Effects of scorpion venom heat-resistant peptide on the hippocampal neurons of kainic acid-induced epileptic rats

Abstract

Scorpion venom is a Chinese medicine for epilepsy treatment, but the underlying mechanism is not clear. Scorpion venom heat-resistant peptide (SVHRP), a peptide isolated from the venom of Buthus martensii Karsch, has an anti-epileptic effect by reducing seizure behavior according to a modified Racine scale. The present study aimed to investigate the molecular mechanism of SVHRP on temporal lobe epilepsy. The hippocampus and hippocampal neurons from kainic acid-induced epileptic rats were treated with SVHRP at different doses and duration. Quantitative RT-PCR and immunoblotting were used to detect the expression level of brain-derived neurotrophic factor (BDNF), neuropeptide Y (NPY), cAMP-response element binding protein (CREB), stromal interaction molecule (STIM), and calcium release-activated calcium channel protein 1 (ORAI1). In the hippocampal tissues and primary hippocampal neuron cultures, SVHRP treatment resulted in increased mRNA and protein levels of BDNF and NPY under the epileptic condition. The upregulation of BDNF and NPY expression was positively correlated with the dose level and treatment duration of SVHRP in hippocampal tissues from kainic acid-induced epileptic rats. On the other hand, no significant changes in the levels of CREB, STIM, or ORAI1 were observed. SVHRP may exhibit an anti-epileptic effect by upregulating the expression of BDNF and NPY in the epileptic hippocampus.

Epilepsy; SVHRP; BDNF; NPY

Introduction

Epilepsy is defined as a disorder of the brain characterized by an enduring predisposition to generate epileptic seizures (¹). According to public data from the World Health Organization, epilepsy is one of the most common neurological diseases worldwide; there are around 50 million people living with epilepsy (²). A variety of anti-epileptic drugs have been developed and used in first-line therapies for epilepsy treatment (³); however, up to 30% of epilepsy cases can be medically refractory (⁴).

Scorpion venom is a Chinese ethnomedicine used for the treatment of neuronal diseases, such as apoplexy, cerebral palsy, and epilepsy (⁵). A recent study demonstrated that scorpion venom heat-resistant peptide (SVHRP), a peptide purified from the venom of Buthus martensii Karsch, can reduce seizure susceptibility scored by a modified Racine scale (⁶). Upon SVHRP treatment, the reduced scores were correlated with the downregulation of proenkephalin mRNA level; however, the detailed molecular mechanism is still unclear. In this study, a kainic acid (KA)-induced rat epilepsy model was used to mimic temporal lobe epilepsy, and the effects of SVHRP on the expression of molecules involved in epileptogenesis, including brain-derived neurotrophic factor (BDNF), neuropeptide Y (NPY), cAMP-response element binding protein (CREB), stromal interaction molecule (STIM), and calcium release-activated calcium channel protein 1 (ORAI1), were analyzed.

Material and Methods

Establishment of KA-induced epileptic rats

To establish an epilepsy model in rats, healthy male Sprague-Dawley rats (age: 8-10 weeks; body weight: 200±20 g) purchased from Shanghai SLAC Laboratory Animal Co., Ltd., China (Laboratory animal license number: 42000600018577) were treated with 12 μg/kg of KA (Sigma, USA) by intracerebroventricular injection [lateral ventricle (AP=-0.8 mm, L=+1.5 mm, DV=-3.6 mm)]. In all KA-treated rats, seizures were observed within 1 h. Rats with spontaneous seizures were used for the experiments. The successful induction of epilepsy was confirmed according to the Racine scale (⁷).

KA-induced epileptic rats were intracerebroventricularly treated with 0.2 or 20 μg/kg of SVHRP, a purified peptide from the venom of the scorpion Buthus martensii Karsch obtained from Dalian Medical University, China (National patent number: ZL01106166.9). After 8 h, the hippocampal tissues were collected for further analysis. Normal saline was used as the control.

Primary hippocampal neuron culture from KA-induced epileptic rats

For primary hippocampal neuron culture, the hippocampal tissues from epileptic rats were collected and cut into slices with 400-600 μm of thickness. Neuronal cells in the entire hippocampal tissues were retrieved by 1 g/L of collagenase (Merck Life Science Co., Ltd., China). The cells were cultured in B27/Neurobasal A with 0.5 mM glutamine, no glutamate, 50 U of penicillin, 0.05 mg/mL of streptomycin, and 5 ng/mL of FGF2 (Thermo Fisher Scientific, USA). After a 10-day culture, the hippocampal neurons were incubated with 0.2 or 20 μg/mL of SVHRP for 1, 8, or 24 h. Cells were then collected for further analysis. To investigate the effects of the dose level of SVHRP, normal saline was used as the control. To investigate the effects of the treatment duration of SVHRP, cells without SVHRP treatment were used as the control.

Quantitative RT-PCR

Total RNA was extracted from the hippocampal tissues and cultured cells, and cDNA was synthesized by SuperScript III reverse transcriptase (Thermo Fisher Scientific). Quantitative RT-PCR was carried out by Power SYBR GREEN PCR Master mix (Thermo Fisher Scientific) and Applied Biosystems™ 7500 Real-Time PCR system (Thermo Fisher Scientific). Primer sets used for detecting the mRNA expression level of BDNF, NPY, CREB, STIM, ORAI1, and β-actin are listed in Table 1. Relative folds of expression (target gene/β-actin) were calculated using the 2^−ΔΔCT method (⁸).

Table 1
Primer sequences for quantitative RT-PCR analysis.

Target	Primer sequence (5′→3′)
BDNF
Forward	TCAACATAAACCACCAAC
Reverse	TCGCTTCATCTTAGGAGT
NPY
Forward	GCTTATGACCCGCACTTA
Reverse	TTCAGCCACCCGAGAT
CREB
Forward	GCACTAAGGTTACAGTGGGAGCAGA
Reverse	ACAGTTCAAGCCCAGCCACAG
STIM
Forward	GGCTAAGAGAATGGGAAGAATCC
Reverse	CTGGTGGAGAAACTGCCTGAC
ORAI1
Forward	TGAGGGCGAACAGGTGC
Reverse	GCCAGAGTTACTCCGAGGTGA
β-actin
Forward	GGAGATTACTGCCCTGGCTCCTA
Reverse	GACTCATCGTACTCCTGCTTGCTG

Immunoblotting

Protein lysates from the hippocampal tissues and cultured cells were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis. Proteins were then transferred onto a polyvinylidene difluoride membrane for detection. Antibodies against BDNF, NPY, CREB, p-CREB, STIM, ORAI1, and β-actin were purchased from Abcam (USA).

Statistical analyses

The non-parametric two-tailed Mann-Whitney test was utilized for statistical comparisons in all data sets. Data in the bar graphs are reported as means±SD. Statistical differences and the number of replicates are reported in each figure.

Results

Of the 20 rats treated with KA for seizure induction, 2 died during the induction of seizures. Successful induction of seizures was observed in 18 rats, which were classified as stage 3 to 5 according to the Racine scale; these rats survived until scheduled euthanasia. In the hippocampal tissues, both mRNA and protein levels of BDNF and NPY were increased by SVHRP. On the other hand, SVHRP did not alter the expression of CREB, STIM, or ORAI1 (Figure 1). Similar mRNA and protein expression patterns with SVHRP treatment were observed in primary hippocampal neuron culture from KA-induced epileptic rats. With SVHRP treatment, the expression of BDNF and NPY was up-regulated, while the expression of CREB, STIM, or ORAI1 was not altered significantly (Figure 2).

Figure 1
mRNA levels (n=3, top) and protein levels (n=3, bottom) of brain-derived neurotrophic factor (BDNF), neuropeptide Y (NPY), MP-response element binding protein (CREB), stromal interaction molecule (STIM), and calcium release-activated calcium channel protein 1 (ORAI1) in scorpion venom heat-resistant peptide-treated hippocampal tissues from kainic acid-induced epileptic rats. Data are reported as means±SD. *P<0.05; **P<0.01 (Mann-Whitney test).

Figure 2
mRNA levels (n=3, top) and protein levels (n=3, bottom) of brain-derived neurotrophic factor (BDNF), neuropeptide Y (NPY), cAMP-response element binding protein (CREB), stromal interaction molecule (STIM), and calcium release-activated calcium channel protein 1 (ORAI1) in scorpion venom heat-resistant peptide-treated primary hippocampal neuron culture from kainic acid-induced epileptic rats. Data are reported as means±SD. *P<0.05 (Mann-Whitney test).

The long-term effects of SVHRP on molecules associated with epilepsy were further studied. Eight-hour treatment of SVHRP induced upregulation of BDNF and NPY expression (Figures 1 and 2). This increase was sustained up to 24 h post-treatment at 0.2 μg/kg of SVHRP. On the other hand, the expression of CREB, STIM, or ORAI1 was not significantly changed by long-term treatment of SVHRP (Figure 3).

Figure 3
mRNA levels (n=3, top) and protein levels (n=3, bottom) of brain-derived neurotrophic factor (BDNF), neuropeptide Y (NPY), cAMP-response element binding protein (CREB), stromal interaction molecule (STIM), and calcium release-activated calcium channel protein 1 (ORAI1) in hippocampal tissues from kainic acid-induced epileptic rats with different treatment time of scorpion venom heat-resistant peptide. Data are reported as means±SD. *P<0.05; **P<0.01 (Mann-Whitney test).

Discussion

In this study, SVHRP treatment resulted in the upregulation of BDNF and NPY expression under epileptic condition, while the expression level of the other examined molecules, including CREB, STIM, and ORAI1, were not significantly altered. This differential expression pattern for each epilepsy-associated molecule suggested that the anti-epileptic mechanism of SVHRP may undergo the BDNF-NPY pathway.

BDNF is one of the most studied molecules in the pathophysiology of epilepsy. BDNF increases excitatory neurotransmission in cultured hippocampal neurons (⁹) and adult hippocampal slices (¹⁰). The proepileptogenic effects of BDNF have been systemically reviewed (¹¹,¹²). Interestingly, seven-day chronic infusion of BDNF into the hippocampus resulted in attenuation of the development of kindling in a rat epilepsy model (¹³). The anti-epileptogenic effects of BDNF are considered to be achieved by triggering NPY expression (¹⁴,¹⁵). Upon SVHRP treatment, the mRNA and protein expression levels of BDNF and NPY were positively correlated in the hippocampus and cultured hippocampal neurons from epileptic rats. Moreover, in the hippocampus from epileptic rats, the sustained BDNF expression level triggered NPY expression in a time-dependent manner. These data suggested that SVHRP enhanced BDNF expression and exerted its anti-epileptic effects through BDNF-mediated NPY expression.

CREB has been reported to play a role in transducing neuronal excitatory signals, and decreased CREB levels have been shown to suppress epilepsy (¹⁶). Activation of CREB is one of the transcriptional regulatory mechanisms for BDNF and NPY expression (¹⁷). In the present study, however, mRNA and protein levels of CREB were not significantly changed upon SVHRP treatment. It is possible that the transcriptional activity of CREB is post-translational regulated (i.e., phosphorylation) and is induced transiently. On the other hand, SVHRP might increase the BDNF and NPY levels through an unexplored CREB-independent transcriptional mechanism. In addition, it is known that aberrant Ca²⁺ flux in the neuron results in epileptic events (¹⁸). Activation of an inward Ca²⁺ current in the neuron triggers the initiation of epileptogenic activity (¹⁹). STIM and ORAI proteins play a critical role in maintaining cellular Ca²⁺ homeostasis (²⁰). In the present study, the anti-epileptic effects of SVHRP were not achieved by modulating the mRNA and protein levels of STIM and ORAI. In regard to the potential role of SVHRP in Ca²⁺ flux, further studies may focus on the effects of SVHRP on the expression/function of other calcium channels and the formation of STIM-ORAI complexes.

In conclusion, we reported a potential molecular mechanism for the anti-epileptic function of SVHRP. SVHRP upregulated the mRNA and protein levels of BDNF and NPY, providing a potential candidate for epilepsy treatment. Further studies are needed to confirm the correlation between gene/protein expression and changes in electric activity/behavior upon SVHRP treatment.

Acknowledgments

This study was supported by the General Program of Logistics Science Foundation of PLA (CNJ14J008).

References

• ¹ Fisher RS, van Emde Boas W, Blume W, Elger C, Genton P, Lee P, et al. Epileptic seizures and epilepsy: definitions proposed by the International League Against Epilepsy (ILAE) and the International Bureau for Epilepsy (IBE). Epilepsia 2005; 46: 470-472, doi: 10.1111/j.0013-9580.2005.66104.x.
  » https://doi.org/10.1111/j.0013-9580.2005.66104.x
• ² WHO. https://www.who.int/news-room/fact-sheets/detail/epilepsy
  » https://www.who.int/news-room/fact-sheets/detail/epilepsy
• ³ Goldenberg MM. Overview of drugs used for epilepsy and seizures: etiology, diagnosis, and treatment. P T 2010; 35: 392-415.
• ⁴ Liu G, Slater N, Perkins A. Epilepsy: treatment options. Am Fam Physician 2017; 15: 87-96.
• ⁵ Liu YF, Ma RL, Wang SL, Duan ZY, Zhang JH, Wu LJ, et al. Expression of an antitumor-analgesic peptide from the venom of Chinese scorpion Buthus martensii karsch in Escherichia coli. Protein Expr Purif 2003; 27: 253-258, doi: 10.1016/S1046-5928(02)00609-5.
  » https://doi.org/10.1016/S1046-5928(02)00609-5
• ⁶ Sun Y, Cui X, Yin S, Yu D, Li S, Zhang W, et al. Effects of scorpion venom heat-resistant protein on seizure behavior and expression of proenkephalin in rats with kainate-induced epilepsy. Neurophysiology 2013; 45: 319-322, doi: 10.1007/s11062-013-9375-4.
  » https://doi.org/10.1007/s11062-013-9375-4
• ⁷ Ono J, Vieth RF, Walson PD. Electrocorticographical observation of seizures induced by pentylenetetrazol (PTZ) injection in rats. Funct Neurol 1990; 5: 345-352.
• ⁸ Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001; 25: 402-408, doi: 10.1006/meth.2001.1262.
  » https://doi.org/10.1006/meth.2001.1262
• ⁹ Levine ES, Dreyfus CF, Black IB, Plummer MR. Brain-derived neurotrophic factor rapidly enhances synaptic transmission in hippocampal neurons via postsynaptic tyrosine kinase receptors. Proc Natl Acad Sci USA 1995; 92: 8074-8077, doi: 10.1073/pnas.92.17.8074.
  » https://doi.org/10.1073/pnas.92.17.8074
• ¹⁰ Kang H, Schuman EM. Long-lasting neurotrophin-induced enhancement of synaptic transmission in the adult hippocampus. Science 1995; 267: 1658-1662, doi: 10.1126/science.7886457.
  » https://doi.org/10.1126/science.7886457
• ¹¹ Koyama R, Ikegaya Y. To BDNF or not to BDNF: that is the epileptic hippocampus. Neuroscientist 2005; 11: 282-287, doi: 10.1177/1073858405278266.
  » https://doi.org/10.1177/1073858405278266
• ¹² Iughetti L, Lucaccioni L, Fugetto F, Predieri B, Berardi A, Ferrari F. Brain-derived neurotrophic factor and epilepsy: a systematic review. Neuropeptides 2018; 72: 23-29, doi: 10.1016/j.npep.2018.09.005.
  » https://doi.org/10.1016/j.npep.2018.09.005
• ¹³ Reibel S, Larmet Y, Le BT, Carnahan J, Marescaux C, Depaulis A. Brain-derived neurotrophic factor delays hippocampal kindling in the rat. Neuroscience 2000; 100: 777-788, doi: 10.1016/S0306-4522(00)00351-1.
  » https://doi.org/10.1016/S0306-4522(00)00351-1
• ¹⁴ Vezzani A, Ravizza T, Moneta D, Conti M, Borroni A, Rizzi M, et al. Brain-derived neurotrophic factor immunoreactivity in the limbic system of rats after acute seizures and during spontaneous convulsions: temporal evolution of changes as compared to neuropeptide Y. Neuroscience 1999; 90: 1445-1461, doi: 10.1016/S0306-4522(98)00553-3.
  » https://doi.org/10.1016/S0306-4522(98)00553-3
• ¹⁵ Reibel S, Vivien-Roels B, Le BT, Larmet Y, Carnahan J, Marescaux C, et al. Overexpression of neuropeptide Y induced by brain-derived neurotrophic factor in the rat hippocampus is long lasting. Eur J Neurosci 2000; 12: 595-605, doi: 10.1046/j.1460-9568.2000.00941.x.
  » https://doi.org/10.1046/j.1460-9568.2000.00941.x
• ¹⁶ Zhu X, Han X, Blendy JA, Porter BE. Decreased CREB levels suppress epilepsy. Neurobiol Dis 2012; 45: 253-263, doi: 10.1016/j.nbd.2011.08.009.
  » https://doi.org/10.1016/j.nbd.2011.08.009
• ¹⁷ Pandey SC, Roy A, Zhang H, Xu T. Partial deletion of the cAMP response element-binding protein gene promotes alcohol-drinking behaviors. J Neurosci 2004; 24: 5022-5030, doi: 10.1523/JNEUROSCI.5557-03.2004.
  » https://doi.org/10.1523/JNEUROSCI.5557-03.2004
• ¹⁸ Kulak W, Sobaniec W, Wojtal K, Czuczwar SJ. Calcium modulation in epilepsy. Pol J Pharmacol 2004; 56: 29-41, doi: 10.1211/002235704777489302.
  » https://doi.org/10.1211/002235704777489302
• ¹⁹ de Falco FA, Bartiromo U, Majello L, Di Geronimo G, Mundo P. Calcium antagonist nimodipine in intractable epilepsy. Epilepsia 1992; 33: 343-345, doi: 10.1111/j.1528-1157.1992.tb02325.x.
  » https://doi.org/10.1111/j.1528-1157.1992.tb02325.x
• ²⁰ Soboloff J, Rothberg BS, Madesh M, Gill DL. STIM proteins: dynamic calcium signal transducers. Nat Rev Mol Cell Biol 2012; 13: 549-565, doi: 10.1038/nrm3414.
  » https://doi.org/10.1038/nrm3414

Publication Dates

• Publication in this collection
  02 Apr 2021
• Date of issue
  2021

History

• Received
  24 Oct 2020
• Accepted
  12 Dec 2020