HELICOBACTER PYLORI OIPA VIRULENCE GENE AS A MOLECULAR MARKER OF SEVERE GASTROPATHIES

Gene de virulência oipA de Helicobacter pylori como marcador molecular de gastropatias severas

ABSTRACT

Background:

Helicobacter pylori is an etiologic agent of gastroduodenal diseases. The microorganism, considered a type I carcinogen, affects about 50% of the global population. H. pylori virulence factors are determinant for the clinical outcome of the infection. The outer inflammatory protein A (oipA) gene encodes an outer membrane adhesin and is related to severe gastropathies, such as gastric cancer.

Objective:

The aim of this study was to evaluate the association of the oipA gene with the severity of gastroduodenal diseases in dyspeptic patients in region Central Brazil.

Methods:

The polymerase chain reaction (PCR) was used to determine the presence of H. pylori. Samples positives were used for molecular screening of the oipA gene. Gastropathies were categorized as non-severe and severe diseases.

Results:

Approximately 68% of patients had H. pylori and 36% were infected with H. pylori oipA+ strains. Infection was significantly associated in patients aged over 44 years (P=0.004). However, there was no association between oipA and patients’ age (P=0.89). Approximately 46% of patients infected with oipA+ strains had some severe illness. Gastric adenocarcinoma was the most frequent severe gastropathy. The H. pylori oipA genotype was inversely associated with the severity of gastroduodenal diseases (OR=0.247, 95%CI: 0.0804-0.7149 and P=0.007).

Conclusion:

The characterization of possible molecular markers will contribute to personalized medicine, impacting the prognosis of patients.

Keywords:
Bacterial gene; bacterial adhesion; bacterial outer membrane proteins

RESUMO

Contexto:

Helicobacter pylori é um agente etiológico de doenças gastroduodenais. O microrganismo, considerado cancerígeno tipo I, afeta cerca de 50% da população mundial. Os fatores de virulência do H. pylori são determinantes para o desfecho clínico da infecção. O gene da proteína inflamatória externa A (oipA) codifica uma adesina da membrana externa e está relacionado a gastropatias severas, como o câncer gástrico.

Objetivo:

O objetivo deste estudo foi avaliar a associação do gene oipA com a gravidade das doenças gastroduodenais em pacientes dispépticos na região Brasil Central.

Métodos:

A reação em cadeia da polimerase (PCR) foi utilizada para determinar a presença de H. pylori. Amostras positivas foram utilizadas para triagem molecular do gene oipA. As gastropatias foram categorizadas como doenças não severas e severas.

Resultados:

Aproximadamente 68% dos pacientes apresentaram H. pylori e 36% estavam infectados com cepas H. pylori oipA+. A infecção foi significativamente associada em pacientes com idade superior a 44 anos (P=0,004). No entanto, não houve associação entre oipA e a idade dos pacientes (P=0,89). Aproximadamente 46% dos pacientes infectados com cepas oipA+ tiveram alguma doença severa. O adenocarcinoma gástrico foi a gastropatia severa mais frequente. O genótipo oipA de H. pylori foi inversamente associado à gravidade das doenças gastroduodenais (OR=0,247, IC95%: 0,0804-0,7149 P=0,007).

Conclusão:

A caracterização de possíveis marcadores moleculares contribuirá para a medicina personalizada, impactando no prognóstico dos pacientes.

Palavras-chave:
Gene bacteriano; adesão bacteriana; proteínas da membrana externa bacteriana

HIGHLIGHTS

• Evidence points to an association between the H. pylori oipA gene and gastropathies.

• There is a high prevalence of H. pylori infection with a relevant percentage of oipA+ strains.

• More severe gastropathies were observed in those infected with H. pylori oipA+ strains.

INTRODUCTION

Helicobacter pylori is a gram-negative, spiral, flagellate and microaerophilic bacterium. This microorganism is cosmopolitan and it is estimated that about 50% of the world population is infected^1,2. The prevalence of H. pylori is associated with socioeconomic factors and hygiene conditions. In this context, higher infection rates are observed in developing countries³. In Brazil, the prevalence of infection varies from 31.7% to 91%, depending on the socioeconomic conditions of the different regions^4,5.

Infection with H. pylori can lead to the development of non-severe gastric diseases, such as duodenitis, esophagitis, gastritis, and ulcers, or severe, such as gastric atrophy, intestinal metaplasia, and adenocarcinoma. Because of its role in the pathogenesis of gastric cancer, the International Agency for Research on Cancer (IARC) of the World Health Organization (WHO) classifies this microorganism as a type I carcinogen^6-11.

The clinical outcome of the infection depends on the imbalance of the parasite-host relationship. H. pylori presents high genetic heterogeneity, and the different virulence factors are determinants for the development of severe diseases during the period of infection of the microorganism. Several virulence genes, such as oipA, may be associated with the severity of gastropathies^12,13.

The oipA gene encodes the outer inflammatory protein A (oipA), an outer membrane protein that plays the role of adhesin. OipA acts on the phosphorylation of some signaling pathways that can induce inflammation along with pathways mediated by the cag pathogenic island (cag-PAI). The expression of oipA can stimulate several pro-inflammatory agents, mainly IL-8^14-16. The induction of a more severe inflammatory response, through the activation of gene transcription, increases the risk for the development of peptic ulcer and gastric cancer¹⁷.

Due to the high prevalence of infection and the well-established role in the etiology of severe gastroduodenal diseases, the characterization of possible molecular markers is extremely relevant for personalized medicine, impacting the diagnosis, prognosis and treatment of patients. In this sense, the aim of this study was to evaluate the association of the virulence gene oipA of H. pylori with the severity of gastroduodenal diseases in dyspeptic patients in central Brazil.

METHODS

Ethical considerations

This study was approved by the Research Ethics Committee of the Hospital das Clínicas of the Federal University of Goiás (HC/UFG), under protocol number 2.519.032 (CAAE: 83422017.7.0000.5078) and by the Research Ethics Committee of the Association de Goiás Combating Cancer in Goiás (ACCG), in Goiânia - Goiás, opinion no. 2.885.763 (CAAE: 95637418.3.3001.0031). All participants who agreed to participate in the study signed a Free and Informed Consent Form (FICT).

Population and samples

A total of 156 dyspeptic patients, aged between 18 and 75 years, confirmed by upper digestive endoscopy, were recruited for this study. Exclusion criteria were patients who used proton pump inhibitors, histamine-2 receptor blockers, or immunosuppressants/antibiotics. In addition, patients with active gastrointestinal bleeding, pregnant, lactating, or those who could not undergo endoscopy were excluded. One patient did not present the signed FICT and was excluded from this research. A total of 155 patients (117 from HC/UFG and 38 from ACCG) were included in this study, 47 (30.3%) male and 108 (69.7%) female. Regarding age, patients were categorized into two groups: aged 44 years or less and aged over 44 years, of which 109 (70.3%) were aged over 44 years.

Samples were collected by a gastroenterologist in accordance with the recommendations of the IV Brazilian Consensus on H. pylori infection. During endoscopy, two fragments were obtained from the antrum and two from the gastric body¹⁷. Tumor samples collected from patients with gastric cancer were obtained at the time of gastrectomy¹⁸. Two samples (one from the antrum and the other from the gastric body) were sent to the Clinical Pathology laboratory at HC/UFG for histopathological analysis. The other two samples were transported under refrigeration and stored at -20˚C at the Núcleo de Estudos da Helicobacter pylori (NEHP), located at the Federal University of Goiás. These samples were subjected to molecular analysis, in accordance with previous studies published by NEHP^19,20.

Histology

Samples obtained from gastric mucosal biopsies were fixed in 10% buffered formalin and stained with hematoxylin-eosin and Giemsa. The Sydney System was used to classify the histopathological parameters²¹.

DNA extraction from biopsies

For DNA extraction, the protocol provided by the manufacturer Kit QIAamp DNA Mini Kit^® (Qiagen, Valencia, CA, United States of America or USA) was used. The quantification and purity analysis of the genomic DNA was performed using optical density in a spectrophotometer (NanoDrop^® ND-1000 UV-Vis).

Amplification of H. pylori DNA and the oipA virulence gene

The extracted DNA was used for the molecular screening of H. pylori infection by amplifying a fragment of the constitutive ribosomal 16S rRNA gene (hpx) using the polymerase chain reaction (PCR). The hpx-positive samples were then subjected to oipA gene detection.

Gene amplification (16S rRNA and oipA) was performed using the Amplitherm^® thermocycler. Each reaction consisted of 0.5 µL of Taq-DNA polymerase (2.5 units), 5 µL of 10X CoralLoad PCR buffer (QIAamp, Qiagen) containing MgCl₂ (1.5 mM), 2 µL of dNTP (2.5 mM) and 33.5 µl milliQ water. After mixing, 5 µL of DNA from each sample (50 ng) were added, totaling a final volume of 50 µL. For each assay a negative and a positive control were used, with an H. pylori DNA aliquot kindly given by author Dr. Lucas Trevizani Rasmussen.

The specific oligonucleotides for each gene, the amplification conditions and the size of the fragments obtained are described in Table 1. PCRs will be performed using primers previously described in the literature^22,23.

TABLE 1
Sequence of primers used for the identification of H. pylori and oipA, amplification conditions and fragment size.

Gene	Oligonucleotides	Sequence (5’ → 3’)	Amplification conditions	bp
16S	hpx1	CTGGAGARACTAAGYCCCTC	94°C, 1 min; 59°C, 1 min;	150
rRNA	hpx2	GAGGAATACTCATTGCAAGGCGA	72˚C, 1 min (40 cycles)
oipA	HPO638F	GTTTTTGATGCATGGGATTT	94°C, 1 min; 56°C, 1 min;	401
	HPO638R	GTGCATCTCTTATGGCTTT	72°C, 1 min (35 cycles)

• R: GA (purine) and Y: TC (pyrimidine).

PCR products were stained with BlueGreen nucleic acid (Lab Biotechnology^®) and subjected to 2% agarose gel electrophoresis. Visualization was performed under ultraviolet (UV) light using a transilluminator.

Diagnosis of gastroduodenal diseases and severity criteria

Endoscopic and histopathological reports were used to segregate patients with gastroduodenal lesions according to severity. Lesions were categorized as non-severe (duodenitis, esophagitis, gastritis, and ulcers) and severe (gastric adenocarcinoma, gastric atrophy, and intestinal metaplasia)²⁴.

Data analysis

Data were analyzed using SPSS software (Statistical Package for the Social Sciences) version 17.0. The P-value was calculated using the chi-square and Fisher’s exact tests, considering P values lower than 0.05 for statistical significance.

RESULTS

DNA extracted from gastric biopsies from 155 patients was used for molecular screening of H. pylori, through amplification of the 16S rRNA gene. A total of 67.7% of patients were positive for H. pylori infection. Positive samples were subjected to amplification of the 401 bp fragment of the oipA virulence gene. Of the total H. pylori positive samples, the oipA+ gene was detected in 36% (25/105), and 64% (80/105) of the samples were oipA-.

H. pylori infection was more prevalent in patients over 44 years of age (42.58%). The analysis of age groups of patients showed a significant association between infection and age (P=0.004). However, no association was found between the oipA genotype and the age of the patients (P=0.89). In this study, the presence of the infection was predominant in females (69.7%), but there was no significant association between the prevalence of the oipA genotype and the sex of the patients (P=0.95).

According to endoscopic and histopathological reports, patients infected with H. pylori had 88 clinical outcomes, 53 of which were non-severe and 35 were severe. The most prevalent non-severe gastroduodenal lesion was gastritis (32.33%), followed by esophagitis (5.26%) and duodenitis (1.5%). The most prevalent severe lesions were AdG (20.3%), gastric atrophy (3.76%) and metaplasia (2.25%). Regarding the presence of oipA, the most prevalent non-severe disease was gastritis (6.77%), and the most frequent severe disease was AdG (10.53%), as described in Table 2.

TABLE 2
Relationship between the presence of oipA and the severity of gastroduodenal diseases.

Type	Diseases	oipA +	oipA -
Severe	AdG	14 (10.53%)	13 (9.77%)
	Gastric atrophy	1 (0.75%)	4 (3.01%)
	Metaplasia	1 (0.75%)	2 (1.50%)
Not Severe	Esophagitis	0 (0%)	7 (5.26%)
	Duodenitis	0 (0%)	2 (1.50%)
	Gastritis	9 (6.77%)	34 (25.56%)
	Ulcer	0 (0%)	1 (0.75%)
Total	-	25 (28.40%)	63 (71.60%)

Descriptive analyzes showed that patients infected with H. pylori with oipA+ strains had 1.77 times more severe disease than those with non-severe disease. While, patients infected with H. pylori oipA- the presence of non-severe diseases was 2.31 times lower than those with severe diseases. However, the logistic regression model showed a significant inverse association between disease severity in patients infected with H. pylori oipA+, as the estimated odds ratio was less than 1 (OR: 0.247, CI: 0.080-0.714, P=0.007) (Table 3).

TABLE 3
Association between the presence of oipA and the severity of gastroduodenal diseases.

Diseases	oipA +	oipA -	OR	95%CI	P-value
Severe	16	19	0.247	0.0804 - 0.7149	0.007
Not Severe	9	44

• OR: Odds ratio. CI: Confidence interval.

DISCUSSION

Higher rates of H. pylori infection are reported in developing countries. In our study, the prevalence of infection was 67.7%. These data corroborate with studies conducted in Iran and Peru, where the rates were 76% and 62.9%²⁵. On the other hand, a lower prevalence was found in Southeastern Brazil, with a proportion of 31%⁴. These differences can be attributed to socioeconomic conditions or to the different diagnostic methods used in the study.

Females were more affected by H. pylori infection, despite this, the presence of the oipA gene was not associated with the sex of the patients. In a study carried out in Iran with 86 patients, no significant difference was observed in the prevalence of the oipA genotype between men and women²⁶. The different prevalence of H. pylori infection between the sexes can be explained by factors related to lifestyle, such as smoking and alcohol consumption. These factors favor the infection and progression of gastric diseases and are more frequently associated with males^27,28. Furthermore, the characteristic heterogeneity of the H. pylori genome may explain the differences in the detection of the oipA gene in both sexes.

In this study, infection by the microorganism was more prevalent in patients over 44 years of age (70,3%). The age range of patients in adulthood was associated with H. pylori infection. A study carried out in Canada with 934 patients also showed a predominance of infection in adult patients²⁹. On the other hand, Tran et al. found no association between age and H. pylori infection in the Vietnamese population³⁰. In adults, there is a longer time of exposure of the microorganism throughout life. Furthermore, the levels of inflammation and ulceration are significantly higher in this age group when compared to children³¹. These factors may justify a higher prevalence of infection in adulthood.

In our findings, the oipA+ genotype of H. pylori was not associated with the age of the patients. This data corroborates the study carried out in Bulgaria, where the oipA gene was not associated with age³². Other virulence genes that are more characterized in H. pylori, such as the cagA gene, were not associated with any age group of patients. In contrast, the vacA s1/s2 gene was significantly associated with the age group of 31 to 40 years in a study on the Chinese population³³. Age is a determining risk factor for the development of gastropathies, as patients are exposed to a longer period of tissue damage resulting from the virulence of molecular markers of the microorganism.

The H. pylori oipA gene was detected in 36% of dyspeptic patients. Relatively low rate compared to other countries such as Iran, Tunisia, Costa Rica and China, where the oipA gene was detected in 55%, 90.8%, 97% and 100% of samples, respectively^22,34-37. The host’s immune response and lifestyle, as well as the genetic polymorphism of H. pylori strains, may explain the different prevalences of oipA in these regions.

H. pylori oipA+ strains are associated with different severe and non-severe gastroduodenal diseases¹⁷. In our research, the most prevalent non-severe gastroduodenal lesion in patients infected with H. pylori oipA+ strains was gastritis. On the other hand, the most diagnosed severe lesion in patients with H. pylori oipA+ strains was gastric adenocarcinoma. A study carried out in the capital of Iran showed that the oipA genotype was more common in patients with gastritis than in patients with gastric cancer³⁸. In Colombia and the USA the oipA gene was significantly associated with duodenal ulcer, gastric cancer, high H. pylori density and severe neutrophil infiltration. The combination of these factors can lead to increased mucosal inflammation, which represents an important risk factor for the severity of gastropathies^39-41.

In the present study, the descriptive analysis revealed that the presence of severe diseases in individuals infected with H. pylori oipA+ strains was approximately twice as high as individuals with non-severe diseases, that is, patients positive for oipA tend to develop more severe diseases when compared to to H. pylori oipA- patients. However, the oipA+ gene was inversely associated with the severity of gastroduodenal lesions. In a study conducted in Japan, the oipA gene was also associated with an increased risk of gastric cancer⁴². The functional status of the oipA gene of H. pylori allows better adhesion of the bacteria to the gastric epithelium, stimulating greater production of IL-8 and, consequently, tissue damage that favors the development of gastric cancer, especially when oipA is associated with other genes, such as vacA and cagA^17,43. However, a study in Iran found a strong association of the H. pylori oipA genotype for ulcer risk and a significant reverse association with gastric cancer⁴⁴.

Clinical outcomes resulting from infection are due to the association of numerous virulence genes. A limitation of this study was the isolated analysis of the oipA gene, in addition to the lack of data on the functional status of this virulence gene. Other studies should be performed to determine the mechanisms associated with the development of gastropathies in patients infected with H. pylori oipA+ strains.

CONCLUSION

The H. pylori oipA genotype is an important pathogenicity marker and has been associated with the severity of gastroduodenal diseases. In this study, the prevalence of infection was 67.7%, and the oipA gene was detected in 36% of the patients. Patient’s age and sex were not associated with H. pylori oipA+ strains. New studies will make it possible to evaluate this genotype associated with other virulence factors of H. pylori and the severity of gastric diseases. The molecular characterization of circulating strains in the region will contribute to personalized medicine, impacting the diagnosis, prognosis, and treatment of patients.

REFERENCES

• ¹
  Mezmale L, Coelho LG, Bordin D, Leja M. Review: Epidemiology of Helicobacter pylori Helicobacter 2020;1;25:e12734. https://doi.org/10.1111/hel.12734.
  » https://doi.org/10.1111/hel.12734
• ²
  Quaglia NC, Dambrosio A. Helicobacter pylori: A foodborne pathogen? World J Gastroenterol. 2018;24:3472-87. https://dx.doi.org/10.3748/wjg.v24.i31.3472.
  » https://doi.org/10.3748/wjg.v24.i31.3472
• ³
  Zamani M, Ebrahimtabar F, Zamani V, Miller WH, Alizadeh-Navaei R, Shokri-Shirvani J, et al. Systematic review with meta-analysis: the worldwide prevalence of Helicobacter pylori infection. Aliment Pharmacol Ther. 2018;47:868-76. https://doi.org/10.1111/apt.14561.
  » https://doi.org/10.1111/apt.14561
• ⁴
  Rodrigues MF, Guerra MR, Alvarenga AVR de, Souza DZO, Costa RAV e S, Cupolilo SMN. Helicobacter pylori infection and gastric cancer precursor lesions: prevalence and associated factors in a reference laboratory in southeastern Brazil. Arq Gastroenterol. 2019;56:419-24. https://doi.org/10.1590/S0004-2803.201900000-84.
  » https://doi.org/10.1590/S0004-2803.201900000-84
• ⁵
  Vinagre IDF, Queiroz AL, Silva Júnior MR, Vinagre RMDF, Martins LC. Helicobacter pylori infection in patients with different gastrointestinal diseases from northern Brazil. Arq Gastroenterol. 2015;52:266-71. https://doi.org/10.1590/S0004-28032015000400004.
  » https://doi.org/10.1590/S0004-28032015000400004
• ⁶
  Calvet X, Ramírez Lázaro MJ, Lehours P, Mégraud F. Diagnosis and Epidemiology of Helicobacter pylori Infection. Helicobacter. 2013;1:5-11. https://doi.org/10.1111/hel.12071.
  » https://doi.org/10.1111/hel.12071
• ⁷
  Hatakeyama M. Structure and function of Helicobacter pylori cagA, the first-identified bacterial protein involved in human cancer. Proc Jpn Acad Ser B Phys Biol Sci. 2017;93:196-219. https://doi.org/10.2183/pjab.93.013.
  » https://doi.org/10.2183/pjab.93.013
• ⁸
  Hooi JK, Ying Lai W, Khoon Ng W, Suen MM, Underwood FE, Tanyingoh D, et al. Global Prevalence of Helicobacter pylori Infection: Systematic Review and Meta-analysis. Gastroenterology. 2017;153:420-9. https://doi.org/10.1053/j.gastro.2017.04.022.
  » https://doi.org/10.1053/j.gastro.2017.04.022
• ⁹
  IARC. List of Classifications - IARC Monographs on the Identification of Carcinogenic Hazards to Humans. 2021;1-131. [Internet]. https://monographs.iarc.who.int/agents-classified-by-the-iarc/
  » https://monographs.iarc.who.int/agents-classified-by-the-iarc/
• ¹⁰
  Malfertheiner P, Megraud F, Morain C, Bazzoli F, El-Omar E, Graham D, et al. Current concepts in the management of Helicobacter pylori infection: the Maastricht III Consensus Report. Gut. 2007;56:772-81. http://dx.doi.org/10.1136/gut.2006.101634.
  » https://doi.org/10.1136/gut.2006.101634
• ¹¹
  Mantero P, Matus GS, Corti RE, Cabanne AM, Gabriel G, de Palma Z, et al. Helicobacter pylori and corpus gastric pathology are associated with lower serum ghrelin. World J Gastroenterol . 2018;24:397-407. https://dx.doi.org/10.3748/wjg.v24.i3.397.
  » https://doi.org/10.3748/wjg.v24.i3.397
• ¹²
  Baj J, Forma A, Sitarz M, Portincasa P, Garruti G, Krasowska D, et al. Helicobacter pylori Virulence Factors-Mechanisms of Bacterial Pathogenicity in the Gastric Microenvironment. Cells. 2020;10:27. https://doi.org/10.3390/cells10010027.
  » https://doi.org/10.3390/cells10010027
• ¹³
  Machlowska J, Baj J, Sitarz M, Maciejewski R, Sitarz R. Gastric cancer: Epidemiology, risk factors, classification, genomic characteristics and treatment strategies. Int J Mol Sci. 2020;21:4012. https://doi.org/10.3390/ijms21114012.
  » https://doi.org/10.3390/ijms21114012
• ¹⁴
  Ansari S, Yamaoka Y. Helicobacter pylori virulence factors exploiting gastric colonization and its pathogenicity. Toxins (Basel). 2019;11:677. https://doi.org/10.3390/toxins11110677.
  » https://doi.org/10.3390/toxins11110677
• ¹⁵
  Farzi N, Yadegar A, Aghdaei HA, Yamaoka Y, Zali MR. Genetic diversity and functional analysis of oipA gene in association with other virulence factors among Helicobacter pylori isolates from Iranian patients with different gastric diseases. Infect Genet Evol. 2018;60:26-34. https://doi.org/10.1016/j.meegid.2018.02.017.
  » https://doi.org/10.1016/j.meegid.2018.02.017
• ¹⁶
  Horridge DN, Begley AA, Kim J, Aravindan N, Fan K, Forsyth MH. Outer inflammatory protein a (OipA) of Helicobacter pylori is regulated by host cell contact and mediates CagA translocation and interleukin-8 response only in the presence of a functional cag pathogenicity island type IV secretion system. Pathog Dis. 2017;75:ftx113. https://doi.org/10.1093/femspd/ftx113
  » https://doi.org/10.1093/femspd/ftx113
• ¹⁷
  Coelho LGV, Marinho JR, Genta R, Ribeiro LT, Passos MCF, Zaterka S, et al. IV Brazilian Consensus Conference on Helicobacter pylori infection. Arq Gastroenterol. 2018;42:128-32. https://doi.org/10.1590/S0004-28032005000200012.
  » https://doi.org/10.1590/S0004-28032005000200012
• ¹⁸
  Braga LLBC, Batista MHR, de Azevedo OGR, da Silva Costa KC, Gomes AD, Rocha GA, et al. OipA “on” status of Helicobacter pylori is associated with gastric cancer in North-Eastern Brazil. BMC Cancer. 2019;19:48. https://doi.org/10.1186/s12885-018-5249-x.
  » https://doi.org/10.1186/s12885-018-5249-x
• ¹⁹
  Oliveira AKS, Silva LLL, Miguel MP, Blanco AJV, Carneiro LC, Barbosa MS. Helicobacter pylori cagA virulence gene and severe esogastroduodenal diseases: is there an association? Arq Gastroenterol. 2021;58:468-75.
• ²⁰
  Silva LLL, Oliveira AKS, Gama AR, Ramos AFPL, Silva AMTC, Blanco AJV, et al. Helicobacter pylori virulence dupA gene: Risk factor or protective factor? Braz J Microbiol. 2021;1:1-7.
• ²¹
  Stolte M, Meining A. The updated Sydney system: classification and grading of gastritis as the basis of diagnosis and treatment. Can J Gastroenterol. 2001;15:591-8. https://doi.org/10.1155/2001/367832.
  » https://doi.org/10.1155/2001/367832
• ²²
  Mansour KB, Fendri C, Zribi M, Masmoudi A, Labbene M, Fillali A, et al. Prevalence of Helicobacter pylori vacA, cagA, iceA and oipA genotypes in Tunisian patients. Ann Clin Microbiol Antimicrob. 2010;9:10. http://www.ann-clinmicrob.com/content/9/1/10
  » http://www.ann-clinmicrob.com/content/9/1/10
• ²³
  Scholte GHA, Van Doom LJ, Quint WGV, Lindeman J. Polymerase chain reaction for the detection of Helicobacter pylori in formaldehyde-sublimate fixed, paraffin-embedded gastric biopsies. Diagnostic molecular pathology: American J Surg Pat. 1997;6:238-43.
• ²⁴
  Paredes-Osses E, Sáez K, Sanhueza E, Hebel S, González C, Briceño C, et al. Association between cagA, vacAi, and dupA genes of Helicobacter pylori and gastroduodenal pathologies in Chilean patients. Folia Microbiol (Praha). 2017;62:437-44. https://doi.org/10.1007/s12223-017-0514-y.
  » https://doi.org/10.1007/s12223-017-0514-y
• ²⁵
  Castaneda CA, Castillo M, Chavez I, Barreda F, Suarez N, Nieves J, et al. Prevalence of Helicobacter pylori infection, its virulent genotypes, and epstein-barr virus in Peruvian patients with chronic gastritis and gastric cancer. J Glob Oncol. 2019;5:1-9. https://doi.org/10.1200/JGO.19.00122.
  » https://doi.org/10.1200/JGO.19.00122
• ²⁶
  Aghdam SM, Sardari Z, Safaralizadeh R, Bonyadi M, Abdolmohammadi R, Moghadam MS, et al. Investigation of association between oipA and iceA1/iceA2 genotypes of Helicobacter pylori and gastric cancer in Iran. Asian Pac J Cancer Prev. 2014;15:8295-9. https://doi.org/10.7314/APJCP.2014.15.19.8295.
  » https://doi.org/10.7314/APJCP.2014.15.19.8295
• ²⁷
  IBGE. Impulsionado pelas mulheres, consumo de álcool cresce entre brasileiros em 2019. Agência de Notícias IBGE. 2020. [Internet]. Available from: https://agenciadenoticias.ibge.gov.br/agencia-noticias/2012-agencia-de-noticias/noticias/29472-impulsionado-pelas-mulheres-consumo-de-alcool-cresce-entre-brasileiros-em-2019#:~:text=Ou%20melhor%2C%20as%20brasileiras%3A%2017,23%2C9%25%20em%202013
  » https://agenciadenoticias.ibge.gov.br/agencia-noticias/2012-agencia-de-noticias/noticias/29472-impulsionado-pelas-mulheres-consumo-de-alcool-cresce-entre-brasileiros-em-2019#:~:text=Ou%20melhor%2C%20as%20brasileiras%3A%2017,23%2C9%25%20em%202013
• ²⁸
  Venneman K, Huybrechts I, Gunter MJ, Vandendaele L, Herrero R, van Herck K. The epidemiology of Helicobacter pylori infection in Europe and the impact of lifestyle on its natural evolution toward stomach cancer after infection: A systematic review. Helicobacter. 2018;23:e12483. https://doi.org/10.1111/hel.12483.
  » https://doi.org/10.1111/hel.12483
• ²⁹
  Garcia KF, Geary J, Chang HJ, McAlpine L, Walker E, Colquhoun A, et al. Burden of disease from Helicobacter pylori infection in western Canadian Arctic communities. BMC Public Health. 2019;19:730. https://doi.org/10.1186/s12889-019-7065-x.
  » https://doi.org/10.1186/s12889-019-7065-x
• ³⁰
  Tran TT, Nguyen AT, Quach DT, Pham DTH, Cao NM, Nguyen UTH, et al. Emergence of amoxicillin resistance and identification of novel mutations of the pbp1A gene in Helicobacter pylori in Vietnam. BMC Microbiol. 2022;22:41. https://doi.org/10.1186/s12866-022-02463-8.
  » https://doi.org/10.1186/s12866-022-02463-8
• ³¹
  Razavi A, Bagheri N, Azadegan-Dehkordi F, Shirzad M, Rahimian G, Rafieian-Kopaei M et al. Comparative Immune Response in Children and Adults with H. pylori Infection. J Immunol Res. 2015:315957. https://doi.org/10.1155/2015/315957.
  » https://doi.org/10.1155/2015/315957
• ³²
  Markovska R, Boyanova L, Yordanov D, Gergova G, Mitov I. Helicobacter pylori oipA genetic diversity and its associations with both disease and cagA, vacA s, m, and i alleles among Bulgarian patients. Diagn Microbiol Infect Dis. 2011;71:335-40. https://doi.org/10.1016/j.diagmicrobio.2011.08.008.
  » https://doi.org/10.1016/j.diagmicrobio.2011.08.008
• ³³
  Fan L, Li R, Li H, Zhang J, Wang L. Detection of CagA, VacA, IceA1 and IceA2 virulent genes in Helicobacter pylori isolated from gastric ulcer patients. Lab Med. 2018;42:155-62. https://doi.org/10.1515/labmed-2018-0059.
  » https://doi.org/10.1515/labmed-2018-0059
• ³⁴
  Dabiri H, Jafari F, Baghaei K, Shokrzadeh L, Abdi S, Pourhoseingholi MA, et al. Prevalence of Helicobacter pylori vacA, cagA, cagE, oipA, iceA, babA2 and babB genotypes in Iranian dyspeptic patients. Microb Pathog. 2017;105:226-30. https://doi.org/10.1016/j.micpath.2017.02.018.
  » https://doi.org/10.1016/j.micpath.2017.02.018
• ³⁵
  Molina-Castro S, Garita-Cambronero J, Malespín-Bendaña W, Une C, Ramírez V. Virulence factor genotyping of Helicobacter pylori isolated from Costa Rican dyspeptic patients. Microb Pathog . 2019;128:276-80. https://doi.org/10.1016/j.micpath.2019.01.018.
  » https://doi.org/10.1016/j.micpath.2019.01.018
• ³⁶
  Xue Z, Yang H, Su D, Song X, Deng X, Yu C, et al. Geographic distribution of the cagA, vacA, iceA, oipA and dupA genes of Helicobacter pylori strains isolated in China. Gut Pathog. 2021;13:39. https://doi.org/10.1186/s13099-021-00434-4.
  » https://doi.org/10.1186/s13099-021-00434-4
• ³⁷
  Zhao Q, Song C, Wang K, Li D, Yang Y, Liu D, et al. Prevalence of Helicobacter pylori babA, oipA, sabA and homB genes in isolates from Chinese patients with different gastroduodenal diseases. Med Microbiol Immunol. 2020;209:565-77. https://doi.org/10.1007/s00430-020-00666-2.
  » https://doi.org/10.1007/s00430-020-00666-2
• ³⁸
  Asl HM, Badamchi A, Javadinia S, Khaleghi S, Tehraninia L, Saedi S, et al. Prevalence of Helicobacter pylori vacA, cagA, cagE1, cagE2, dupA and oipA genotypes in patients with gastrointestinal diseases. Acta Med Iran. 2020;58:310-7. https://doi.org/10.18502/acta.v58i7.4417.
  » https://doi.org/10.18502/acta.v58i7.4417
• ³⁹
  Yamaoka Y, Ojo O, Fujimoto S, Odenbreit S, Haas R, Gutierrez O, et al. Helicobacter pylori outer membrane proteins and gastroduodenal disease. Gut. 2006;55:775-81. http://dx.doi.org/10.1136/gut.2005.083014.
  » https://doi.org/10.1136/gut.2005.083014
• ⁴⁰
  Akbari S, Rezaeian T, Mohammadzadeh R, Meshkat Z, Namdar AB, Aryan E, et al. Investigation of association between iceA, babA2 and oipA genotypes of Helicobacter pylori and IL-8-251 T>A polymorphism with clinical outcomes in Helicobacter pylori-infected Iranian patients. Gene Reports. 2021;1:24. https://doi.org/10.1016/j.genrep.2021.101210.
  » https://doi.org/10.1016/j.genrep.2021.101210
• ⁴¹
  Coussens LM, Werb Z. Inflammation and cancer. Nature. 2002;420:860. https://doi.org/10.1038/nature01322.
  » https://doi.org/10.1038/nature01322
• ⁴²
  Bartpho TS, Wattanawongdon W, Tongtawee T, Paoin C, Kangwantas K, Dechsukhum C. Precancerous Gastric Lesions with Helicobacter pylori vacA +/ babA 2 +/ oipA + Genotype Increase the Risk of Gastric Cancer. Biomed Res Int. 2020:7243029. https://doi.org/10.1155/2020/7243029.
  » https://doi.org/10.1155/2020/7243029
• ⁴³
  Yamaoka Y, Kwon DH, Graham DY. A M(r) 34,000 proinflammatory outer membrane protein (oipA) of Helicobacter pylori Proc Natl Acad Sci U S A. 2020;97:7533-8. https://doi.org/10.1073/pnas.130079797.
  » https://doi.org/10.1073/pnas.130079797
• ⁴⁴
  Feili O, Bakhti S, Latifi-Navid S, Zahri S, Yazdanbod A. Contrasting association of Helicobacter pylori oipA genotype with risk of peptic ulceration and gastric cancer. Infect Genet Evol . 2021;89:104720. https://doi.org/10.1016/j.meegid.2021.104720.
  » https://doi.org/10.1016/j.meegid.2021.104720

• Disclosure of funding: no funding received
• Declaration of use of artificial intelligence: none

Publication Dates

• Publication in this collection
  04 Mar 2024
• Date of issue
  2024

History

• Received
  24 July 2023
• Accepted
  02 Oct 2023