lisa Vale Gomes^II; Clebert José Alves^I

^IUnidade Acadêmica de Medicina Veterinária, Centro de Saúde e Tecnologia Rural, Universidade Federal de Campina Grande, Patos, PB, Brazil

^IIDepartamento de Medicina Veterinária, Universidade Federal Rural de Pernambuco, Recife, PE, Brazil

^{Send correspondence}

ABSTRACT

The present study reports the first isolation of Actinobacillus seminis from a goat in Brazil. A four-year-old Moxotó breeding goat in a flock of 70 goats and 65 sheep reared together in the county of Patos, semiarid region of Northeastern Brazil, showed clinical signs of unilateral orchitis and epididymitis. Diagnosis of A. seminis infection was confirmed by association of clinical findings, bacterial isolation and 16S rRNA gene sequencing. This result suggests that A. seminis may be an additional cause of infertility in goats, and that sheep may be the source of infection because the mixed farming system allows the contact between sheep and goats in the semiarid region of Northeastern Brazil.

Key words: epididymitis, goats, Actinobacillus seminis, isolation.

Introduction

Goat breeding has great economic importance in many countries, including Brazil. However, several factors negatively affect goat breeding including nutritional and health issues, and infectious diseases (Pinheiro et al., 2000).

It is documented that ovine epididymitis due to A. seminis is one of the major cause of economic losses as it reduces and interferes with the fertility of infected ram. Its pathogenesis is uncertain, but it is suggested that A. seminis may ascends from the preputial cavity and colonizes the genital tract, causing the clinical signs, and that predisposing factors such as stress induced by hormone changes, as well as nutritional deficiencies can cause the development of orchitis and epididymitis, particularly in young sheep (Hajtós et al., 1987; Dibarrat et al., 2006).

The first isolation of A. seminis was reported by Baynes and Simmons (1960), in Australia, in semen of rams with epididymitis. Then, the bacterium was isolated in several occasions in different countries: United States of America (Livingston and Hardy, 1964), South Africa (Worthington and Bosman, 1968), New Zealand (Bruere et al., 1977), Hungary (Hajtós et al., 1987), Argentine (Robles et al., 1990), Brazil (Gomes et al., 2001; Gregory et al., 2009; Bezerra et al., 2012), United Kingdom (Heath et al., 1991), Spain (Puente-Redondo et al., 2000), Turkey (Diker et al., 1991), Kenya (Mbai et al., 1996) and Mexico (Narez et al., 1999). Interestingly, it was reported that A. seminis had been isolated from bulls and goat in South Africa (Van Tonder and Bolton, 1970; Van Tonder, 1973) and from cattle in New Zealand (Dixon et al., 1983).

This paper documents the first isolation of the microorganism from a goat with clinical signs of epididymitis and orchitis in Brazil.

Materials and Methods

Field observation and clinical signs

During a visit in a farm in the county of Patos, State of Paraíba, semiarid region of Brazil to investigate the reasons of reduced fertility, where there were 135 animals, 70 goats and 65 sheep reared, a four-year-old Moxotó breeding goat was found to have clinical signs of unilateral orchitis and epididymitis on the right side (Figure 1). Clinical examination of the area showed firm consistency of the epididymis and testis, with absence of ulceration or nodularity, sensitivity to palpation and adhesions of the scrotum.

Serological examination

Blood samples were collected from all animals by jugular vein puncture. Agar gel immunodiffusion (AGID) test was used for the detection of anti-B. ovis antibodies with commercial kits produced by the Institute of Technology of Paraná (TECPAR, Curitiba, Paraná, Brazil), using lipopolysaccharide antigen and proteins of B. ovis strain Reo 198. Buffered Acidified Plate Antigen Test (BAPA) was used for serodiagnosis of B. abortus using an inactivated B. abortus strain 1119-3 antigen, produced by the Institute of Technology of Paraná (TECPAR, Curitiba, Paraná, Brazil), at the cellular concentration of 4% and Rose Bengal stained (OIE, 2008).

Bacteriological examination

Weekly samples of semen were collected from the goat diagnosed with epididymitis and orchitis using electroejaculation for three successive weeks. Fine needle aspirates of a caseous and white to yellow material of the testis and the tail of the epididymis were also performed by aspiration with disposable syringes and needles. The samples were plated on blood agar and Brucella agar (Difco, Franklin Lakes, NJ, USA) enriched with defibrinated sheep blood at a concentration of 5% of the total volume. All samples were incubated at 37 ºC in an atmosphere containing 10% of carbon dioxide (CO₂). Cultures were examined daily for five days for visible growth. The bacteria isolated were subjected to Gram staining and biochemical tests (catalase, oxidase, nitrate and esculin; and acid production from maltose, xylose, galactose and trehalose) according to Krieg and Holt (1984).

Molecular examination

Semen, aspirates and isolated bacteria samples were subjected to DNA extraction according to the manufacturer's protocol using the commercial kit "Qiagen DNeasy^® Blood and Tissue Kit" (Qiagen, Austin, TX, USA).

Polimerase Chain Reaction (PCR) technique for Brucella spp.

Specific primers directed to the 16S-23S ribosomal RNA (rRNA) interspace region of Brucella spp. (ITS66: ACATAGATCGCAGGCCAGTCA and ITS279: AGATACCGACGCAAACGCTAC) (Keid et al., 2007) were used, which amplify with 214 bp. The amplification reaction mixture was prepared in a volume of 12.5 µL containing 200 µM of each deoxynucleoside tryphosphate, 50 mM KCl, 10 mM Tris-HCl (pH 9.0), 1.5 mM MgCl₂, 0.5 mM of each primer, 1.5 U platinum Taq DNA polymerase (Invitrogen, Carlsbad, CA, USA) and 5 µL of template DNA.

The reaction was performed in a DNA thermal cycler (MJ Research PTC 200 DNA engine, Watertown, MA, USA) without mineral oil. Ultrapure water was used as negative control while B. ovis strain 63/290 served as positive control. After an initial denaturation at 95 ºC for 2 min, the PCR profile was set as follows: 30 s of template denaturation at 95 ºC, 30 s of primer annealing at 62 ºC and 30 s of primer extension at 72 ºC, for a total of 40 cycles, with a final extension at 72 ºC for 5 min.

PCR technique for A. seminis

SRJAS1 (CTTATCTTTCTTAAGCCCTGAC) and SRJAS2 (AAGAAAAAGACGAAGAGACATT) primers were used, which amplify the 16S rRNA gene with 436 bp (Appuhamy et al., 1998b). Amplification reactions were performed in a final volume of 25 µL containing 2.5 µLof PCR buffering solution (100 mM Tris-HCL, 15 mM MgCl2, 500 mM KCl, pH 8.3), 2 µL (0.2 µM) of each dNTP, 1.0 µL (50 pM) of each primer, 0.125 µL (0.625 U) of Taq polymerase (Qiagen, Austin, TX, USA), 2.5 µLof genomic DNA and 16.87 µL of Milli-Q ultrapure water, according to the supplier's protocol.

The thermal profile of the stages of reactions was measured on Thermal Cycler (Bioer Technology CO LTD, Hangzhou, China), consisting of an initial denaturation of DNA at 94 ºC (1 min) and followed by 35 cycles at 94 ºC for 30 s for denaturation, 55 ºC for 30 s for annealing, 72 ºC for 6 min for extension and final extension of 1 min at 72 ºC, according to Appuhamy et al. (1998a).

Amplified products were analyzed by electrophoresis in a 2% agarose gel and then stained with ethidium bromide (0.5 mgµML). The DNA bands were visualized under UV light.

DNA sequencing

Sequencing reactions were performed using the kit "The BigDye^® Terminator v3.1 Cycle Sequencing" (Applied Biosystems, Foster City, CA, USA) and polymerization conditions were performed in 96 well plates according to manufacturer's instructions. Samples were sequenced by the dideoxy terminator method in automatic in ABI PRISM 3100 Genetic Analyser for automated sequencing (Applied Biosystem), with subsequent analysis of sequence identity performed using Jalview software (http://www.jalview.org/).

Results

Serological findings

All animals were found to be negative (100%) for B. abortus by BAPA test, while five sheep (n = 5, 8%) and nine goats (n = 9, 13%) including the diseased goat were found to be positive for B. ovis by IDGA.

Bacteriological findings

Small smooth, shining and non-pigmented colonies (1 to 2 mm) were isolated from semen samples. They approved to be non-motile, Gram negative coccobacilli. Biochemically, isolated organism was catalase, oxidase, nitrate and esculin positive. It produces acid from maltose and xylose but not from galactose and trehalose.

PCR findings

PCR was negative for Brucella spp. However, A. seminis DNA was amplified from weekly-collected semen samples and isolated colonies (isolate SAAS01). Sequence of PCR products from semen samples and colonies that revealed a DNA fragment of a standard size showed 99% similarity with the region of the 16S rRNA gene of A. seminis.

Discussion

Positive sequencing following isolation of A. seminis in goats is the first report of this kind in Brazil. A fact that deserves attention concerns the mixed farming system of goats and sheep in Brazil. The isolation of A.seminis from a Boer goat, bull semen, and from an Angora goat, an Afrikaner and Friesland bull raised the wide range of host involvement and the role of both sheep and goat in the dissemination of actinobacillosis (Al-Katib and Dennis, 2005) and indicate that these species may serve as sources of infection for A. seminis and thus aid in the spread and transmission of infection when they are in contact with rams under intensive systems (Al-Katib and Dennis, 2009).

Clinical and pathological findings of the epididymitis and orchitis in the tested goat were properly similar to those described by others (Bezerra et al., 2012). The signs of infection by A. seminis deserve special consideration because the effects are not noticeable or measurable (Gomes et al., 2001), particularly in extensive breeding systems or when farmers are not aware of the economic importance of the disease (Bezerra et al., 2012). It should be stressed that the clinical changes observed are usually associated with low concentration, low motility and non viability of sperms, besides the presence of neutrophils in the semen, which affect the fertility rate of breeders, and in the regions where the disease has not been previously diagnosed, economic losses may be even greater (Baynes and Simmons, 1960; Van Tonder, 1973; Bezerra et al., 2012).

Our findings indicated that serological tests did not yield satisfactory results. In this study, positive AGID in the goat raises the possible simultaneous presence of B. ovis seropositive animal when infected with A. seminis, which should be subject of further investigations. This in contrast with those results reported by Gomes et al. (2001) and Gregory et al. (2009) that isolated A. seminis in sheep, which were AGID-negative for B. ovis.

In the present study, the isolation of A.seminis from a goat would suggest that infection be disseminated in adult breeding goats, which makes control difficult, because of the continued exchange of breeding goats between the farmers and their commercialization without proper healthcare.

The differential diagnosis of orchitis and epididymitis must be based on clinical and pathological diagnosis, the isolation and identification of the causative agent (Sponenberg et al., 1983). Our findings indicated that the morphological, and biochemical characteristics allowed its identification as A. seminis.

It is concluded that A. seminis should be considered as differential diagnosis in cases of epididymitis in goats particularly in the Northeastern Brazil where the mixed farming system is widely adopted, and the agent has already been isolated in sheep.

Submitted: August 9, 2012;

Approved: September 9, 2013.

All the content of the journal, except where otherwise noted, is licensed under a Creative Commons License CC BY-NC.

References

• Al-Katib WA, Dennis SM (2005) Experimental transmission of Actinobacillus seminis infection to rams. Vet Rec 157:143-147.
• Al-Katib WA, Dennis SM (2009) Ovine genital actinobacillosis: a review. NZ Vet J 57:352-358.
• Appuhamy S, Coote JG, Low JC (1998a) PCR methods for rapid identification and characterization of Actinobacillus seminis strains. J Clin Microbiol 36:814-817.
• Appuhamy S, Low JC, Parton R, Coote JG (1998b) Specific PCR primers from the Actinobacillus seminis J Appl Microbiol 185:941-948.
• Baynes ID, Simmons GC (1960) Ovine epididymitis caused by Actinobacillus seminis N. sp. Aust Vet J 36:454-459.
• Bezerra MJG, Santos AS, Cruz JALO, Kung ES, Sá SG, Jabour FF, Brito MF, Mota RA (2012) Epididimite ovina por Actinobacillus seminis no Estado de Pernambuco. Pesq Vet Bras 32:369-373.
• Bruere AN, West DM, MacLachlan NJ, Edwards ND, Chapman HM (1977) Genital infection of ram hoggets associated with a Gram-negative pleomorphic organism. NZ Vet J 25:191-193.
• Dibarrat JA, Aparicio ED, Reynoso BA, Aparicio BD, Gutiérrez VRT, Pérez JT (2006) Inducción experimental de epididimitis en ovinos por inoculación intrauretral com Actinobacillus seminis: estudio bacteriológico, serológico e histopatológico. Rev Tec Pec México 44:257-267.
• Diker KS, Aydin F, Sertel M, Yurdaydi N, Daskin A, Kaya O (1991) Prevalence and causes of ram epididymitis in Turkey. Turk J Vet Anim Sci 15:65-71.
• Dixon RJ, Stevenson BJ, Sims KR (1983) Actinobacillus seminis isolated from cattle. NZ Vet J 31:122-123.
• Gomes MJP, Driemeier D, Bonetti AL, Eidt M, Azambuja DR (2001) Epididimite ovina: isolamento de Actinobacillus seminis no Rio Grande do Sul, Brasil. Arq Fac Vet UFRGS 29:55-58.
• Gregory L, Rizzo HH, Meira Júnior EBS, Lins GJV, Lins GPV, Pinheiro ES (2009) Relato do primeiro caso de orquite e epididimite unilateral ovina causada por Actinobacillus seminis no estado de São Paulo, Brasil. Rev Bras Rep Anim 33:105-107.
• Hajtós I, Fodor L, Glávits R, Varga J (1987) Isolation and characterization of Actinobacillus seminis strains from ovine semen samples and epididymitis. J Vet Med B 34:138-147.
• Heath PJ, Davies IH, Morgan JH, Aitken IA (1991) Isolation of Actinobacillus seminis from rams in United Kingdom. Vet Rec 129:304-307.
• Keid LB, Soares RM, Vieira NR, Megid J, Salgado VR, Vasconcellos SA, Costa M, Gregori F, Richtzenhain LJ (2007) Diagnosis of canine brucellosis: comparison between serological and microbiological tests and a PCR based on primers to 16S-23S rDNA interspacer. Vet Res Commun 31:951-965.
• Krieg NR, Holt JG (1984) Bergey's manual of systematic bacteriology. Williams & Wilkins, Baltimore.
• Livingston CW, Hardy WT (1964) Isolation of Actinobacillus seminis from ovine epididymitis. Am J Vet Res 25:660-663.
• Mbai K, Munyua SJM, Gathumbi PK, Mbiuki SM (1996) Actinobacillus seminis as a cause of ram infertility in Kenya. Small Rum Res 3:227-231.
• Narez GM, Aparicio ED, Morales-Alvarez JF, Romero FA, Guemes FS (1999) Ovine epididymitis: bacteriological and serological studies. Vet Mexico 30:329-336.
• OIE -World Organization for Animal Health (2008) Caprine and ovine brucellosis (excluding Brucella ovis). Manual of Standards for Diagnostic Tests and Vaccines for Terrestrial Animals. 6th ed. Available at: http://www.oie.int/eng/normesmmanual Accessed 18 June 2012.
• Pinheiro RR, Gouveia AMG, Alves FSF, Haddad JPA (2000) Aspectos epidemiológicos da caprinocultura cearense. Arq Bras Med Vet Zootec 52:534-543.
• Puente-Redondo VA, García Del Blanco N, Pérez-Martínez C, González-Rodríguez MC, Rodríguez-Ferri EF, Gutiérrez-Martín CB (2000) Isolation of Actinobacillus seminis from the genital tract of rams in Spain. J Comp Pathol 122:217-222.
• Robles CA, Urcullu JA, Uzal FA, Merio R (1990) Primer diagnostico em Patagonia de orchideoepididimitis em carneros por bacilos pleomorficos Gram negativos. Vet Argent 7:453-455.
• Sponenberg DP, Carter ME, Carter GR, Cordes DO, Stevens SE, Veit HP (1983) Suppurative epididymitis in a ram infected with Actinobacillus seminis J Am Vet Med Assoc 182:990-991.
• Van Tonder EM, Bolton TFW (1970) The isolation of Actinobacillus seminis from bovine semen: a preliminary report. J South African Vet Med Assoc 41:287-288.
• Van Tonder EM (1973) Infection of rams with Actinobacillus seminis J South African Vet Med Assoc 44:235-240.
• Worthington RW, Bosman PP (1968) Isolation of Actinobacillus seminis in South Africa. J South African Vet Med Assoc 39:81-85.

Publication Dates

• Publication in this collection
  08 Apr 2014
• Date of issue
  2014

History

• Accepted
  09 Sept 2013
• Received
  09 Aug 2012