The complete mitochondrial genome of Corydoras nattereri (Callichthyidae: Corydoradinae)

ABSTRACT

The complete mitogenome of Corydoras nattereri , a species of mailed catfishes from southeastern Brazil, was reconstructed using next-generation sequencing techniques. The mitogenome was assembled using mitochondrial transcripts from the liver transcriptomes of three individuals, and produced a circular DNA sequence of 16,557 nucleotides encoding 22 tRNA genes, two rRNA genes, 13 protein-coding genes and two noncoding control regions (D-loop, OrigL). Phylogeographic analysis of closely related sequences of Cytochrome Oxydase C subunit I (COI) demonstrates high diversity among morphologically similar populations of C. nattereri . Corydoras nattereri is nested within a complex of populations currently assigned to C. paleatus and C. ehrhardti . Analysis of mitogenome structure demonstrated that an insertion of 21 nucleotides between the ATPase subunit-6 and COIII genes may represent a phylogenetically informative character associated with the evolution of the Corydoradinae.

Keywords:
Barcode; DNA; Mitogenome; Molecular diversity; mtRNA.

RESUMO

O mitogenoma completo de Corydoras nattereri , uma espécie de bagres encouraçados do sudeste do Brasil, foi reconstruído através de técnicas de sequencimento de DNA de próxima geração. O mitogenoma foi produzido a partir de produtos de transcrição mitocondrial dos transcriptomas hepáticos de três indivíduos, resultando numa sequência de DNA circular de 16.557 nucleotídeos abrangendo 22 genes de tRNA, dois genes de rRNA, 13 genes codificadores de proteínas e duas regiões de controle não codificadoras (D-loop, OrigL). A análise filogenética de sequências proximamente relacionadas da subunidade I do gene Citocrome Oxidase C (COI) demonstrou a existência de elevada diversidade entre populações morfologicamente similares de C. nattereri . Corydoras nattereri está inserida num complexo de populações atualmente identificadas como C. paleatus e C. ehrhardti . A análise da estrutura do mitogenoma demonstra que a inserção de uma sequência de 21 nucleotídeos entre os genes da subunidade 6 da ATPase e do COIII representa um caráter filogeneticamente informativo associado à evolução de Corydoradinae.

Introduction

Corydoradinae are a species-rich group of armored freshwater catfishes that inhabit streams, rivers and floodplains throughout South America (Alexandrou et al., 2011). Together with the Callichthyinae, they comprise the Callichthyidae, a family of catfishes diagnosed by the presence of two series of bony plates on the sides of the body and one pair of barbels at lips junction (Reis, 1998). The Corydoradinae comprises 227 nominal taxa and 188 valid species (Eschmeyer & Fong, 2015), assigned to the Aspidoras Ihering, 1907, Corydoras Lacépède, 1803, and Scleromystax Gunther, 1864 (Britto, 2003). Corydoras is the most species-rich genus of catfishes with over 160 described and nearly as many undescribed species (Alexandrou et al. , 2011; Eschmeyer & Fong, 2015). According to Reis (2003) about two new species of Corydoras are described each year. While the Callichthyinae is relatively well-known based on morphological (Reis, 1997, 1998, 2003) and molecular studies (Mariguela et al., 2013), the Corydoradinae remains poorly known, despite their great interest to the aquarium hobby. Phylogenetic studies that included species of Corydoras have been performed, primarily by Britto (2003) based on morphological characters, and more recently by Alexandrou et al. (2011), based on molecular data. In the later study, however, a large proportion of the 52 taxa recognized could not be associated to a valid name, with many species being referenced to informal "C-Numbers" (Fuller & Evers, 2005) available from the aquarium industry or to their geographic origin.

Corydoras nattereri Steindachner, 1876, is a widespread species of Corydoras in southeastern Brazil, ranging from rio Mucuri, in Bahia, to the Paranaguá Bay, in Paraná (Britto, 2007; Shimabukuro-Dias et al., 2004a). Corydoras nattereri and Scleromystax prionotos (Nijssen & Isbrücker, 1980) form a pair of color mimics where their distribution overlaps (Alexandrou et al., 2011). The geographic range of C. nattereri represents a distributional range of about 1,350 km, encompassing numerous isolated coastal river drainages. With such widespread distribution it is not surprising that significant variability has been found among various populations of C. nattereri . Oliveira et al. (1990) identified three different cytotypes among these populations, that differ in number of chromosomes (2n numbers of 40, 43 and 44), suggesting that more than one species is represented by the taxon. That cytogenetic variation among populations was later correlated with variation in DNA sequence data (Simabukuro-Dias et al. , 2004b).

Currently partial sequences of the Cytochrome Oxydase C subunit I (COI) of Corydoras nattereri , a widely used DNA barcode marker, are available publicly from only two localities (Pereira et al., 2011, 2013). Sequences of additional mitochondrial genes have been made available by Alexandrou et al. (2011), but only specimens with imprecise locality data have been listed in that study. Within the Corydoradinae, complete mitochondrial sequence data is only available for C. rabauti from a specimen without associated locality data (Saitoh et al., 2003). Herein, we present the complete mitochondrial genome for C. nattereri based on three specimens with precise geographic provenance, thus providing a significant increment in DNA data available for phylogenetic studies of the Corydoradinae.

Material and Methods

Specimens of Corydoras nattereri were collected in the rio Suruí (22.600556 S, -43.091667 W) at the Santo Aleixo district, Magé, Rio de Janeiro, Brazil. The fish were deposited at the Museu Nacional, Rio de Janeiro, UFRJ (MNRJ 41520) and tissues from tree individuals (MNTI 8664-8666) were preserved in ethanol and RNALater. Total RNA was extracted from the liver tissue following conventional phenol-chloroform extraction. RNA quality was accessed using the RNA Nano kit for Bioanalyzer (Agilent). Three individual cDNA libraries were constructed using the TruSeq RNA Sample kit v.2 (Illumina). Libraries were accessed for quality (Bioanalyzer, DNA1000 kit, Agilent) and quantity (Kapa Biosystems). Two separated runs (single-end and paired-end) were performed in an Illumina HiSeq 2500 using the TrueSeq SBS kit v.3 (Illumina). Raw Illumina data were demultiplexed using the BCL2FASTQ software (Illumina). Reads were trimmed for Illumina adaptors by Trimmomatic (Bolger et al., 2014) and its quality was evaluated using FastQC (Babraham Bioinformatics). Only reads with Phred score over 30 were used for the transcriptome assembly. Cleaned reads from the three individual fish were used for the de novo assembly of transcriptomes using the default parameters of Trinity (v. 2.0.2) (Haas et al., 2013). Mitochondrial genomes were assembled using the mitochondrial transcripts from the liver transcriptome, following the approach described by Moreira et al. (2015a, 2015b). Briefly, mitochondrial transcripts were retrieved running a BLASTN search against the mitogenome of the closest related species with a complete mitogenome available, Corydoras rabauti (GI: 29501080) (Saitoh et al., 2003). Mitochondrial transcripts were edited according to the information of strand orientation given by the BLASTN result, and aligned with SeaView using the built-in CLUSTAL alignment algorithm and the mitogenome of C. rabauti (Gouy et al., 2010). The sequence of each CONTIG was manually checked for inconsistencies and gaps. Small gaps at mitogenomes, which code for transfer RNAs, were completed with Sanger sequencing data from PCR with specific designed primers. As the identity of the three assembled mitogenomes was higher than 99.8%, the three sequences were concatenated in one consensus sequence. The consensus mitogenome was annotated using the web-based services MitoFish and MITOS (Iwasaki et al., 2013; Bernt et al., 2013), and the origin of the L-strand replication was identified based on Wong et al. (1983). In order to determine sequencing depth of each base in the mitogenome, Bowtie v. 1.0.0 was used to align the reads on the assembled mitogenome. The aligned reads were viewed using Integrated Genome Viewer (IGV), Tablet (Langmead et al., 2009; Milne et al., 2010; Robinson et al., 2011; Thorvaldsdóttir et al., 2012), and Geneious version 6 (http://www.geneious.com, Kearse et al., 2012).

A Maximum Likelihood (ML) analysis of relationships was performed to position the mitogenomes within a taxonomic and phylogenetic context. All publicly available sequences of COI that exhibited nucleotide identity greater than 90% in a BLAST search of the GenBank Nucleotide Database and Bold Systems were included in the analysis, as well as additional sequences of Corydoras nattereri , Callichthys callichthys , Scleromystax barbatus , and Aspidoras lakoi (the latter three used as outgroups) produced in the Museu Nacional (MNLM) laboratory (Table 1) using Sanger sequencing methods, and the corresponding COI sequence extracted from the C. rabauti mitochondrial genome (GenBank Accession AB054128). To ensure uniformity of coverage, only nucleotides from positions 58 to 699, and only sequences with full coverage of that segment were included in the analysis, producing a matrix of nucleotide sequences from 35 fish. The ML analysis was performed using Mega 6.06 (Tamura et al., 2013) under the Hasegawa-Kishino-Yano model (Hasegawa et al., 1985), selected by the corrected Akaike information criterion using jModeltest v.2.1.7 (Darriba et al., 2012). Initial tree(s) for the heuristic search were obtained by Neighbor-Join and BioNJ algorithms applied to a matrix of pairwise distances estimated using the Maximum Composite Likelihood (MCL) approach. The discrete Gamma distribution was used to model evolutionary differences among sites, with 5 categories (+G, parameter = 0.1563). Branch support was estimated with the Bootstrap method, using 350 replications. The tree was rooted using Callichthys callichthys as outgroup.

Table 1
List of samples used in this study, ordered according to GenBank Accession codes. Voucher museum catalog number is provided only for specimens that are being made available for the first time.

GenBank Accession	BOLD ProcessID	Sample	Voucher	Species	Publication/Source	Latitude	Longitude	Locality
GU701815	FUPR517-09	LBP-32757		Corydoras ehrhardti	Pereira et al., 2013	-23,9383	-50,7290	Upper Parana basin, Brazil
GU701816	FUPR516-09	LBP-32756		Corydoras ehrhardti	Pereira et al., 2013	-23,9383	-50,7290	Upper Parana basin, Brazil
GU701817	FUPR818-09	LBP-36128		Corydoras ehrhardti	Pereira et al., 2013	-23,9383	-50,7290	Upper Parana basin, Brazil
GU701818	FUPR817-09	LBP-36126		Corydoras ehrhardti	Pereira et al., 2013	-23,9383	-50,7290	Upper Parana basin, Brazil
GU701819	FUPR816-09	LBP-36124		Corydoras ehrhardti	Pereira et al., 2013	-23,9383	-50,7290	Upper Parana basin, Brazil
GU701809	FUPR819-09	LBP-36114		Corydoras paleatus	Pereira et al., 2013	-	-	Upper Parana basin, Brazil
GU701810	FUPR822-09	LBP-36119		Corydoras paleatus	Pereira et al., 2013	-	-	Upper Parana basin, Brazil
GU701812	FUPR824-09	LBP-36122		Corydoras paleatus	Pereira et al., 2013	-	-	Upper Parana basin, Brazil
GU701813	FUPR823-09	LBP-36121		Corydoras paleatus	Pereira et al., 2013	-	-	Upper Parana basin, Brazil
GU701814	FUPR515-09	LBP-32755		Corydoras ehrhardti	Pereira et al., 2013	-23,9383	-50,7290	Upper Parana basin, Brazil
GU701871	FUPR820-09	LBP-36116		Corydoras paleatus	Pereira et al., 2013	-	-	Upper Parana basin, Brazil
GU702213	FPSR082-09	LBP-29094		Corydoras nattereri	Pereira et al., 2011	-23,3690	-46,0240	[Rio Paraíba do Sul upstream from Jacareí], SP, Brazil
JN988818	FUPR285-09	LBP-32330		Corydoras nattereri	Pereira et al., 2013	-23,5112	-45,8591	[rio Paraitinguinha, Tietê drainage], upper Paraná Basin, SP, Brazil
JN988819	FUPR286-09	LBP-32331		Corydoras nattereri	Pereira et al., 2013	-23,5112	-45,8591	[rio Paraitinguinha, Tietê drainage], upper Paraná Basin, SP, Brazil
JN988821	FUPR288-09	LBP-32333		Corydoras nattereri	Pereira et al., 2013	-23,5112	-45,8591	[rio Paraitinguinha, Tietê drainage], upper Paraná Basin, SP, Brazil
JN988822	FUPR289-09	LBP-32334		Corydoras nattereri	Pereira et al., 2013	-23,5112	-45,8591	[rio Paraitinguinha, Tietê drainage], upper Paraná Basin, SP, Brazil
JX111730	FARGB202-11	UNMDP-T 0370		Corydoras paleatus	Rosso et al., 2012	-36,2680	-59,9800	Arroio Tapalque, Buenos Aires, Argentina
JX111731	FARGB238-11	UNMDP-T 0406		Corydoras paleatus	Rosso et al., 2012	-38,3350	-61,6014	El Divisorio Stream, Buenos Aires, Argentina
JX111732	FARGB358-11	UNMDP-T 0526		Corydoras paleatus	Rosso et al., 2012	-34,9700	-61,0433	Adeg Puente Santa Cruz (Ascencion), Buenos Aires, Argentina
JX111733	FARGB239-11	UNMDP-T 0407		Corydoras paleatus	Rosso et al., 2012	-38,3350	-61,6014	El Divisorio Stream, Buenos Aires, Argentina
JX111734	FARGB201-11	UNMDP-T 0369		Corydoras paleatus	Rosso et al., 2012	-36,2680	-59,9800	Arroyo Tapalque, Buenos Aires, Argentina
JX111735	FARGB200-11	UNMDP-T 0368		Corydoras paleatus	Rosso et al., 2012	-36,2680	-59,9800	Arroyo Tapalque, Buenos Aires, Argentina
JX111736	FARGB184-11	UNMDP-T 0352		Corydoras paleatus	Rosso et al., 2012	-35,6056	-59,9914	Chascomus lagoon, Buenos Aires, Argentina
JX111737	FARGB183-11	UNMDP-T 0351		Corydoras paleatus	Rosso et al., 2012	-35,6056	-59,9914	Chascomus lagoon, Buenos Aires, Argentina
JX111738	FARGB172-11	UNMDP-T 0340		Corydoras paleatus	Rosso et al., 2012	-35,5411	-58,0894	Vitel lagoon, Buenos Aires, Argentina
KT874579	MNRJ531-15	MNTI9093/MNLM5113	MNRJ41901	Callichthys callichthys	This study	-19,9753	-40,5478	rio Valssungana Velha, Reis Magos drainage, near bridge of Santa Teresa - Santa Leopoldina road, Santa Teresa, ES, Brazil
KT874580	MNRJ533-15	MNTI554/MNL1354	MNRJ31639	Aspidoras lakoi	This study	-20,7500	-46,2122	Left bank tributary of ribeirão do Turvo, between Fazenda da Serra de Cima and Fazenda Baixadão, Capitólio, MG, Brazil
KT874581	MNRJ538-15	MNTI8665/MNLM5103	MNRJ41520	Corydoras nattereri	This study	-22,6006	-43,0917	Tributary of rio Suruí and rio Suruí downstream of Piabeta - Santo Aleixo road, Magé, RJ, Brazil
KT874582	MNRJ532-15	MNTI7422/MNLM4992	MNRJ40948	Scleromystax barbatus	This study	-26,1972	-49,9219	Rio Lindo (right margin tributary of rio Cubatão), SC-301, bairro Dona Francisca, Joinville, SC, Brazil
KT874583	MNRJ534-15	MNTI3387/MNLM935	MNRJ37470	Corydoras nattereri	This study	-22,4675	-42,2975	Córrego Aldeia Velha, under bridge on road Aldeia Velha, near RPPN Fazenda do Bom Retiro, Casimiro de Abreu, RJ, Brazil
KT874584	MNRJ539-15	MNTI8666/MNLM5104	MNRJ41520	Corydoras nattereri	This study	-22,6006	-43,0917	Tributary of rio Suruí and rio Suruí downstream of Piabeta - Santo Aleixo road, Magé, RJ, Brazil
KT874585	MNRJ537-15	MNTI8664/MNLM5102	MNRJ41520	Corydoras nattereri	This study	-22,6006	-43,0917	Tributary of rio Suruí and rio Suruí downstream of Piabeta - Santo Aleixo road, Magé, RJ, Brazil
KT874586	MNRJ536-15	MNTI7464/MNLM5000	MNRJ41030	Corydoras ehrhardti	This study	-26,2803	-49,3244	rio Vermelho, Itapocu drainage, downstream of dam, upstream of aqueduct, São Bento do Sul, SC, Brazil
KT874587	MNRJ535-15	MNTI3832	MNRJ37693	Corydoras nattereri	This study	-18,3106	-40,2411	rio do Sul under bridge of ES-130 between Vinhático and Pinheiros, on municipal border between Montanha and Pinheiros, ES, Brazil

Results

Sequencing depth. The complete mitochondrial genome sequence of C. nattereri is 16,557 bp long (GenBank Accessions No. KT239008, KT239009, KT239010, Fig. 1). A total of 152,877,464 100bp reads were used to assemble the transcriptomes. On average, 12 transcripts were aligned to the reference mitogenome. These aligned transcripts were used to assembly the mitogenome of Corydoras nattereri , which was sequenced with an average coverage depth of 8,194 and a total of 1,378,370 aligned reads (Fig. 2). The sequencing depth varied greatly along the mitogenome sequence, from as low as of 1 read, to as high as 69,778 reads. Cytochrome oxidase subunits I, II and III were the protein-coding genes with the highest number of reads. Regions with lower sequencing depth tend to code for tRNA. Five small gaps, varying from 21 to 183 nucleotides, were filled by conventional PCR and Sanger sequencing (Table 2).

Fig. 1
Circular representation of the mitochondrial genome of Corydoras nattereri . Genes encoded in the heavy strand are shown in the outer circle and genes encoded in the light strand are offset inwards. The inner circle represents the CG-content. Figure was generated by the online server MitoFish, http://mitofish.aori.u-tokyo.ac.jp (Iwasaki et al ., 2012).

Fig. 2
Sequencing depth over the complete mitogenomes of the three individuals of Corydoras nattereri: KT239008 (A), KT239009 (B), and KT239010 (C). Read counts (y-axis) are shown in logarithmic scale and sharp decreases correspond to the punctuation model of mitochondrial transcription (positions correspond to those shown in Fig. 1 and Table 3). Black vertical bars indicate position of gaps that were filled with Sanger sequencing (Table 2). Reads were mapped to the mitogenomes using Bowtie and visualized at the Integrative Genome Viewer (IGV, Bernt et al., 2013; Thorvaldsdóttir et al ., 2013).

Table 2
Positions and lengths of the five gaps in the mitogenome assembled using mitochondrial transcripts sequenced using Illumina HiSeq2500. These gaps were filled using conventional PCR and Sanger sequencing with the species-specific primers listed.

Gap position	Length (nucleotides)	Primers
		Forward	Reverse
1 - 81	81	CAGATTAGGCTCGACCGACG	GGCGTATGACGGCTTGGTAA
995 - 1085	91	CCCAAAACGTCAGGTCGAGG	TTTGCCACAGAGACGGGTTG
7836 - 7910	75	AAATCTGCGGTGCAAACCAC	GGCGGTTATTTTGTCAGCGG
9558 - 9579	22	GAGCCCACCACAGCATCATA	GCAGTCGTGCAGATCCTAGT
11720 - 11903	184	CCCCCGCTACCCAACTTAAT	TGCTTTCTGTTCCCTGGTCT

Genome organization. The complete mitochondrial genome sequence of Corydoras nattereri contains the typical vertebrate features: 22 tRNA genes, 2 rRNA genes, 13 protein-coding genes and two noncoding control regions (D-loop, OrigL) (Table 3, Fig. 2). The majority of genes are encoded on the heavy strand, whereas ND6 and eight tRNAs are found on the light strand. All protein-coding genes used ATG start codons, except for COI that used GTG. Seven protein-coding genes are terminated with the complete stop codon, of which five ended with TAA (ATP8, ATP6, ND4L, ND5 and ND6), one with TAG (ND1) and one with AGG (COI). The remaining protein-coding genes are ended by incomplete stop codons, T (COII, COIII, ND2, ND3, ND4 and Cytb), which are completed by post-transcriptional polyadenylation. The 12S and the 16S rRNA genes are separated by tRNA-Val gene and their lengths are 945 and 1,667 bp, respectively. The 22 tRNA genes had sizes ranging from 67 to 75 nucleotides and the control region, located between tRNAPro and tRNAPhe genes, is 939 bp long. A 21-nucleotide insertion sequence between the ATPase subunit-6 and COIII genes was found in C. nattereri . The nucleotide composition for the heavy strand was 32.3% A, 25.7%T, 15.1% G, and 27.0% C.

Table 3
Positioning of genes in the mitochondrial genome of Corydoras nattereri . Negative gap values indicate overlap.

Gene	Start	End	Length	Gap	Direction	Start Codon	Stop Codon
tRNA-Phe	1	68	68	0
12S rRNA	69	1013	945	0
tRNA-Val	1014	1085	72	0
16S rRNA	1086	2752	1667	0
tRNA-Leu	2753	2827	75	0
ND1	2828	3799	972	8		ATG	TAG
tRNA-Ile	3808	3879	72	-2
tRNA-Gln	3878	3948	71	-1	complement
tRNA-Met	3948	4017	70	0
ND2	4018	5062	1045	0		ATG	T--
tRNA-Trp	5063	5133	71	1
tRNA-Ala	5135	5203	69	1	complement
tRNA-Asn	5205	5277	73	0	complement
origin-L	5278	5312	35	-3	complement
tRNA-Cys	5310	5377	68	-1	complement
tRNA-Tyr	5377	5446	70	1	complement
COI	5448	7007	1560	-13		GTG	AGG
tRNA-Ser	6995	7065	71	4	complement
tRNA-Asp	7070	7138	69	6
COII	7145	7835	691	0		ATG	T--
tRNA-Lys	7836	7909	74	1
ATPase 8	7911	8078	168	-10		ATG	TAA
ATPase 6	8069	8752	684	21		ATG	TAA
COIII	8774	9557	784	0		ATG	T--
tRNA-Gly	9558	9629	72	0
ND3	9630	9978	349	0		ATG	T--
tRNA-Arg	9979	10048	70	0
ND4L	10049	10345	297	-7		ATG	TAA
ND4	10339	11719	1381	0		ATG	T--
tRNA-His	11720	11789	70	0
tRNA-Ser	11790	11856	67	1
tRNA-Leu	11858	11930	73	0
ND5	11931	13757	1827	-4		ATG	TAA
ND6	13754	14269	516	0	complement	ATG	TAA
tRNA-Glu	14270	14337	68	3	complement
Cyt b	14341	15478	1138	0		ATG	T--
tRNA-Thr	15479	15550	72	-2
tRNA-Pro	15549	15618	70	0	complement
D-loop	15619	16557	939

Phylogenetic context. The phylogeographic analysis of publically available COI together with additional COI sequences generated by our research group confirmed our identification of the samples of the rio Suruí as Corydoras nattereri (Fig. 3). Our three samples form a monophyletic group with specimens of C. nattereri from the Paraíba do Sul and the Paraitinguinha rivers (upper Tietê drainage, upper Paraná basin) (Pereira et al., 2011, 2013). Contrasting with the high similarity of the samples from these three basins, our samples from the rio Aldeia Velha (rio São João coastal basin), and rio Itaúnas are considerably different. The latter are morphologically similar to C. nattereri , but their sequences are 2.5%-3.6% divergent in relation to the rio Surui samples. Such high divergence suggests that the populations of Corydoras from the São João and Itaúnas river basins represent cryptic species.

Fig. 3
Maximum likelihood tree (log likelihood = -2410.0522) of Corydoras samples with at least 90% similarity to the mitochondrial cytochrome oxidase I sequences of C. nattereri from the rio Suruí. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. Bootstrap robustness is indicated next to selected branches. Samples of C. nattereri have the locality name appended to the sample ID (those for which mitogenomes were produced are from de rio "Surui"), outgroups have the genus name and other samples of Corydoras have the species epithet name appended to the ID code (Table 1).

Our phylogenetic analysis also demonstrates that the C. nattereri clade is nested within a large clade of samples identified in the literature (Pereira et al., 2011, 2013; Rosso et al., 2012) as C. paleatus and C. ehrhardti . Samples of C. ehrhardti (including new sequences produced here) form a monophyletic clade also included among this larger clade, but samples of Corydoras paleatus form a complex of non-monophyletic populations. Within this large complex, samples of C. paleatus GU701809, GU701810, GU701812, GU701813, and GU701871, from the upper rio Paraná basin, form the monophyletic subunit most closely related to C. nattereri , but the bootstrap value for this sister group relationship is low, indicating that further study of C. paleatus species complex is still necessary.

Discussion

Despite the great diversity of Corydoras, this is the first mitogenome with voucher specimens sampled in their native habitat and deposited in a permanent collection. A mitogenome of C. rabauti has been reported by Saitoh et al. (2003), but that study was based on a specimen without locality data obtained from the aquarium trade, and the study does not mention a registration number of a voucher specimen in any biological collection.

Our analysis of COI sequences revealed high levels of genetic divergence and taxonomic complexity among samples closely related to C. nattereri . Specimens from the São João and Itaúnas river basins may represent cryptic species, that are currently undistinguishable from topotype specimens of C. nattereri . Their level of divergency (2.5% - 3.6%) far exceeds the maximum intraspecific divergence (1.6%) reported among six species of Corydoras from the upper Paraná basin (Pereira et al., 2013). The analysis also demonstrated the complexity of relationships among populations of C. nattereri , C. paleatus , and C. ehrhardti . Within this context, our newly produced mitogenome C. nattereri is likely to provide a solid base to identify additional mitochondrial markers to be used in future studies designed to clarify the relationships among these and other callichthyid taxa.

Comparison of the mitogenome of Corydoras nattereri with that of C. rabauti (Saitoh et al., 2003) reveals features that are likely to be phylogenetically informative and useful in future studies. A 21-nucleotide insertion sequence between the ATPase subunit-6 and COIII genes was found in C. nattereri . This insertion corresponds to a 17-nucleotide insertion previously detected in C. rabauti (Saitoh et al. , 2003). Most vertebrate mitochondrial genomes have a head-to-tail junction between the ATPase subunit-6 and COIII genes, and this insertion was considered phylogenetically uninformative in the study of Saitoh et al . (2003). Our discovery of an insertion in the homologous position of C. nattereri is interpreted as an apomorphic trait shared by the two species. Further investigation about the distribution and length of this insertion among Corydoradinae is likely to yield significant insights about the phylogeny of the group.

Acknowledgements

Authors acknowledge the use of the computer cluster Titan from the Woods Hole Oceanographic Institution (WHOI), where TP holds a guest investigator position. Carla Christie Dijban Quijada, Emanuel Neuhaus, Decio Ferreira de Moraes Junior (UFRJ/MN), and José R. Gomes participated in the field work that yielded the specimens from the rio Surui. William Bryan Jennings (UFRJ/MN) and Gustavo Ferraro (FAPERJ fellowship) provided essential support for laboratory activities at the Laboratório de Pesquisa em Biodiversidade Molecular (UFRJ/MN). This work was supported by Partnerships for Enhanced Engagement in Research (PEER) grant from U.S. Agency for International Development (PGA-2000003446) to TP, and grants from CNPq (307610/2013-6, 564940/2010-0, 476822/2012-2) and FAPERJ (E-26/111.404/2012, E-26/200.697/2014) to PAB.

References

• Alexandrou, M. A., C. Oliveira, M. Maillard, R. A. R. McGill, J. Newton, S. Creer & M. I. Taylor. 2011. Competition and phylogeny determine community structure in Müllerian co-mimics. Nature, 469: 84-88.
• Bernt, M., A. Donath, F. Jühling, F. Externbrink, C. Florentz, G. Fritzsch, J. Pütz, M. Middendorf & P. F. Stadler. 2013. MITOS: improved de novo metazoan mitochondrial genome annotation. Molecular Phylogenetics and Evolution, 69: 313-319.
• Bolger, A. M., M. Lohse & B. Usadel. 2014. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics, 30: 2114-2120.
• Britto, M. R. 2003. Phylogeny of the subfamily Corydoradinae Hoedeman, 1952 (Siluriformes: Callichthyidae), with a definition of its genera. Proceedings of the Academy of Natural Sciences of Philadelphia, 153: 119-154.
• Britto, M. R. 2007. Família Callichthyidae. Pp.75-81. In: Buckup, P. A., N. A. Menezes & M. S. Ghazzi (Eds.). Catálogo das espécies de peixes de água doce do Brasil. Rio de Janeiro, Museu Nacional. (Série Livros, 23).
• Darriba, D., G. L. Taboada, R. Doallo & D. Posada. 2012. jModelTest 2: more models, new heuristics and parallel computing. Nature Methods, 9: 772.
• Eschmeyer, W. N. & J. D. Fong. 2015. Catalog of fishes: genera, species, references. Electronic Version. San Francisco, CA, California Academy of Sciences. Available from: Available from: http://researcharchive.calacademy.org/research/ichthyology/catalog/fishcatmain.asp (6 August 2015).
  » http://researcharchive.calacademy.org/research/ichthyology/catalog/fishcatmain.asp
• Fuller, I. A. M. & H.-G. Evers. 2005. Identifying Corydoradinae catfish. Aspidoras - Brochis - Corydoras - Scleromystax & C-numbers. 1st ed. Worcestershire, Ian Fuller Enterprises; Rodgau, A.C.S. GmbH (Aqualog), 384p.
• Gouy, M., S. Guindon & O. Gascuel. 2010. SeaView Version 4: a multiplatform graphical user interface for sequence alignment and phylogenetic tree building. Molecular Biology and Evolution, 27: 221-224.
• Haas, B. J., A. Papanicolaou, M. Yassour, M. Grabherr, P. D. Blood, J. Bowden, M. B. Couger, D. Eccles, B. Li, M. Lieber, M. D. MacManes, M. Ott, J. Orvis, N. Pochet, F. Strozzi, N. Weeks, R. Westerman, T. William, C. N. Dewey, R. Henschel, R. D. LeDuc, N. Friedman & A. Regev. 2013. De novo transcript sequence reconstruction from RNA-seq using the Trinity platform for reference generation and analysis. Nature Protocols, 8: 1494-1512.
• Hasegawa, M., H. Kishino & T. Yano. 1985. Dating of the human-ape splitting by a molecular clock of mitochondrial DNA. Journal of Molecular Evolution, 22: 160-174.
• Iwasaki, W., T. Fukunaga, R. Isagozawa, K. Yamada, Y. Maeda, T. P. Satoh, T. Sado, K. Mabuchi, H. Takeshima, M. Miya & M. Nishida. 2013. Mitofish and mitoannotator: a mitochondrial genome database of fish with an accurate and automatic annotation pipeline. Molecular Biology and Evolution, 30: 2531-2540.
• Kearse, M., R. Moir, A. Wilson, S. Stones-Havas, M. Cheung, S. Sturrock, S. Buxton, A. Cooper, S. Markowitz, C. Duran, T. Thierer, B. Ashton, P. Meintjes & A. Drummond. 2012. Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics, 28: 1647-1649.
• Langmead, B., C. Trapnell, M. Pop & S. L. Salzberg. 2009. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biology, 10: R25.
• Mariguela, T. C., M. A. Alexandrou, F. Foresti & C. Oliveira. 2013. Historical biogeography and cryptic diversity in the Callichthyinae (Siluriformes, Callichthyidae). Journal of Zoological Systematics and Evolutionary Research, 51: 308-315.
• Milne, I., M. Bayer, L. Cardle, P. Shaw, G. Stephen, F. Wright & D. Marshall. 2010. Tablet-next generation sequence assembly visualization. Bioinformatics, 26: 401-402.
• Moreira, D. A., C. Furtado & T. E. Parente. 2015a. The use of transcriptomic next-generation sequencing data to assemble mitochondrial genomes of Ancistrus spp. (Loricariidae). Gene, 573: 171-175.
• Moreira, D. A., M. G. P. Magalhães, P. C. C. Andrade, C. Furtado, A. L. Val & T. E. Parente. 2015b. An RNA-based approach to sequence the mitogenome of Hypoptopoma incognitum (Siluriformes: Loricariidae). Mitochondrial DNA: 1-3.
• Nijssen, H. & I. J. H. Isbrücker. 1980. On the identity of Corydoras nattereri Steindachner, 1877 with the description of a new species, Corydoras prionotos (Pisces, Siluriformes, Callichthyidae). Beaufortia, 30: 1-9.
• Oliveira, C., L. F. Almeida Toledo & S. A. Toledo Filho. 1990. Comparative cytogenetic analysis in three cytotypes of Corydoras nattereri (Pisces, Siluriformes, Callichthyidae). Cytologia, 55: 21-26.
• Pereira, L. H. G., G. M. G. Maia, R. Hanner, F. Foresti & C. Oliveira. 2011. DNA barcodes discriminate freshwater fishes from the Paraíba do Sul River Basin, São Paulo, Brazil. Mitochondrial DNA, 22(S1): 71-79.
• Pereira, L. H. G., R. Hanner, F. Foresti & C. Oliveira. 2013. Can DNA barcoding accurately discriminate megadiverse Neotropical freshwater fish fauna? BMC Genetics, 14: 20 (1-14).
• Reis, R. E. 1997. Revision of the Neotropical catfish genus Hoplosternum (Ostariophysi: Siluriformes: Callichthyidae), with the description of two new genera and three new species. Ichthyological Exploration of Freshwaters, 7: 299-326.
• Reis, R. E. 1998. Anatomy and phylogenetic analysis of the Neotropical callichthyid catfishes (Ostariophysi, Siluriformes). Zoological Journal of the Linnean Society, 124: 105-168.
• Reis, R. E.. 2003. Family Callichthyidae (Armored catfishes). Pp. 291-309. In: Reis, R. E., S. O. Kullander & C. J. Ferraris Jr. (Orgs.). Check list of the freshwater fishes of South and Central America. Porto Alegre, Edipucrs.
• Robinson, J. T., H. Thorvaldsdóttir, W. Winckler, M. Guttman, E. S. Lander, G. Getz & J. P. Mesirov. 2011. Integrative genomics viewer. Nature Biotechnology, 29: 24-26.
• Rosso, J. J., E. Mabragaña, M. González Castro & J. M. Díaz de Astarloa. 2012. DNA barcoding Neotropical fishes: recent advances from the Pampa Plain, Argentina. Molecular Ecology Resources, 12: 999-1011.
• Saitoh, K., M. Miya, J. G. Inoue, N. B. Ishiguro & M. Nishida. 2003. Mitochondrial genomics of ostariophysan fishes: perspectives on phylogeny and biogeography. Journal of Molecular Evolution, 56: 464-472.
• Shimabukuro-Dias, C. K., C. Oliveira & F. Foresti. 2004a. Karyotype variability in eleven species of the catfish genus Corydoras (Siluriformes: Callichthyidae). Ichthyological Exploration of Freshwaters, 15: 135-146.
• Shimabukuro-Dias, C. K., C. Oliveira, R. E. Reis & F. Foresti. 2004b. Molecular phylogeny of the armored catfish family Callichthyidae (Ostariophysi, Siluriformes). Molecular Phylogenetics and Evolution, 32: 152-163.
• Tamura, K., G. Stecher, D. Peterson, A. Filipski & S. Kumar. 2013. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Molecular Biology and Evolution, 30: 2725-2729.
• Thorvaldsdóttir, H., J. T. Robinson & J. P. Mesirov. 2012. Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration. Briefings in Bioinformatics, 14: 178-192.
• Wong, J. F. H., D. P. Ma, R. K. Wilson & B. A. Roe. 1983. DNA sequence of the Xenopus laevis mitochondrial heavy and light strand replication origins and flanking tRNA genes. Nucleic Acids Research, 11: 4977-4995.

Data availability

Data citations

Eschmeyer, W. N. & J. D. Fong. 2015. Catalog of fishes: genera, species, references. Electronic Version. San Francisco, CA, California Academy of Sciences. Available from: Available from: http://researcharchive.calacademy.org/research/ichthyology/catalog/fishcatmain.asp (6 August 2015).

Publication Dates

• Publication in this collection
  2016

History

• Received
  20 Oct 2015
• Accepted
  12 Jan 2016