ABSTRACT
Methionine (Met) and cysteine (Cys) are nutrients in broiler diets, responsible for strengthening protein synthesis, immunity, and metabolic regulation. To estimate the ideal digestible Met + Cys:digestible Lysine (Lys) ratio for broilers under a lipopolysaccharide (LPS) inflammatory challenge, 384 male broilers were distributed in a completely randomized 4×2 factorial design, with four ratios of dig. Met + Cys:dig. Lys (0.69, 0.73, 0.77, and 0.81) and two conditions (with or without challenge). Each treatment had eight replicates, with six birds per experimental unit (EU). The evaluated parameters included broilers’ weight gain (WG), feed intake (FI), and feed conversion ratio (FCR); jejunum mRNA transcript levels of nuclear factor kappa-B (NF-Κb), glutathione peroxidase (GPX), superoxide dismutase (SOD), glutathione synthetase (GSS), and methionine adenosyltransferase 2 (MAT2); relative weights of liver and spleen, and fat mass (%) and lean mass (%). A linear regression model would estimate the ideal ratio if an effect had occurred. No interaction (p>0.05) was observed between the factors for all the data, nor did the different ratios had any effect (p>0.05) either. LPS-administered exhibited reduced performance, heavier liver and spleen, and lower GSS expression. Hence, the lowest dig Met + Cys:dig Lys ratio (0.69) was sufficient to maintain the performance parameters, the relative weight of lymphoid organs, fat and lean mass, and NF-Kb, GPX, SOD, GSS, MAT2, and CBS mRNA transcript levels in the jejunum.
Keywords:
E. coli; LPS; Sulfur amino acids
INTRODUCTION
Currently, in intensive production, broilers are subject to chronic inflammatory challenge that triggers immune responses and impairs immunological homeostasis (Zhang et al., 2019aZhang H, Chen Y, Chen Y, et al. Dietary pterostilbene supplementation attenuates intestinal damage and immunological stress of broiler chickens challenged with lipopolysaccharide. Journal Animal Science 2019a; 98(1):skz373. https://doi.org/10.1093/jas/skz373
https://doi.org/10.1093/jas/skz373...
) due to pathogenic microorganisms present in the production system, vaccinations with excessive dosages, and abuse or lack of chemotherapy with growth-promoting antibiotics (Liu et al., 2015Liu L, Shen J, Zhao C, et al. Dietary Astragalus polysaccharide alleviated immunological stress in broilers exposed to lipopolysaccharide. International Journal of Biological Macromolecules 2015;72:624-32. https://doi.org/ 10.1016/j.ijbiomac.2014.08.057
https://doi.org/...
). This challenge prevents poultry from expressing their maximum genetic and economic potential (Li et al., 2015).
In experimental trials on inflammation in broiler chickens, inoculation of bacterial LPS is a technique used to increase the activation of chickens’ inflammatory response without submitting them to potentially pathogenic agents, while also simulating a condition closer to the one found in commercial sheds (Beutler & Rietschel, 2003Beutler B, Rietschel, ET. Innate immune sensing and its roots: the story of endotoxin. Nature Reviews Immunology 2003;3:169-76. https://doi.org/10.1038/nri1004
https://doi.org/10.1038/nri1004...
; Nunes et al., 2020Nunes RA, Duarte M de S, Campos PHRF, et al. Active vitamin D3-glycoside preserves weight gain and modulates the inflammatory response in broiler chickens challenged with lipopolysaccharide. Animal Feed Science and Technology 2020;270:114704. https://doi.org/10.1016/j.anifeedsci.2020.114704
https://doi.org/10.1016/j.anifeedsci.202...
). When they are inoculated and perceived by the immune system, there is an increase in the production of the NF-Κb transcription factor that stimulates the expression and synthesis of inflammatory genes (Liu et al., 2022Liu M, Zhang Y, Cao KX, et al. Increased ingestion of hydroxy-methionine by both sows and piglets improves the ability of the progeny to counteract LPS-induced hepatic and splenic injury with potential regulation of TLR4 and NOD signaling. Antioxidants 2022;11(2):321. https://doi.org/10.3390/antiox11020321.
https://doi.org/10.3390/antiox11020321...
).
The sulfur amino acids (SAA) methionine (Met) and cysteine (Cys) are involved in functions that fortify broilers’ immune system, including regulation of the innate immune system, lipid metabolism, digestive functions, protein synthesis, and defense against oxidative stress (OS; Martínez et al., 2017Martínez Y, Li X, Liu G, et al. The role of methionine on metabolism, oxidative stress, and diseases. Amino Acids 2017;49(12):2091-8. https://doi.org/10.1007/s00726-017-2494-2
https://doi.org/10.1007/s00726-017-2494-...
). The leading cause of OS is the imbalance between the production of free radicals, such as reactive oxygen species (ROS), and antioxidant enzymes (Nawaz & Zhang, 2021Nawaz AH, Zhang L. Oxidative stress in broiler chicken and its consequences on meat quality. International Journal of Life Science Research Archive 2021;1(1):45-54. https://doi.org/10.53771/ijlsra.2021.1.1.0054
https://doi.org/10.53771/ijlsra.2021.1.1...
). Adding high levels of SAA to feed increases the synthesis and activity of GPX and SOD (Wen et al., 2016Wen C, Jiang XY, Ding LR, et al. Effects of dietary methionine on growth performance, meat quality and oxidative status of breast muscle in fast- and slow-growing broilers. Poultry Science 2016;432. https://doi.org/10.3382/ps/pew432
https://doi.org/10.3382/ps/pew432...
), thereby decreasing the presence of free radicals that damage macromolecules.
An increase in Met transsulfuration mitigates the effects of OS and maintains the demand of Cys for cellular reduced glutathione (GSH) synthesis (Del Vesco et al., 2015Del Vesco AP, Gasparino E, de Oliveira Grieser D, et al. Effects of methionine supplementation on the expression of oxidative stress-related genes in acute heat stress-exposed broilers. British Journal of Nutrition 2015;113(4):549-59. https://doi.org/10.1017/S0007114514003535
https://doi.org/10.1017/S000711451400353...
; Bortoluzzi et al., 2019Bortoluzzi C, Fernandes JIM, Doranalli K, et al. Effects of dietary amino acids in ameliorating intestinal function during enteric challenges in broiler chickens. Animal Feed Science and Technology 2019;262:114383. https://doi.org/10.1016/j.anifeedsci.2019.114
https://doi.org/10.1016/j.anifeedsci.201...
). Moreover, SAA participates in glutathione synthetase (GSS) gene expression, resulting in the effective synthesis of potent antioxidants that contribute to the removing system’s ability of ROS to alleviate the OS effect (Lai et al., 2018Lai A, Dong G, Song D, et al. Responses to dietary levels of methionine in broilers medicated or vaccinated against coccidia under Eimeria tenella-challenged condition. BMC Veterinary Research 2018;14:140. https://doi.org/10.1186/s12917-018-1470-8
https://doi.org/10.1186/s12917-018-1470-...
; Lugata et al., 2022Lugata K, Ortega ADSV, Szabó C. The role of methionine supplementation on oxidative stress and antioxidant status of poultry - a review. Agriculture 2022;12(10):1701. https://doi.org/10.3390/agriculture12101701
https://doi.org/10.3390/agriculture12101...
).
Therefore, additional SAA supplementation may improve performance by reducing OS and, consequently, the inflammatory challenge. One strategy to mitigate the adverse effects of inflammation is to increase the intake of dig SAA through the ratio dig SAA:dig lysine (Lys), such as dig Met + Cys. However, few studies have estimated the ideal dig Met + Cys to dig Lys ratio in diets for broiler chickens under inflammatory challenge.
Thus, it was hypothesized that the ideal ratio of dig Met + Cys:dig Lys in broiler diets is increased in immunologically challenged broilers. The objective of this study was therefore to estimate the ideal ratio of dig Met + Cys:dig Lys for broilers submitted or not to LPS inflammatory challenge.
MATERIALS AND METHODS
Ethics Committee
The Animal Care and Use Committee of the Federal University of Viçosa, Brazil, approved all animal procedures conducted in this study (protocol no. 70/2021). The experiment was conducted according to the experimental protocols for using live broilers from the National Council for Experimentation Animal Control (CONCEA, 2008) in the municipality of Viçosa (20°45’14” S, 42°52’53” W, altitude 648.74 m), in the state of Minas Gerais, Brazil.
Birds and experimental design
One-day-old male broiler chickens (Cobb 500) were obtained from a commercial hatchery. The poultry were reared on the floor according to lineage management recommendations until the beginning of the experiment. They had free access to water and were fed a corn/soybean meal-based standard diet in mashed form (ad libitum). At the thirteenth day of age, based on their body weight, a total of 384 male broilers (514 ± 51.4 g) were distributed in a 4 x 2 (four ratios of dig Met + Cys:dig Lys x with or without challenge) completely randomized factorial design, with eight replicates per treatment, and six chickens per experimental unit (EU). The birds were housed in 64 EUs consisting of wire floor cages (667 cm²/broiler) in a two-level battery equipped with a trough feeder and a nipple drinker. The temperature was maintained according to lineage management recommendations, and the broilers were exposed to 18 hours of continuous light daily during the experimental period. To simulate a repeated exposure inflammatory challenge, all birds were weighted individually so that treatments 5, 6, 7, and 8 received an intraperitoneal application of 1mg of LPS / kg of body weight at 14, 16, 18, and 20 days old. The birds from treatments 1, 2, 3, and 4 were individually weighed and received a comparable amount of saline solution (SS) at a similar location to the administration of LPS in treatments 5, 6, 7, and 8, ensuring a consistent induction of stress.
Diets
The experimental diets (Table I) were based on corn and soybean meal, and were formulated according to the nutritional recommendations by Rostagno et al. (2017Rostagno HS, Albino LFT, Hannas MI, et al. Brazilian tables for poultry and swine: food composition and nutritional requirements. 4th ed. Viçosa: UFV; 2017.) for the 8 to 21 days old phase, except for the levels of dig Met + Cys, which varied per treatment. The ratios of dig Met + Cys:dig Lys tested were 0.69, 0.74, 0.79, and 0.84. 95% of the recommended level of dig lysin was used. The suboptimal level aimed to ensure that the chickens consumed all dig Lys and that the ideal dig Met + Cys:dig Lys ratio was not underestimated. Samples of experimental diets were collected for analysis of crude protein and amino acids (Aas) to correct the formulas before preparing the experimental diets (Table I). All experimental diets had an essential nitrogen:total nitrogen ratio that was lower than 0.50, as recommended by Maia et al. (2021Maia RC, Albino LFT, Rostagno HS, et al. Low crude protein diets for broiler chickens aged 8 to 21 days should have a 50% essential-to-total nitrogen ratio. Animal Feed Science and Technology 2021;271:114709. https://doi.org/10.1016/j.anifeedsci.2020.114
https://doi.org/10.1016/j.anifeedsci.202...
).
Performance and sample collection
The broilers’ performance was evaluated at 21 days of age by determining the weight gain (WG), feed intake (FI), and feed conversion ratio (FCR). At 20 days, the bird with the weight closest to the average weight of the EU was selected for sample collection. Then, 24 hours after the last application of LPS, the bird was euthanized and slaughtered. 2 cm of the jejuni were collected, stored individually in cryogenic tubes, and kept in an ultra-freezer until analyzed to measure mRNA transcript levels. At 21 days of age, when one bird per EU was slaughtered for sample collection, the leftover feed was weighed, and the feed intake per bird from 13 to 21 days of age was calculated. The total feed intake per bird and the final weight were used to determine the feed conversion ratio. The liver and spleen of the sampled broiler were removed and weighed separately to determine their relative weights. The relative weights were determined in relation to the animal’s live weight (%).
Determination of mRNA transcript level
The total RNA transcript level of the samples from the jejunum was extracted using a Trizol® reagent (Invitrogen, Carlsbad, California, 279 USA), according to the manufacturer’s instructions, in the proportion of 1 mL for each 80 mg of tissue. This process measured mRNA expression for nuclear factor kappa-B (NF-Κb; F: GTGTGAAGAAACGGGAACTG; R: GGCACGGTTGTCATAGATGG), glutathione peroxidase (GPX) (F: GACCAACCCGCAGTACATCA; R: GAGGTGCGGGCTTTCCTTTA), superoxide dismutase (SOD) (F: AGGGGGTCATCCACTTCC; R: CCCATTTGTGTTGTCTCCAA), GSS (F: GTGCCAGTTCCAGTTTTCTTATG; R: TCCCACAGTAAAGCCAAGAG) and methionine adenosyltransferase 2 (MAT2; F: CTTCCCAGCAGCCACTTGAG; R: GCAGTCAAGCTGAGCGTTCC). RNA integrity was assessed on a 1% agarose gel stained with ethidium bromide (10 mg/mL) and visualized under ultraviolet light. For real-time PCR, the fluorescent dye SYBR GREEN (SYBR® GREEN PCR Master Mix, Applied Biosystems, USA) was used. The amplification conditions in the thermocycler were initially denatured at 95ºC for 10 min, followed by 40 cycles of denaturation at 95ºC for 15 seconds, and annealing at 60ºC for 1 min. The melting curves were performed to guarantee the specificity of the PCR products. The β-actin gene (F: ATTGTCCACCGCAAATGCTTC; R: AAATAAAGCCATGCCAATCTCGTC) was used as an endogenous control. The data were generated following the 2−ΔΔCT method (Livak & Schmittgen, 2001Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2-??CT. Methods 2001;4:1-408. https://doi.org/10.1006/meth.2001.1262
https://doi.org/10.1006/meth.2001.1262...
).
DEXA estimated fat mass (%) and lean mass (%)
Chicken body composition was measured using a Prodigy Advance DEXA scanner (GE Medical Systems Ultrasound & Primary Care Diagnostics LLC 3030 Ohmeda Drive, Madison, WI, 53718, USA) with encore software version 18. A complete body scan was performed and analyzed in the small animal body mode. At the start of each scanning day, a quality assurance program was performed using a phantom standard to ensure the accurate calibration of the scanner. Eight euthanized chickens per treatment were placed in a dorsal position with spread wings and stretched legs to avoid extensive overlap of body parts. Subsequently, the lines defining the regions of interest were corrected for the body. Since these lines are fixed at specific intersections, a calculated compromise was consistently applied. Based on the attenuation of the 2 X-ray beams by different absorbing materials, the software calculated the estimated values for total tissue, lean and fat tissue. These values were obtained for the whole body region. After that, equations developed by Schallier et al. (2019Schallier S, Li C, Lesuisse J, et al. Dual-energy X-ray absorptiometry is a reliable non-invasive technique for determining whole body composition of chickens. Poultry Science 2019;98(1):1652-61. https://doi.org/10.3382/ps/pez013
https://doi.org/10.3382/ps/pez013...
) were used to correct the values of total fat mass [1] and total lean mass percentage [2]:
Statistical analyses
The statistical analysis was conducted using a 4 × 2 factorial arrangement of treatments to investigate the response of (challenged and unchallenged) broilers to 4 ratios of digestible Methionine + Cysteine:digestible Lysine in the diets. Data were analyzed using the GLM procedure of SAS 9.4 (SAS Institute Inc., Cary, NC, USA). The cage served as the experimental unit for growth performance, and one bird served as the experimental unit for determining mRNA transcript levels, relative weights of liver and spleen, and DEXA estimated fat and lean mass. Differences were considered significant at an alpha <0.05. The mean comparison method was used, and a linear regression model would estimate the ideal ratio if an effect had occurred. The assumptions of analysis of variance, regarding the normality of residuals and the homogeneity of variances, were evaluated using the Shapiro-Wilk and Hartley tests, respectively. The statistical model used for the analysis consisted of Yijk=μ+Ri+Cj+(R x C)ij+εijk, where Yijk is the measured dependent variable, μ is the overall mean, R is the effect of the different ratios, C effect of the challenge, R x C is the effect of the interaction, and εijk the random error.
RESULTS
Performance
No mortality was observed during the experiment. There was no interaction (p>0.05) between the inflammatory challenge and the increase of dig Met + Cys:dig Lys ratio for WG, FI, and FCR. The different ratios of dig Met + Cys:dig Lys had no significant effect (p>0.05) on the same data observed. However, there were significant differences (p>0.05) between challenged and unchallenged animals. Chickens that received the intraperitoneal application of LPS all had lower performance parameters than those that received a SS application (Table II).
Organs relative weight
There was no interaction (p>0.05) between the inflammatory challenge and the increase of the dig Met + Cys:dig Lys ratio on the relative weight of the liver and spleen. The different ratios of dig Met + Cys:dig Lys had no significant effect (p>0.05) on these same indices. However, there was a significant difference (p<0.05) between challenged and non-challenged animals. The chickens that received an intraperitoneal application of LPS had a heavier liver and spleen than those that received the application of SS (Table II).
mRNA transcript level
There was no interaction (p>0.05) between the inflammatory challenge and the increase in the dig Met + Cys:dig Lys ratio for the mRNA transcript level of NF-Κb, GPX, SOD, GSS, MAT2, and CBS in the jejunum. Furthermore, the different ratios of dig Met + Cys:dig Lys had no significant effect (p>0.05) on the mRNA transcript level of the same target genes. However, there was a significant difference (p<0.05) between challenged and non-challenged animals for GSS mRNA transcript level. Broilers that received an intraperitoneal application of LPS had lower expression than those that received SS (Table II).
DEXA estimated fat and lean mass
There was no interaction (p>0.05) between the inflammatory challenge and the increase of dig Met + Cys: dig Lys ratio for lean and fat mass. The different ratios of dig Met + Cys: dig Lys also had no significant effect (p>0.05) on the same body compositions. Furthermore, there were no significant differences (p>0.05) between challenged and non-challenged animals for DEXA estimated fat and lean mass (Table II).
DISCUSSION
The application of LPS is commonly used to experimentally stimulate the inflammatory response of broilers (Chen et al., 2020Chen Y, Cheng Y, Wang W, et al. Protective effects of dietary supplementation with a silicate clay mineral (palygorskite) in lipopolysaccharide-challenged broiler chickens at an early age. Animal Feed Science and Technology 2020;263:114459. https://doi.org/10.1016/j.anifeedsci.2020.114459
https://doi.org/10.1016/j.anifeedsci.202...
; Kreuz et al., 2020Kreuz BS, Rocha GC, Campos PHRF, et al. Effects of dietary nucleotide supplementation on growth performance and physiology of broiler chickens under pre-and post-inflammatory challenge. Revista Brasileira de Zootecnia 2020;49:e20200117. https://doi.org/10.37496/rbz4920200117
https://doi.org/10.37496/rbz4920200117...
; Qiu et al., 2022Qiu W, Zhang X, Pang X, et al. Asiatic acid alleviates LPS-induced acute kidney injury in broilers by inhibiting oxidative stress and ferroptosis via activation of the Nrf2 pathway. Food and Chemical Toxicology 2022;170:113468. https://doi.org/10.1016/j.fct.2022.113468
https://doi.org/10.1016/j.fct.2022.11346...
). This was again confirmed by this study’s results, with worsening performance, lymphoid organ hypertrophy, and mRNA transcript level of GSS. Additionally, the transsulfuration of Met into Cys increases under challenge conditions, and the amount of Met will be deficient for production. Thus, less Met will be acquired and retained in tissues linked to growth performance (Conde-Aguilera et al., 2013Conde-Aguilera JA, Cobo-Ortega C, Tesseraud S, et al. Changes in body composition in broilers by a sulfur amino acid deficiency during growth. Poultry Science 2013;92(5):1266-75. https://doi.org/10.3382/ps.2012-02796
https://doi.org/10.3382/ps.2012-02796...
), potentially impacting the quality of prime meats, such as breast muscle (Conde-Aguilera et al., 2016).
This lower performance can be attributed to LPS-induced inflammation that deteriorates the intestinal barrier function (Wang et al., 2022aWang MY, Zhang Y, Tong YX, et al. Effects of lutein on jejunal mucosal barrier function and inflammatory responses in lipopolysaccharide-challenged yellow-feather broilers. Poultry science 2022a;101(12):102191. https://doi.org/10.1016/j.psj.2022.102191
https://doi.org/10.1016/j.psj.2022.10219...
), and absorption and route change of nutrients to support homeostatic activities compensating the deficiency (Korver & Klasing, 1997Korver DR, Klasing KC. Dietary fish oil alters specific and inflammatory immune responses in chicks. The Journal of Nutrition 1997;127(10):2039-46. https://doi.org/10.1093/jn/127.10.2039
https://doi.org/10.1093/jn/127.10.2039...
; Zhang et al., 2013Zhang X, Zhao L, Cao F, et al. Effects of feeding fermented Ginkgo biloba leaves on small intestinal morphology, absorption, and immunomodulation of early lipopolysaccharide-challenged chicks. Poultry Science 2013;92(1):119-30. https://doi.org/10.3382/ps.2012-02645
https://doi.org/10.3382/ps.2012-02645...
). The compromise in the use of Aas by the animal (Li et al., 2007Li P, Yin Y-L, Li D, et al. Amino acids and immune function. British Journal of Nutrition 2007;98(2):237. https://doi.org/10.1017/s000711450769936x
https://doi.org/10.1017/s000711450769936...
; Liu et al., 2015Liu L, Shen J, Zhao C, et al. Dietary Astragalus polysaccharide alleviated immunological stress in broilers exposed to lipopolysaccharide. International Journal of Biological Macromolecules 2015;72:624-32. https://doi.org/ 10.1016/j.ijbiomac.2014.08.057
https://doi.org/...
) alters the nutritional requirement of these nutrients. In this study, it was expected that changing the optimal dig Met + Cys:dig Lys ratio in broilers submitted or not to inflammatory challenge would improve growth performance. However, this hypothesis was not confirmed, possibly because the level of these Aas in the basal diet was suboptimal, as found by Savaram et al. (2022Savaram VRR, Mantena VLNR, Paul SS, et al. Enhancement of performance and anti-oxidant variables in broiler chicken fed diets containing sub-optimal methionine level with graded concentrations of sulphur and folic acid. Animal Bioscience 2022;35(5):721. https://doi.org/10.5713/ab.21.0258
https://doi.org/10.5713/ab.21.0258...
).
Metabolites of Aas can regulate OS and anti-inflammatory activity (Del Vesco et al., 2015Del Vesco AP, Gasparino E, de Oliveira Grieser D, et al. Effects of methionine supplementation on the expression of oxidative stress-related genes in acute heat stress-exposed broilers. British Journal of Nutrition 2015;113(4):549-59. https://doi.org/10.1017/S0007114514003535
https://doi.org/10.1017/S000711451400353...
; Zhang et al., 2020Zhang C, Wang C, Chen K, et al. Effect of l-theanine on growth performance, intestinal development and health, and peptide and amino acid transporters expression of broilers. Journal of the Science of Food and Agriculture 2020;100(4):1718-25. https://doi.org/10.1002/jsfa.10192
https://doi.org/10.1002/jsfa.10192...
). This is justified by the increased liver and spleen hypertrophy with incremental levels of dietary Aas due to the rise in protein biosynthesis and liver activity (Jahanian & Khalifeh-Gholi, 2018Jahanian R, Khalifeh-Gholi M. Marginal deficiencies of dietary arginine and methionine could suppress growth performance and immunological responses in broiler chickens. Journal of Animal Physiology and Animal Nutrition 2018;102:11-20. https://doi.org/10.1111/jpn.12695
https://doi.org/10.1111/jpn.12695...
), and by the associated enhanced immune cell replication and proliferation (Barekatain et al., 2019Barekatain R, Nattrass G, Tilbrook AJ, et al. Reduced protein diet and amino acid concentration alter intestinal barrier function and performance of broiler chickens with or without synthetic glucocorticoid. Poultry Science 2019;98(9):3362-75. https://doi.org/10.3382/ps/pey563
https://doi.org/10.3382/ps/pey563...
). Therefore, one strategy to mitigate the adverse effects of bacterial LPS-induced inflammation is to increase the intake of dig Aas in the diet by increasing the dig Aas:dig Lys ratio (Star et al., 2012Star L, Rovers M, Corrent E, et al. Threonine requirement of broiler chickens during subclinical intestinal Clostridium infection. Poultry Science 2012;91(3):643-52. https://doi.org/10.3382/ps.2011-01923
https://doi.org/10.3382/ps.2011-01923...
; Abdaljaleel et al., 2018Abdaljaleel RA, Al-Ajeeli M, Jameel Y, et al. Assessing effects of yeast cell wall supplementation on threonine requirements in broilers as measured by performance and intestinal morphology. Poultry Science 2018;97(7):2473-8. https://doi.org/10.3382/ps/pey095
https://doi.org/10.3382/ps/pey095...
; Lisnahan et al., 2022Lisnahan CV, Nahak OR, Welsiliana W, et al. Effect of L-arginine and L-Lysine HCl ratio on growth performance and ileum morphology of native chickens aged 2-14 weeks. Veterinary World 2022;15(5):1365. https://doi.org/10.14202/vetworld.2022.1365-1372
https://doi.org/10.14202/vetworld.2022.1...
) through Met + Cys addition. However, the results confirm that altering the ideal dig Met + Cys:dig Lys ratio does not reduce oxidative and inflammatory stress by altering the relative weight of the liver and spleen. Nonetheless, animals that received the application of LPS had higher relative weight of the liver and spleen than the non-challenged animals (SS application), which agrees with Lieboldt et al. (2016Lieboldt MA, Frahm J, Halle I, et al. Metabolic and clinical response toEscherichia colilipopolysaccharide in layer pullets of different genetic backgrounds supplied with graded dietary L-arginine. Poultry Science 2016;95(3):595-611. http://dx.doi.org/10.3382/ps/pev359
http://dx.doi.org/10.3382/ps/pev359...
) and Wang et al. (2022bWang H, Yang F, Song ZW, et al. The influence of immune stress induced by Escherichia coli lipopolysaccharide on the pharmacokinetics of danofloxacin in broilers. Poultry Science 2022b;101(3):101629. https://doi.org/10.1016/j.psj.2021.101629
https://doi.org/10.1016/j.psj.2021.10162...
).
LPS can increase NF-Kb production, which stimulates the expression of inflammatory genes (Yang et al., 2019Yang L, Liu G, Lian K, et al. Dietary leonurine hydrochloride supplementation attenuates lipopolysaccharide challenge-induced intestinal inflammation and barrier dysfunction by inhibiting the NF-?B/MAPK signalling pathway in broilers. Journal of Animal Science 2019;97(4):1679-92. https://doi.org/10.1093/jas/skz078
https://doi.org/10.1093/jas/skz078...
; Liu et al., 2022Liu M, Zhang Y, Cao KX, et al. Increased ingestion of hydroxy-methionine by both sows and piglets improves the ability of the progeny to counteract LPS-induced hepatic and splenic injury with potential regulation of TLR4 and NOD signaling. Antioxidants 2022;11(2):321. https://doi.org/10.3390/antiox11020321.
https://doi.org/10.3390/antiox11020321...
). Adding high levels of Met to feed can strengthen the antioxidant system by increasing SOD activity in the proximal intestine (Wang et al., 2019Wang MY, Yin X, Yin D, et al. Antioxidant response and bioavailability of methionine hydroxy analog relative to DL-methionine in broiler chickens. Animal Nutrition 2019;5(3):241-7. https://doi.org/10.1016/j.aninu.2019.06.007
https://doi.org/10.1016/j.aninu.2019.06....
), protecting and repairing cells (Roushdy et al., 2018Roushdy EM, Zaglool AW, El-Tarabany MS. Effects of chronic thermal stress on growth performance, carcass traits, antioxidant indices and the expression of HSP70, growth hormone and superoxide dismutase genes in two broiler strains. Journal of Thermal Biology 2018;74:337-43. https://doi.org/10.1016/j.jtherbio.2018.04.00
https://doi.org/10.1016/j.jtherbio.2018....
). Powerful negative radicals are formed in tissues through metabolism or cellular reactions, such as superoxide or singlet oxygen. The SOD enzyme can catalytically convert these free radicals into molecular oxygen (O2) and hydrogen peroxide (H2O2), which are less harmful. However, the exaggerated accumulation of H2O2 is toxic to tissues or cells (Ighodaro & Akinloye, 2017Ighodaro OM, Akinloye OA. First line defence antioxidants-superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GPX): Their fundamental role in the entire antioxidant defence grid. Alexandria Journal of Medicine 2017;54(4). https://doi.org/10.1016/j.ajme.2017.09.001
https://doi.org/10.1016/j.ajme.2017.09.0...
).
Met is a precursor of GSH (Gasparino et al., 2017Gasparino, E, Del Vesco AP, Khatlab AS, et al. Effects of methionine hydroxy analogue supplementation on the expression of antioxidant-related genes of acute heat stress-exposed broilers. Animal 2017;12(5):931-9. https://doi.org/10.1017/S1751731117002439
https://doi.org/10.1017/S175173111700243...
), and its supplementation increases GPX expression (Del Vesco et al., 2015Del Vesco AP, Gasparino E, de Oliveira Grieser D, et al. Effects of methionine supplementation on the expression of oxidative stress-related genes in acute heat stress-exposed broilers. British Journal of Nutrition 2015;113(4):549-59. https://doi.org/10.1017/S0007114514003535
https://doi.org/10.1017/S000711451400353...
; Zhang et al., 2019bZhang Y, Xu BY, Zhao L, et al. Increased consumption of sulfur amino acids by both sows and piglets enhances the ability of the progeny to adverse effects induced by Lipopolysaccharide. Animals 2019b;29(9):1048. https://doi.org/10.3390/ani9121048
https://doi.org/10.3390/ani9121048...
). It plays a vital role in antioxidant defense, indirectly breaking down H2O2 to water, using H2O2 as a substrate for GSH oxidation (Ighodaro & Akinloye, 2017Ighodaro OM, Akinloye OA. First line defence antioxidants-superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GPX): Their fundamental role in the entire antioxidant defence grid. Alexandria Journal of Medicine 2017;54(4). https://doi.org/10.1016/j.ajme.2017.09.001
https://doi.org/10.1016/j.ajme.2017.09.0...
), and stopping lipid peroxidation (Chen et al., 2017Chen M, Li X, Fan R, et al. Selenium antagonizes cadmium-induced apoptosis in chicken spleen but not involving Nrf2-regulated antioxidant response. Ecotoxicology and Environmental Safety 2017;145:503-10. https://doi.org/10.1016/j.ecoenv.2017.08.001
https://doi.org/10.1016/j.ecoenv.2017.08...
). Thus, GPX contributes to the protection of all cells that utilize oxidative metabolism by eliminating increased reactive species during the inflammatory process. In this study, it was expected that altering the optimal dig Met + Cys:dig Lys ratio for broilers subjected to inflammatory challenge or not would improve the mRNA transcript level of NF-Kb, GPX, and SOD in the jejunum. However, this hypothesis was not confirmed.
According to Li et al. (2017Li Q, Cui J, Fang C, et al. S-Adenosylmethionine attenuates oxidative stress and neuroinflammation induced by Amyloid-? through modulation of glutathione metabolism. Journal of Alzheimer's Disease 2017;58(2):549-58. https://doi.org/10.3233/JAD-170177
https://doi.org/10.3233/JAD-170177...
), SOD activity can be improved by S-adenosylmethionine, a vital methyl donor. It is synthesized from Met and adenosine triphosphate through the upregulation of MAT2 (Faraji et al., 2018Faraji M, Karimi Dehkordi S, Zamiani Moghadam AK, et al. Combined effects of guanidinoacetic acid, coenzyme Q10 and taurine on growth performance, gene expression and ascites mortality in broiler chickens. Journal of Animal Physiology and Animal Nutrition 2018; 103(1):162-9. https://doi.org/10.1111/jpn.13020
https://doi.org/10.1111/jpn.13020...
). S-adenosylmethionine acts in methylation and biosynthesis processes of molecules that increase energy availability for protein deposition, such as the methylation of guanidinoacetic acid to form creatine (Mousavi et al., 2013Mousavi SN, Afsar A, Lotfollahian H. Effects of guanidinoacetic acid supplementation to broiler diets with varying energy contents. The Journal of Applied Poultry Research 2013;22(1):47-54. https://doi.doi.org/10.3382/japr.2012-00575
https://doi.doi.org/10.3382/japr.2012-00...
). This study hypothesized that altering the optimal dig Met + Cys:dig Lys ratio for broilers subjected or not to inflammatory challenge would improve the mRNA transcript level of MAT2 in the jejunum. However, this was not confirmed.
Reverse transsulfuration is a Cys biosynthetic pathway characterized by the cleavage of cystathionine. It starts with CBS separating the homocysteine complex (HCy) and serine to form cystathionine (Kruger, 2017Kruger WD. Cystathionine ?-synthase deficiency: Of mice and men. Molecular Genetics and Metabolism 2017;121(3):199-205. https://doi.org/10.1016/j.ymgme.2017.05.011
https://doi.org/10.1016/j.ymgme.2017.05....
). In addition to this role, HCy can regenerate Met via remethylation (Wan et al., 2017Wan J, Ding X, Wang J, et al. Dietary methionine source and level affect hepatic sulfur amino acid metabolism of broiler breeder hens. Animal Science Journal 2017;88(12):2016-24. https://doi.org/10.1111/asj.12882
https://doi.org/10.1111/asj.12882...
). This study expected that altering the optimal dig Met + Cys:dig Lys ratio for broilers subjected or not to inflammatory challenge would improve CBS’s mRNA transcript level in the jejunum. However, this hypothesis was not confirmed.
GSS is an enzyme that acts in the second step of the formation of GSH by catalyzing the reaction of dipeptide gamma-glutamylcysteine with glycine (Lu, 2013Lu SC. Glutathione synthesis. Biochimica et Biophysica Acta (BBA) - General Subjects 2013;5:3143-53. https://doi.org/10.1016/j.bbagen.2012.09.008
https://doi.org/10.1016/j.bbagen.2012.09...
). GSH is present in the intestinal epithelium, where it can improve intestinal morphology characteristics (Song et al., 2018Song ZH, Cheng K, Zheng XC, et al. Effects of dietary supplementation with enzymatically treated Artemisia annua on growth performance, intestinal morphology, digestive enzyme activities, immunity, and antioxidant capacity of heat-stressed broilers. Poultry Science 2018;9(2):430-7. https://doi.doi.org/10.3382/ps/pex312
https://doi.doi.org/10.3382/ps/pex312...
). However, when chickens go through LPS-induced inflammation, there is a lower production of GSH (Sun et al., 2014Sun B, Ma J, Zhang J, et al. Lycopene reduces the negative effects induced by lipopolysaccharide in breeding hens. British Poultry Science 2014;55(5):628-34. https://doi.org/10.1080/00071668.2014.956688
https://doi.org/10.1080/00071668.2014.95...
). Since GHS depends on the GSS enzyme activity for their formation, it can be stated that there was a reduction in the expression of GSS as well. This study predicted that the alteration of the ideal dig Met + Cys:dig Lys ratio for broilers submitted or not to inflammatory challenge would improve the mRNA transcript level of GSS. However, this hypothesis was not confirmed. On the other hand, findings show that broilers that received LPS-induced inflammation had lower mRNA transcript level of GSS in the jejunum.
SAAs stand out in the protein and lipid metabolism of poultry (Majdeddin et al., 2019Majdeddin M, Golian A, Kermanshahi H, et al. Effects of methionine and guanidinoacetic acid supplementation on performance and energy metabolites in breast muscle of male broiler chickens fed corn-soybean diets. British Poultry Science 2019;60:554-63. https://doi.org/10.1080/00071668.2019.1631447
https://doi.org/10.1080/00071668.2019.16...
). These Aas participate in pathways that give rise to polyamines, creatine, melatonin, and epinephrine (Zhou et al., 2020Zhou HY, Wu W-J, Xu Y-Y, et al. Calcium carbonate addition improves l-methionine biosynthesis by metabolically engineered Escherichia coli W3110-BL. Frontiers in Bioengineering and Biotechnology 2020;8. https://doi.org/10.3389/fbioe.2020.00300
https://doi.org/10.3389/fbioe.2020.00300...
). In addition, SAAs participate in metabolic pathways of methyl group donation, such as choline and betaine (Alagawany et al., 2022Alagawany M, Elnesr SS, Farag MR, et al. Betaine and related compounds: Chemistry, metabolism and role in mitigating heat stress in poultry. Journal of Thermal Biology 2022;104:103168. https://doi.org/10.1016/j.jtherbio.2021.103168
https://doi.org/10.1016/j.jtherbio.2021....
). Regarding lipid metabolism, SAAs interfere with the oxidative catabolism of fat tissue (Elsharkawy et al., 2021Elsharkawy MS, Chen Y, Liu R, et al. Paternal dietary methionine supplementation improves carcass traits and meat quality of chicken progeny. Animals 2021;28(11):325. https://doi.org/10.3390/ani11020325
https://doi.org/10.3390/ani11020325...
) (like carnitine biosynthesis (Ringseis et al., 2018Ringseis R, Keller J, Eder K. Basic mechanisms of the regulation of L-carnitine status in monogastrics and efficacy of L-carnitine as a feed additive in pigs and poultry. Journal of Animal Physiology and Animal Nutrition 2018;102(6):1686-719. https://doi.org/10.1111/jpn.12959
https://doi.org/10.1111/jpn.12959...
) that stimulates fatty acid oxidation for better energy production), growth performance (Golrokh et al., 2016Golrokh AJ, Bouyeh M, Seidavi A, et al. Effect of different dietary levels of atorvastatin and L-carnitine on performance, carcass characteristics and plasma constitutes of broiler chickens. The Journal of Poultry Science 2016;53(3):201-7. https://doi.org/10.2141/jpsa.0150184
https://doi.org/10.2141/jpsa.0150184...
), and improves carcass quality, as reported by Asadi et al. (2016Asadi H, Sadeghi A, Eila N, et al. Carcass Traits and Immune Response of Broiler Chickens Fed Dietary L-Carnitine, Coenzyme Q10 and Ractopamine. Revista Brasileira de Ciência Avícola 2016;18(4):677-82. https://doi.org/10.1590/1806-9061-2016-0324
https://doi.org/10.1590/1806-9061-2016-0...
). Thus, this study hypothesized that altering the ideal dig Met + Cys:dig Lys ratio for broilers submitted or not to inflammatory challenge would change the percentage of lean and fat mass. However, results revealed that these variables were not influenced.
CONCLUSIONS
It is therefore inferred that the lowest dig Met + Cys:dig Lys ratio, that is 0.69 (1.193% dig Lys: 0.823% dig Met + Cys), was sufficient to maintain the performance parameters, the relative weight of lymphoid organs, fat and lean mass, and the NF-Kb, GPX, SOD, GSS, MAT2, and CBS mRNA contents of the jejunum.
ACKNOWLEDGMENTS
We dedicate this study to the memory of our professor Luiz Albino, an outstanding mentor, collaborator, and friend. His legacy endures in the countless lives he touched. We thank the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) and Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) for their support.
REFERENCES
- Abdaljaleel RA, Al-Ajeeli M, Jameel Y, et al. Assessing effects of yeast cell wall supplementation on threonine requirements in broilers as measured by performance and intestinal morphology. Poultry Science 2018;97(7):2473-8. https://doi.org/10.3382/ps/pey095
» https://doi.org/10.3382/ps/pey095 - Alagawany M, Elnesr SS, Farag MR, et al. Betaine and related compounds: Chemistry, metabolism and role in mitigating heat stress in poultry. Journal of Thermal Biology 2022;104:103168. https://doi.org/10.1016/j.jtherbio.2021.103168
» https://doi.org/10.1016/j.jtherbio.2021.103168 - Asadi H, Sadeghi A, Eila N, et al. Carcass Traits and Immune Response of Broiler Chickens Fed Dietary L-Carnitine, Coenzyme Q10 and Ractopamine. Revista Brasileira de Ciência Avícola 2016;18(4):677-82. https://doi.org/10.1590/1806-9061-2016-0324
» https://doi.org/10.1590/1806-9061-2016-0324 - Barekatain R, Nattrass G, Tilbrook AJ, et al. Reduced protein diet and amino acid concentration alter intestinal barrier function and performance of broiler chickens with or without synthetic glucocorticoid. Poultry Science 2019;98(9):3362-75. https://doi.org/10.3382/ps/pey563
» https://doi.org/10.3382/ps/pey563 - Beutler B, Rietschel, ET. Innate immune sensing and its roots: the story of endotoxin. Nature Reviews Immunology 2003;3:169-76. https://doi.org/10.1038/nri1004
» https://doi.org/10.1038/nri1004 - Bortoluzzi C, Fernandes JIM, Doranalli K, et al. Effects of dietary amino acids in ameliorating intestinal function during enteric challenges in broiler chickens. Animal Feed Science and Technology 2019;262:114383. https://doi.org/10.1016/j.anifeedsci.2019.114
» https://doi.org/10.1016/j.anifeedsci.2019.114 - Chen M, Li X, Fan R, et al. Selenium antagonizes cadmium-induced apoptosis in chicken spleen but not involving Nrf2-regulated antioxidant response. Ecotoxicology and Environmental Safety 2017;145:503-10. https://doi.org/10.1016/j.ecoenv.2017.08.001
» https://doi.org/10.1016/j.ecoenv.2017.08.001 - Chen Y, Cheng Y, Wang W, et al. Protective effects of dietary supplementation with a silicate clay mineral (palygorskite) in lipopolysaccharide-challenged broiler chickens at an early age. Animal Feed Science and Technology 2020;263:114459. https://doi.org/10.1016/j.anifeedsci.2020.114459
» https://doi.org/10.1016/j.anifeedsci.2020.114459 - Conde-Aguilera JA, Cholet JCG, Lessire M, et al. The level and source of free-methionine affect body composition and breast muscle traits in growing broilers. Poultry Science 2016;95(10):2322-31. https://doi.org/10.3382/ps/pew105
» https://doi.org/10.3382/ps/pew105 - Conde-Aguilera JA, Cobo-Ortega C, Tesseraud S, et al. Changes in body composition in broilers by a sulfur amino acid deficiency during growth. Poultry Science 2013;92(5):1266-75. https://doi.org/10.3382/ps.2012-02796
» https://doi.org/10.3382/ps.2012-02796 - Del Vesco AP, Gasparino E, de Oliveira Grieser D, et al. Effects of methionine supplementation on the expression of oxidative stress-related genes in acute heat stress-exposed broilers. British Journal of Nutrition 2015;113(4):549-59. https://doi.org/10.1017/S0007114514003535
» https://doi.org/10.1017/S0007114514003535 - Elsharkawy MS, Chen Y, Liu R, et al. Paternal dietary methionine supplementation improves carcass traits and meat quality of chicken progeny. Animals 2021;28(11):325. https://doi.org/10.3390/ani11020325
» https://doi.org/10.3390/ani11020325 - Faraji M, Karimi Dehkordi S, Zamiani Moghadam AK, et al. Combined effects of guanidinoacetic acid, coenzyme Q10 and taurine on growth performance, gene expression and ascites mortality in broiler chickens. Journal of Animal Physiology and Animal Nutrition 2018; 103(1):162-9. https://doi.org/10.1111/jpn.13020
» https://doi.org/10.1111/jpn.13020 - Gasparino, E, Del Vesco AP, Khatlab AS, et al. Effects of methionine hydroxy analogue supplementation on the expression of antioxidant-related genes of acute heat stress-exposed broilers. Animal 2017;12(5):931-9. https://doi.org/10.1017/S1751731117002439
» https://doi.org/10.1017/S1751731117002439 - Golrokh AJ, Bouyeh M, Seidavi A, et al. Effect of different dietary levels of atorvastatin and L-carnitine on performance, carcass characteristics and plasma constitutes of broiler chickens. The Journal of Poultry Science 2016;53(3):201-7. https://doi.org/10.2141/jpsa.0150184
» https://doi.org/10.2141/jpsa.0150184 - Ighodaro OM, Akinloye OA. First line defence antioxidants-superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GPX): Their fundamental role in the entire antioxidant defence grid. Alexandria Journal of Medicine 2017;54(4). https://doi.org/10.1016/j.ajme.2017.09.001
» https://doi.org/10.1016/j.ajme.2017.09.001 - Jahanian R, Khalifeh-Gholi M. Marginal deficiencies of dietary arginine and methionine could suppress growth performance and immunological responses in broiler chickens. Journal of Animal Physiology and Animal Nutrition 2018;102:11-20. https://doi.org/10.1111/jpn.12695
» https://doi.org/10.1111/jpn.12695 - Korver DR, Klasing KC. Dietary fish oil alters specific and inflammatory immune responses in chicks. The Journal of Nutrition 1997;127(10):2039-46. https://doi.org/10.1093/jn/127.10.2039
» https://doi.org/10.1093/jn/127.10.2039 - Kreuz BS, Rocha GC, Campos PHRF, et al. Effects of dietary nucleotide supplementation on growth performance and physiology of broiler chickens under pre-and post-inflammatory challenge. Revista Brasileira de Zootecnia 2020;49:e20200117. https://doi.org/10.37496/rbz4920200117
» https://doi.org/10.37496/rbz4920200117 - Kruger WD. Cystathionine ?-synthase deficiency: Of mice and men. Molecular Genetics and Metabolism 2017;121(3):199-205. https://doi.org/10.1016/j.ymgme.2017.05.011
» https://doi.org/10.1016/j.ymgme.2017.05.011 - Lai A, Dong G, Song D, et al. Responses to dietary levels of methionine in broilers medicated or vaccinated against coccidia under Eimeria tenella-challenged condition. BMC Veterinary Research 2018;14:140. https://doi.org/10.1186/s12917-018-1470-8
» https://doi.org/10.1186/s12917-018-1470-8 - Li P, Yin Y-L, Li D, et al. Amino acids and immune function. British Journal of Nutrition 2007;98(2):237. https://doi.org/10.1017/s000711450769936x
» https://doi.org/10.1017/s000711450769936x - Li Q, Cui J, Fang C, et al. S-Adenosylmethionine attenuates oxidative stress and neuroinflammation induced by Amyloid-? through modulation of glutathione metabolism. Journal of Alzheimer's Disease 2017;58(2):549-58. https://doi.org/10.3233/JAD-170177
» https://doi.org/10.3233/JAD-170177 - Li Y, Zhang H, Chen YP, et al. Bacillus amyloliquefaciens supplementation alleviates immunological stress in lipopolysaccharide-challenged broilers at early age. Poult Sci. 2015;94(7):1504-11. https://doi.org/10.3382/ps/pev124
» https://doi.org/10.3382/ps/pev124 - Lieboldt MA, Frahm J, Halle I, et al. Metabolic and clinical response toEscherichia colilipopolysaccharide in layer pullets of different genetic backgrounds supplied with graded dietary L-arginine. Poultry Science 2016;95(3):595-611. http://dx.doi.org/10.3382/ps/pev359
» http://dx.doi.org/10.3382/ps/pev359 - Lisnahan CV, Nahak OR, Welsiliana W, et al. Effect of L-arginine and L-Lysine HCl ratio on growth performance and ileum morphology of native chickens aged 2-14 weeks. Veterinary World 2022;15(5):1365. https://doi.org/10.14202/vetworld.2022.1365-1372
» https://doi.org/10.14202/vetworld.2022.1365-1372 - Liu L, Shen J, Zhao C, et al. Dietary Astragalus polysaccharide alleviated immunological stress in broilers exposed to lipopolysaccharide. International Journal of Biological Macromolecules 2015;72:624-32. https://doi.org/ 10.1016/j.ijbiomac.2014.08.057
» https://doi.org/ - Liu M, Zhang Y, Cao KX, et al. Increased ingestion of hydroxy-methionine by both sows and piglets improves the ability of the progeny to counteract LPS-induced hepatic and splenic injury with potential regulation of TLR4 and NOD signaling. Antioxidants 2022;11(2):321. https://doi.org/10.3390/antiox11020321
» https://doi.org/10.3390/antiox11020321 - Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2-??CT. Methods 2001;4:1-408. https://doi.org/10.1006/meth.2001.1262
» https://doi.org/10.1006/meth.2001.1262 - Lu SC. Glutathione synthesis. Biochimica et Biophysica Acta (BBA) - General Subjects 2013;5:3143-53. https://doi.org/10.1016/j.bbagen.2012.09.008
» https://doi.org/10.1016/j.bbagen.2012.09.008 - Lugata K, Ortega ADSV, Szabó C. The role of methionine supplementation on oxidative stress and antioxidant status of poultry - a review. Agriculture 2022;12(10):1701. https://doi.org/10.3390/agriculture12101701
» https://doi.org/10.3390/agriculture12101701 - Maia RC, Albino LFT, Rostagno HS, et al. Low crude protein diets for broiler chickens aged 8 to 21 days should have a 50% essential-to-total nitrogen ratio. Animal Feed Science and Technology 2021;271:114709. https://doi.org/10.1016/j.anifeedsci.2020.114
» https://doi.org/10.1016/j.anifeedsci.2020.114 - Majdeddin M, Golian A, Kermanshahi H, et al. Effects of methionine and guanidinoacetic acid supplementation on performance and energy metabolites in breast muscle of male broiler chickens fed corn-soybean diets. British Poultry Science 2019;60:554-63. https://doi.org/10.1080/00071668.2019.1631447
» https://doi.org/10.1080/00071668.2019.1631447 - Martínez Y, Li X, Liu G, et al. The role of methionine on metabolism, oxidative stress, and diseases. Amino Acids 2017;49(12):2091-8. https://doi.org/10.1007/s00726-017-2494-2
» https://doi.org/10.1007/s00726-017-2494-2 - Mousavi SN, Afsar A, Lotfollahian H. Effects of guanidinoacetic acid supplementation to broiler diets with varying energy contents. The Journal of Applied Poultry Research 2013;22(1):47-54. https://doi.doi.org/10.3382/japr.2012-00575
» https://doi.doi.org/10.3382/japr.2012-00575 - Nawaz AH, Zhang L. Oxidative stress in broiler chicken and its consequences on meat quality. International Journal of Life Science Research Archive 2021;1(1):45-54. https://doi.org/10.53771/ijlsra.2021.1.1.0054
» https://doi.org/10.53771/ijlsra.2021.1.1.0054 - Nunes RA, Duarte M de S, Campos PHRF, et al. Active vitamin D3-glycoside preserves weight gain and modulates the inflammatory response in broiler chickens challenged with lipopolysaccharide. Animal Feed Science and Technology 2020;270:114704. https://doi.org/10.1016/j.anifeedsci.2020.114704
» https://doi.org/10.1016/j.anifeedsci.2020.114704 - Qiu W, Zhang X, Pang X, et al. Asiatic acid alleviates LPS-induced acute kidney injury in broilers by inhibiting oxidative stress and ferroptosis via activation of the Nrf2 pathway. Food and Chemical Toxicology 2022;170:113468. https://doi.org/10.1016/j.fct.2022.113468
» https://doi.org/10.1016/j.fct.2022.113468 - Ringseis R, Keller J, Eder K. Basic mechanisms of the regulation of L-carnitine status in monogastrics and efficacy of L-carnitine as a feed additive in pigs and poultry. Journal of Animal Physiology and Animal Nutrition 2018;102(6):1686-719. https://doi.org/10.1111/jpn.12959
» https://doi.org/10.1111/jpn.12959 - Rostagno HS, Albino LFT, Hannas MI, et al. Brazilian tables for poultry and swine: food composition and nutritional requirements. 4th ed. Viçosa: UFV; 2017.
- Roushdy EM, Zaglool AW, El-Tarabany MS. Effects of chronic thermal stress on growth performance, carcass traits, antioxidant indices and the expression of HSP70, growth hormone and superoxide dismutase genes in two broiler strains. Journal of Thermal Biology 2018;74:337-43. https://doi.org/10.1016/j.jtherbio.2018.04.00
» https://doi.org/10.1016/j.jtherbio.2018.04.00 - Savaram VRR, Mantena VLNR, Paul SS, et al. Enhancement of performance and anti-oxidant variables in broiler chicken fed diets containing sub-optimal methionine level with graded concentrations of sulphur and folic acid. Animal Bioscience 2022;35(5):721. https://doi.org/10.5713/ab.21.0258
» https://doi.org/10.5713/ab.21.0258 - Schallier S, Li C, Lesuisse J, et al. Dual-energy X-ray absorptiometry is a reliable non-invasive technique for determining whole body composition of chickens. Poultry Science 2019;98(1):1652-61. https://doi.org/10.3382/ps/pez013
» https://doi.org/10.3382/ps/pez013 - Song ZH, Cheng K, Zheng XC, et al. Effects of dietary supplementation with enzymatically treated Artemisia annua on growth performance, intestinal morphology, digestive enzyme activities, immunity, and antioxidant capacity of heat-stressed broilers. Poultry Science 2018;9(2):430-7. https://doi.doi.org/10.3382/ps/pex312
» https://doi.doi.org/10.3382/ps/pex312 - Star L, Rovers M, Corrent E, et al. Threonine requirement of broiler chickens during subclinical intestinal Clostridium infection. Poultry Science 2012;91(3):643-52. https://doi.org/10.3382/ps.2011-01923
» https://doi.org/10.3382/ps.2011-01923 - Sun B, Ma J, Zhang J, et al. Lycopene reduces the negative effects induced by lipopolysaccharide in breeding hens. British Poultry Science 2014;55(5):628-34. https://doi.org/10.1080/00071668.2014.956688
» https://doi.org/10.1080/00071668.2014.956688 - Wan J, Ding X, Wang J, et al. Dietary methionine source and level affect hepatic sulfur amino acid metabolism of broiler breeder hens. Animal Science Journal 2017;88(12):2016-24. https://doi.org/10.1111/asj.12882
» https://doi.org/10.1111/asj.12882 - Wang H, Yang F, Song ZW, et al. The influence of immune stress induced by Escherichia coli lipopolysaccharide on the pharmacokinetics of danofloxacin in broilers. Poultry Science 2022b;101(3):101629. https://doi.org/10.1016/j.psj.2021.101629
» https://doi.org/10.1016/j.psj.2021.101629 - Wang MY, Yin X, Yin D, et al. Antioxidant response and bioavailability of methionine hydroxy analog relative to DL-methionine in broiler chickens. Animal Nutrition 2019;5(3):241-7. https://doi.org/10.1016/j.aninu.2019.06.007
» https://doi.org/10.1016/j.aninu.2019.06.007 - Wang MY, Zhang Y, Tong YX, et al. Effects of lutein on jejunal mucosal barrier function and inflammatory responses in lipopolysaccharide-challenged yellow-feather broilers. Poultry science 2022a;101(12):102191. https://doi.org/10.1016/j.psj.2022.102191
» https://doi.org/10.1016/j.psj.2022.102191 - Wen C, Jiang XY, Ding LR, et al. Effects of dietary methionine on growth performance, meat quality and oxidative status of breast muscle in fast- and slow-growing broilers. Poultry Science 2016;432. https://doi.org/10.3382/ps/pew432
» https://doi.org/10.3382/ps/pew432 - Yang L, Liu G, Lian K, et al. Dietary leonurine hydrochloride supplementation attenuates lipopolysaccharide challenge-induced intestinal inflammation and barrier dysfunction by inhibiting the NF-?B/MAPK signalling pathway in broilers. Journal of Animal Science 2019;97(4):1679-92. https://doi.org/10.1093/jas/skz078
» https://doi.org/10.1093/jas/skz078 - Zhang C, Wang C, Chen K, et al. Effect of l-theanine on growth performance, intestinal development and health, and peptide and amino acid transporters expression of broilers. Journal of the Science of Food and Agriculture 2020;100(4):1718-25. https://doi.org/10.1002/jsfa.10192
» https://doi.org/10.1002/jsfa.10192 - Zhang H, Chen Y, Chen Y, et al. Dietary pterostilbene supplementation attenuates intestinal damage and immunological stress of broiler chickens challenged with lipopolysaccharide. Journal Animal Science 2019a; 98(1):skz373. https://doi.org/10.1093/jas/skz373
» https://doi.org/10.1093/jas/skz373 - Zhang X, Zhao L, Cao F, et al. Effects of feeding fermented Ginkgo biloba leaves on small intestinal morphology, absorption, and immunomodulation of early lipopolysaccharide-challenged chicks. Poultry Science 2013;92(1):119-30. https://doi.org/10.3382/ps.2012-02645
» https://doi.org/10.3382/ps.2012-02645 - Zhang Y, Xu BY, Zhao L, et al. Increased consumption of sulfur amino acids by both sows and piglets enhances the ability of the progeny to adverse effects induced by Lipopolysaccharide. Animals 2019b;29(9):1048. https://doi.org/10.3390/ani9121048
» https://doi.org/10.3390/ani9121048 - Zhou HY, Wu W-J, Xu Y-Y, et al. Calcium carbonate addition improves l-methionine biosynthesis by metabolically engineered Escherichia coli W3110-BL. Frontiers in Bioengineering and Biotechnology 2020;8. https://doi.org/10.3389/fbioe.2020.00300
» https://doi.org/10.3389/fbioe.2020.00300
-
Funding
This research did not receive funding from any financial agency or other sources. -
Data availability statement
The data will be available upon request.
Data availability
The data will be available upon request.
Publication Dates
-
Publication in this collection
30 Aug 2024 -
Date of issue
2024
History
-
Received
08 Feb 2024 -
Accepted
18 June 2024