Fishing for the gonadotropin releasing hormone from the genome of Salminus brasiliensis (Characiformes: Bryconidae)

Pescando o hormônio liberador de gonadotrofina do genoma de Salminus brasiliensis (Characiformes: Bryconidae)

Abstract

The technological development of tools that enable the spawning of different native species is paramount to enable ex situ conservation initiatives, as well as providing means for commercial hatchery of threatened fish which, in turn, relieve fisheries pressure over wild stocks. Neotropical migratory freshwater fish depend on hormonal induction for spawning in hatcheries, through expensive methods of limited efficiency. Salminus brasiliensis is one of the largest Neotropical freshwater fish, a piscivorous top-predator, prized in angling, highly valued in the market, and appreciated in gastronomy. Teleost fish have either, two or three GnRH paralogous genes: GnRH1, GnRH2 and the GnRH3. The expression products of these paralogous isoforms consist of a larger prepro-GnRH polypeptide, which undergoes post-translational proteolytic processing to yield the active decapeptide hormone. There is increasing interest in characterizing and understanding these neuropeptides, because of its practical application in hatchery spawning. We present the characterization of GnRH1’s coding sequence for the prepro-GnRH1 polypeptide of S. brasiliensis. An annotation from a genomic assembly was used for searching for GnRH paralogues, based on data from anonymous predicted transcripts. The sequence retrieved for GnRH1 was then used as a query for searching the uncharacterized GnRH paralogues from full genomes of Characiformes deposited at NCBI. The S. brasiliensis GnRH1 gene sequence retrieved was targeted for PCR and submitted to Sanger sequencing, allowing for its confirmation. It spans 423 bp (exon 1: 128 bp; intron: 161 bp; and exon 2: 1134 bp), with open reading frames coding for 264 and 88 amino acids, respectively. The different variants retrieved for the prepro-GnRH (1, 2 and 3) from Characiformes genomes and deposited sequences from NCBI grouped in three distinct clades in a neighbor joining tree, each forming a monophyletic branch and with the S. brasiliensis sequences nested within the expected groups. Here we observed a variation at a proteolytic site (GKR→GRR), reported as highly conserved in vertebrates up to now, that can potentially alter the cleavage site and modify the peptide topology. This work has characterized, for the first time, the sequence of the GnRH1 coding for its prepro-GnRH peptide, for a member of the Charaficormes order. This will help to promote research and development of tools for broodstock spawning and environmental management of S. brasiliensis and related migratory fish.

Keywords:
GnRH1; conservation; aquaculture; bioinformatics; genomics

Resumo

O desenvolvimento tecnológico de ferramentas que possibilitem a reprodução de diferentes espécies nativas é fundamental para viabilizar iniciativas de conservação ex situ, bem como fornecer meios para produção comercial de peixes ameaçados que, por sua vez, aliviam a pressão pesqueira sobre os estoques selvagens. Peixes migratórios de água doce Neotropicais dependem de indução hormonal para desova em pisciculturas, com métodos caros e de eficiência limitada. Salminus brasiliensis é um dos maiores peixes de água doce Neotropicais, predador de topo piscívoro, admirado na pesca esportiva, muito valorizado no mercado e apreciado na gastronomia. O hormônio liberador de gonadotrofina (GnRH) é uma molécula-chave na reprodução em todos os vertebrados. Os peixes teleósteos possuem dois ou três genes parálogos de GnRH: GnRH1, GnRH2 e GnRH3. Os produtos de expressão gênica dessas isoformas parálogas consistem em um polipeptídeo maior, pré-pró-GnRH, que sofre processamento proteolítico pós-traducional para produzir o hormônio decapeptídeo ativo. Há um interesse crescente na caracterização e compreensão desses neuropeptídeos, devido à sua aplicação prática na reprodução em pisciculturas. Aqui apresentamos a caracterização da sequência codificadora de GnRH1 para o polipeptídeo pré-pŕo-GnRH1 de S. brasiliensis. Uma anotação de montagem genômica foi usada para procurar parálogos de GnRH, com base em dados de transcritos anônimos preditos em um arquivo de anotação gênica. A sequência recuperada para GnRH1 foi então usada como argumento de busca para procura de parálogos não caracterizados de GnRH, a partir de genomas completos de Characiformes depositados no NCBI. A sequência recuperada de S. brasiliensis do gene GnRH1 foi alvo de PCR e submetida ao sequenciamento Sanger, permitindo a sua confirmação. Esta abrange 423 pb (éxon 1: 128 pb; íntron: 161 pb; éxon 2: 134 pb), com janelas abertas de leitura que codificam para 264 e 88 aminoácidos, respectivamente. As diferentes variantes do pré-pró-GnRH (1, 2 e 3) recuperadas dos genomas completos e sequências depositadas de Characiformes no NCBI agruparam-se em três clados distintos, numa árvore de neighbour joining, cada um formando um ramo monofilético e com as sequências de S. brasiliensis aninhadas dentro dos grupos esperados. Aqui observamos uma variação em um sítio proteolítico (GKR→GRR), até então relatado como altamente conservado em vertebrados, que pode potencialmente alterar o sítio de clivagem e modificar a topologia do peptídeo. Este trabalho caracteriza, pela primeira vez, a sequência do gene GnRH1 que codifica para o peptídeo pré-pró-GnRH1, para um membro da ordem Characiformes. Isto ajudará a promover a pesquisa e o desenvolvimento de ferramentas para a reprodução em piscicultura e a gestão ambiental de S. brasiliensis e outros peixes migratórios relacionados.

Palavras-chave:
GnRH1; conservação; aquicultura; bioinformática; genômica

1. Introduction

The Neotropical migratory ichthyofauna from the Southern Cone is heavily impacted by pollution, basin and water bodies degradation, invasive species (Bueno et al., 2021), the intensive exploitation of rivers (Ferreira et al., 2023), the growth of the human population and the increase in industrial and agricultural activities, and mainly through means of hydroelectric dams (Brito-Santos et al., 2021; Gonçalves et al., 2006). Peculiarly, fish can be dichotomically viewed by some stakeholders only as food or considered by others as integral components of the ecosystems, in need of conservation (Cowx et al., 2010; Blanchard et al., 2014; Erisman et al., 2015), which perform valuable and yet largely unmeasured ecosystems services in multiple levels (Pelicice et al., 2023).

The technological development of tools for spawning its different species is paramount to warrant efficient ex situ conservation initiatives, as well as providing means for commercial hatchery of native fish. This, in turn, may relieve fisheries pressure over wild extant stocks (Bogmans and van Soest, 2022) and may help in bridging these two notions, apparently at odds, but which are inextricable poles of a singular integrated issue.

Aquaculture and fisheries accounted for almost 20% of global animal protein production in 2018 and must advance further still to aid in sustaining the ever growing human demographics (Eilert, 2020) and its increasing demands for fish products (Boyd et al., 2022). Fisheries is one of the areas in animal protein production contributing the most to food security (Naylor et al., 2021) and, despite a recent steep upward slope in hatchery production in Brazil, yielding a total of 860,355 tons in 2022 (PEIXE BR, 2023), the native Neotropical species respond only to ~31% of this biomass. Among more than 3,130 known species of Neotropical freshwater fish (Reis et al., 2016), many possess a still virtually untapped potential for aquaculture and many obstacles still remain regarding the conservation of Neotropical fish, including the need for more research funding, the development of technological packages for hatcheries and more efficient governmental policies and enforcement.

South American aquaculture still underperforms in the production of several migratory species with much potential, such as Brycon spp., Leporinus spp. and Prochilodus spp, which are more prominent in fisheries (Valenti et al., 2021). This is, in part, explained because these species rely on a characteristic long and intense seasonal upstream run to reach sexual maturity. Due to a lack of conspicuous natural triggers, such as the absence of migratory and environmental cues, potamodromous Neotropical fish depend on artificial induction for spawning in captivity. Thus, the efficient control over reproductive processes in hatcheries is essential for sustaining both, commercial or environmentally oriented activities, including spawning, trade and ex situ conservation for the mitigation of environmental impacts, through means of soundly informed, goal oriented fish stocking and repopulation initiatives.

Among the South American fish fauna, Salminus brasiliensis Cuvier, 1816 (Characiformes: Bryconidae – Abe et al., 2014) is particularly important, due to its poor conservation status, public notoriety and potential as flagship species (Cao et al., 2016; Dias et al., 2022; Graciano et al., 2022). S. brasiliensis is one of the largest Neotropical freshwater fish and a piscivorous top-predator, thus making it an important actor in top-down community structure determination. Males can reach up to 5 kg and females have been recorded weighing up to 26 kg (Della Flora et al., 2010). This species is relevant in commercial and small scale fisheries (Peixer and Petrere Júnior, 2009) in the It is also a prized angling sports asset, due to its aggressive behavior (Sanches and Piana, 2020) and also highly valued commercially for gastronomy (Rueda et al., 2011; Zaniboni-Filho et al., 2017).

The gonadotropin-releasing hormone (GnRH) is a key molecule in reproductive development and regulation in all vertebrates (Casteel and Singh, 2020). In its active form, it is a neuropeptide consisting of 10 amino acid residues, produced in the hypothalamus, and which triggers a cascade of hormones among the hypothalamic-pituitary-gonadal axis, and coordinates gonadal development and maturation in vertebrates (Zohar et al., 2010), through the release of the follicle-stimulating and Luteinizing hormones (FSH and LH).

It has been determined that teleost fish have either, two or three GnRH paralogous isoform genes (GnRH1, GnRH2, and GnRH3 - Carolsfeld et al., 2000). It is suggested that the emergence of the three GnRH paralogues was the result of at least two independent whole genome duplication events (1R and 2R) by auto- and allo-tetraploidization (Simakov et al., 2020), which occurred early during vertebrate evolution, and were followed by two separate deletion events (Kim et al., 2011, Tostivint, 2011, Roch et al., 2014).

There are still gaps in a deeper understanding of the specific function of these isoforms, but it is known that they are implicated in the control of reproductive function and behavior. According to Okubo and Nagahama (2008), GnRH1 is the paralogous isoform mainly expressed in the hypothalamus, directly associated with reproduction and it’s essential for stimulating the synthesis of gonadotropins. Gonzalez-Martinez et al. (2004) presented evidence that demonstrates that the hypothalamic neurons responsible for synthesizing the GnRH1 molecule are the main source of hypophysarian innervation, making a strong case for this hormone being a main trigger for gonadotropin secretion. The GnRH2 gene is expressed in the integument of the midbrain, associated with the modulation of melatonin synthesis. This gene is present in almost all vertebrate species studied to date, and is the only GnRH isoform with a highly conserved structure. It is believed to assume the role of GnRH1 in fish that lack this paralogue, such as some studied Osteoglossiformes (Ogawa et al., 2022). Finally, the GnRH3 gene is implicated in the neuromodulation of reproductive behavior. It’s the only paralogue which has originally been described exclusively in teleost fishes (Okubo and Nagahama, 2008; Kim et al., 2011) and it also has been shown to occur in lampreys (Smith et al., 2013).

There is increasing scientific interest in characterizing and understanding these genes and its hormones, as fish provide convenient models for evolution and physiology in vertebrates, as well as because of its practical application in hatchery spawning. The gene expression products of these paralogues consist of a larger prepro-GnRH polypeptide, which undergoes post-translational proteolytic processing to yield the biologically active decapeptide hormone. It includes a signal peptide, the GnRH neuropeptide and the GAP (GnRH-Associated Peptide). The GnRH paralogues have 4 exons and 3 introns: exon 1 comprises a 5'-untranslated region (5'-UTR), which assists in mRNA stability; exon 2 encodes the N-terminus of the prepro-GnRH polypeptide, including a signal peptide, the GnRH decapeptide, a conserved proteolytic cleavage site and the N-terminus of the GAP; while exon 3 encodes most of the GAP; and exon 4 encodes the C-terminus of the GAP and a 3′-UTR fraction of the mRNA (Okubo and Nagahama, 2008). The enzymes responsible for converting preproteins into fully functional proteins are prohormone-converting enzymes (PCs), a family of enzymes that have a conserved structure but perform different functions. Among them, the PC1/3 and PC2 enzymes are present exclusively in neuroendocrine cells and are responsible for cleaving prohormones, such as prepro-GnRH. Studies show that PC1/3 is crucial for processing GnRH (Ramzy and Kieffer, 2022).

Advancements in the understanding of the reproductive physiology and modes of action of GnRH molecules in fish have led to its practical use in aquaculture (Zohar et al., 2022). Yet, previous studies have demonstrated that the effects of synthetic hormones in Neotropical fish spawning are still poorly understood, making it particularly important to perform in vivo assays with its alternative forms, due to the varying degrees of success according to isoform and targeted species (e.g. Acuña and Rangel, 2009; Paulino et al., 2011; Viveiros et al., 2013; Souza et al., 2018, 2020).

Paulino et al. (2011) reported that buserelin, an analogous of the GnRH hormone, was effective in leading to sperm and eggs formation in characin migratory Neotropical species, such as Brycon orbignyanus, although it did not result in larvae formation following fertilization. This led to the proposition that analogue-GnRH could potentially replace currently used protocols, which normally employ the common carp (Cyprinus carpio) whole pituitary extract (e.g.Ganeco et al., 2009) for artificial spawning induction. It is still necessary, though, to empirically determine optimal dosages and administration intervals for this goal.

Despite the great potential of GnRH neuropeptides in aquaculture, and their importance as markers for phylogenetic analyses that seek to understand the evolutionary history of species (Kavanaugh et al., 2008; Silver et al., 2004), very few Neotropical fish species have had the molecular characterization of the paralogues present in their genomes and its related expression products. To date, only one study has characterized the sequences of the prepro-GnRH2 and prepro-GnRH3 present in a species of the Characiformes order, Astyanax altiparanae (Chehade et al., 2020). Thus, there is no characterization for the GnRH1 gene or its respective prepro-GnRH for this order, so far.

Aiming to expand on the knowledge about the reproductive mechanisms of Neotropical migratory fish and to facilitate the development of biotechnological solutions for aquaculture of Neotropical migratory fish, we here present the first primary structure characterization of the coding sequence for prepro-GnRH1 from the GnRH1 gene, for S. brasiliensis.

2. Material and Methods

2.1. Initial NGS characterization and in silico analyses of GnRH genes in S. brasiliensis

We departed from the 15X-coverage genomic assembly (from short Illumina reads) presented in Graciano et al. (2022), for predicting paralogue GnRH genes. A recently available S. brasiliensis chromosome level assembly deposited at NCBI’s Genome database [accession: SAMN35075251] was also used to perform independent searches and corroborate results. Due to the absence of characterized prepro-GnRH1 for Characiformes in the literature and databanks, the coding sequence of prepro-GnRH1 was predicted here, using the results of the genomic assembly annotation, previously performed via MAKER (Graciano et al., 2022). Each of the 12,962 predicted coding sequences, from the annotation’s general feature file, was used as a query to BLAST the Ostariophysi superorder of fish, from the database available on NCBI. Then we used the identified prepro-GnRH sequence as bait, to fetch related sequences for Characiformes fish with complete genomes available in NCBI, using Translated BLAST (tblastn).

The retrieved sequences (Table 1) were submitted to a multiple alignment of paralogues determined for Characiformes fish (prepro-GnRH1, prepro-GnRH2 and prepro-GnRH3), using the Ciona intestinalis (vase tunicate) corresponding sequence as outgroup, using the ClustalW software. Non-aligning sequence extremities were trimmed and this was used for building a neighbor-joining tree, with 1,000 bootstrap resampling replicates, using the JTT matrix-based model (Jones et al., 1992). The rate variation between sites was modeled with a gamma distribution (shape parameter=1). All ambiguous positions were removed for each pair of sequences (pairwise deletion option). These analyses were carried out in MEGA X (Kumar et al., 2018). Coding sequences were verified with the web tool Expasy. Signal peptides were searched with the aid of SignalP-6.0 (Teufel et al., 2022) and the ProP-1.0 software (Duckert et al., 2004) was used for predicting potential cleavage sites residues within the preproteins and to perform a general PC prediction.

Table 1
List of retrieved sequences for GnRH gene paralogs (GnRH1, GnRH2 and GnRH3) deposited in NCBI for fish species of the order Characiformes and the sequence used as an outgroup.

Sequence ID	Paralogs	Specie
XP_007256597.1	GnRH2	Astyanax mexicanus
XP_017580723.1	GnRH2	Pygocentrus nattereri
ALA56112.1	GnRH2	Astyanax altiparanae
XP_036444052.1	GnRH2	Colossoma macropomum
XP_007259010.1	GnRH3	Astyanax mexicanus
XP_017564270.1	GnRH3	Pygocentrus_nattereri
ALA56113.1	GnRH3	Astyanax altiparanae
XP_036449403.1	GnRH3	Colossoma macropomum
NP_001034971.1	GnRH-Like	Ciona intestinalis

2.2. PCR and Sanger sequencing of predicted genes

The characterized coding sequence for prepro-GnRH1 isoform was directly targeted for Sanger sequencing of its PCR product. Oligonucleotides were designed with the aid of the Primer Blast Tool. This allowed for the narrowing of new nucleotide sequences for the target-species. PCR conditions were 0.25 mM of dNTP, 0.4 mM of each primer and 1.5 u of Taq DNA polymerase, 1x IVB buffer (Phoneutria – Belo Horizonte, Brazil), using chelex extracted DNA. PCR products were verified in 10% polyacrylamide gel electrophoresis for expected size, with the aid of a DNA ladder (100 pb) and then purified for bidirectional Sanger sequencing, by a service provider. The sequencing product was then checked, trimmed for quality and a consensus sequence constructed using BioEdit 7.2 software, and subsequently aligned with the sequences in Table 1 using ClustalW .

3. Results

3.1. GnRH genes characterization in S. brasiliensis

A coding sequence for a prepro-GnRH was detected in the genomic assembly annotation (Figshare, 2024), originally presented in Graciano et al. (2022). This annotated sequence for GnRH bears the code for the bioactive decapeptide initially described in the seabream fish (Sparus aurata; sbGnRH), later classified as GnRH1 by White et al. (1994). This allowed for the classification of this sequence as being from the GnRH1 gene from S. brasiliensis.

The scaffold bearing the sequence for GnRH1 in the genomic assembly (scaffold 50296 5.4) was visually inspected, using the available BAM file (NLM, 2024), which maps the Illumina short reads back to it. This region presented average coverage of 11.7x, minimum coverage at a depth of 4x and maximum coverage at a depth of 24x, with an average quality value of Q=30. This region was assembled from 70 reads and no gaps were observed in the region where the gene of interest was annotated in the genomic assembly. It spans 423 bp, encompassing two exons: one with 128 bp and the other with 134 bp, separated by one intron 161 bp long. Out of the four expected exons from GnRH, we recovered only exons 2 and 3 for the prepro-GnRH. The determined prepro-GnRH1 sequence has 264 bp and codes for a protein with 87 amino acids, including a signal peptide 21 residues long (Figure 1), and the bioactive decapeptide domain (positions 22-31) with the following sequence: Gln-His-Trp-Ser-Tyr-Gly-Leu-Ser-Pro-Gly (QHWSYGLSPG). This is normally followed by a highly conserved cleavage site: Gly-Lys-Arg (GKR). Here we have observed an amino acid substitution in the second residue from lysine (K) → arginine (R). According to the preprotein convertase cleavage sites prediction analysis, the conserved GKR proteolytic site targeted by the PC enzyme occurs on the right-hand side (C-terminal direction) past the Arg residue (Score: 0.734), resulting in the final tridecapeptide: QHWSYGLSPGGKR. The same analysis was unable to identify the preprotein cleavage site with high confidence in the GRR proteolytic motif, although it points to cleavage possibly occurring past the first Arg residue (Score: 0.070) or, with greater probability, at the second Arg residue (Score: 0.337), also resulting in a tridecapeptide: QHWSYGLSPGGRR.

Figure 1
Characterization of the signal peptide in partial sequences for prepro-GnRH1 according to SignalP (99.99% probability). Sec/SPI (Secreted Signal Peptide), the N-terminal region (Sec/SPI in, red), hydrophobic central region (Sec/SPI h, orange), the C-termini of the signal peptide (Sec/SPI c, in yellow), along the cleavage site (intermittent red line), and cleavage site (CS, green dashed line).

It was possible to recover the target sequence, prepro-GnRH1, in four out of the ten Characiform genomes currently available: Megaleporinus macrocephalus with 73.08%, Colossoma macropomum with 73.91%, Piaractus mesopotamicus with 76.09% and the recently deposited NCBI genome for S. brasiliensis with 95.65% identity. Following sequence alignment, timing and pairwise deletion, there were a total of 125 positions in the final data set (Figure 2). It was possible to confirm the variation at the cleavage site in the prepro-GnRH found here, also present in the remaining Characiformes species recovered with BLAST. The phylogenetic analysis revealed that different paralogues of GnRH (1, 2 and 3) each formed a monophyletic clade, along the prepro-GnRH1 from S. brasiliensis nested within other prepro-GnRH1 orthologues (Figure 3).

Figure 2
Amino acid sequence alignment of prepro-GnRH for S. brasiliensis along sequences retrieved from GenBank for other species of Characiformes. The bioactive decapeptide is highlighted in yellow.

Figure 3
Phylogenetic tree of prepro-GnRH1, prepro-GnRH2 and prepro-GnRH3 sequences from the Order Characiformes. Bootstrap values (%) are given for each node. The prepro-GnRH1 for S. brasiliensis is marked with an arrow.

3.2. PCR and Sanger sequencing of predicted genes

The flanking regions for the predicted 441 bp of the prepro-GnRH1 sequence were targeted for primer design (Table 2), which led to the amplification of bands of expected size (~400 bp) in different S. brasiliensis individuals (Figure 4). These products were submitted to Sanger DNA sequencing and the resulting consensus of forward and reverse reads confirmed a 423 bp long sequence, including one exon with 128 bp; one intron 161 bp long; and another exon with 134 bp. Its open reading frames code for 264 bp and 88 amino acids, respectively. The lysine to arginine variation in the second residue of the proteolytic site was also confirmed in the Sanger sequenced amplicons. The Lys/K → Arg/R change in the second amino acid residue of the proteolytic site was also observed within the sequenced amplicon.

Table 2
Designed primer sequences aiming for a PCR product of 441 bp for the prepro-GnRH1 in S. brasiliensis.

	Sequence (5'-3')	Size (bp)	Annealing temperature (Cº)	CG content (%)
Forward primer	ATCCATAATTCCATACCCACCAACA	25	60.10	40.00
Reverse primer	CGGCTGATTTCTGTTGATCTTGT	23	59.56	43.48

Figure 4
PCR amplification assay of the targeted GnRH1 sequence from the genome of five individuals of S. brasiliensis (channels: 1, 2, 3, 4, 5). Including a negative control (C-) and 100pb ladder (L).

4. Discussion

According to FAO (2022), Brazil was the main freshwater fish producer in the Americas in 2020, yielding 629 thousand tons. Many fish from the Characiformes order are of medium or large size, and are among the native species most reared in South America. This order has 24 families, with around 520 genera and more than 2,300 species (Nelson et al., 2016).

While presenting potential for aquaculture, information on the primary molecular structure of prepro-GnRH paralogues is still scarce for this order. Chehade et al. (2020) had previously described the molecular sequence for prepro-GnRH2 and prepro-GnRH3 for Astyanax altiparanae, from the order Characiformes. Thus, here we delivered the first description of prepro-GnRH1 from a member of the order Characiformes, in an important fish, S. brasiliensis, with a pressing need for development in the blue biotechnology arena (i.e. technology for aquaculture).

Takahashi et al. (2016) resorted to gene knock-out for GnRH1 in the teleost fish medaka (Oryzias latipes) in order to elucidate its effects on fertility. Its function loss did not affect spermatogenesis or folliculogenesis, but completely inhibited ovulation and spawning, evidencing its role and potential for biotechnological application, given the need for cost-effective means for reproductive induction in migratory fish hatchery stations for a number of economic and ecologically important species.

The sequence for the prepro-GnRH1 was anonymously present in the general feature file from the annotation performed over the genomic assembly of S. brasiliensis, in the form of a non-identified predicted coding sequence transcript. The scrutiny of each of the almost 13,000 predicted genes in this annotation allowed for its identification among the genomic assembly. The identified scaffold within the genomic assembly which bears the GnRH1 of S. brasiliensis was considered of very good quality, due to the redundancy in short reads mapping back to it, which was independently confirmed by Sanger sequencing.

This annotated predicted transcript bears only two out of four exons expected of a GnRH gene, which were here identified as exons 3 and 4, which code for almost the integrity of the prepro-GnRH polypeptide. Exon 1 contains an untranslated extremity, believed to stabilize the primary transcript and so does exon 4, along with a short part of the GAP. According to Zohar et al. (2010), analyses of GnRH gene sequences from different species have shown that the coding regions are relatively conserved, while the flanking and intronic regions strongly diverge. This probably hindered the originally employed MAKER pipeline to determine exons 1 and 4 in the annotated predicted transcript. We here raise the possibility this extra GAP portion in exon 4 could be the subtract for alternative splicing of transcripts leading to unique terminus GAP (with the same coded active decapeptides in the different prepro-GnRHs), as it has been described in GnRH2 from eels (Feng et al., 2018).

Lethimonier et al. (2004) evaluated evolutionary aspects of GnRH genes in teleost fishes, when the sequences of paralogues GnRH1, GnRH2 and GnrH3 were studied, along its respective prepro-GnRH isoforms: tripartite peptides, consisting of a signal peptide (20-25 residues), followed by the active decapeptide (GnRH), a proteolytic site of three amino acids and, finally, the GAP (GnRH Associated Peptide, 40-50 residues). The size of each region of the prepro-GnRH observed here is following the previously described in the literature for that group.

Here, nevertheless, we observed, for the first time, a variation in the second position of the proteolytic site, previously reported as highly conserved, Gly-Lys-Arg (GKR) (Lethimonier et al., 2004; Okubo and Nagahama, 2008; Bigot et al., 2012; Gaillard et al., 2018; Chehade et al., 2020; Muñoz-Cueto et al., 2020), which can alter the cleavage site and alter the peptide topology. The variation in a proteolytic cleavage site between the neuropeptide and the GAP. There is a substitution for another arginine over the lysine residue. This discovery can be relevant in future studies aiming the obtention of heterologous expression of GnRH1 for practical use in hatcheries and reveals an apparent molecular synapomorphy for the Characiformes. Several peptides are synthesized as larger, inactive precursors, usually in the form of preproteins, such as prepro-GnRH, which are post-translationally modified to generate the bioactive molecule. While the signal peptide may direct the precursor to a specific cellular compartment, the pro-domains can have other numerous functions. Some pro-domains are responsible for mediating the protein folding process, transport and localization, oligomerization and activity regulation (Duckert et al., 2004). The proteolytic site usually has multiple arginine or lysine residues, and the cleavage process takes place by endoproteolysis in this region (Duckert et al., 2004). The post-translational processing by endoproteolysis is part of regulatory mechanisms that allow organisms to control end-product concentration and the formation of multiple molecules from a single precursor polypeptide.

Regarding the bioactive portion of the prepro-GnRH polypeptide, there is a 100% concordance in the decapeptide sequence with all prepro-GnRH1 analyzed herein, while the signal peptide and the GAP displayed some variation, which could reflect the differential evolutionary pressures over different regions of the initial protein product. The tenacious conservation of the decapeptide is due to low tolerance for structural variation, in face of such important function (Okubo and Nagahama, 2008).

More than half of the 88 amino acids that form the prepro-GnRH polypeptide consist of the GAP portion, which still has an elusive function. In S. brasiliensis, the GAP has 53 amino acids (residues 35 to 88) and shows agreement with the estimated GAP length for sbGnRH1, 40-96 amino acid residues (Kim et al., 2012), closely related to the GnRH1 characterized here, with 100% identity for its bioactive domain. This first description presented here of a prepro-GnRH1 for the order Characiformes can contribute to studies aiming to understand the role of GAP in physiological modulation and migratory behavior, gonadal development and spawning. Nikolics et al. (1985) performed in vitro assays using rat pituitary cells where the GAP showed intense inhibitory action for prolactin secretion (up to 45%) and resulted in the release of the FSH and LH gonadotropins, while Onuma et al. (2010) pointed to a putative role of prolactin in the initial migratory behavior of salmon (Oncorhynchus keta). In eels (Anguilla japonica), prolactin expression decreases following reproductive development, during downstream migration (San Han et al., 2003). Nevertheless, Nocillado et al. (2022) suggested that the GAP is an accessory sequence, and non-essential for the decapeptide activity, but which could contribute to gonadal development and other reproductive functions and behavior.

The results presented here can be used to facilitate the new development of expression systems, as well as the development of studies that seek to elucidate the structure of this neurohormone and its interaction with GnRH receptors present in the genome of different species. We hope it will help to promote the availability of tools for the reproductive management of broodstock in S. brasiliensis and related migratory fish, due to their characteristic lack of spontaneous spawning capacity in hatchery environments.

Acknowledgements

We would like to thank CAPES (code 001) for a PhD scholarship to RCDG, CEMIG Peixe Vivo, FAPEMIG and CNPq for a fellowship in technological development for GMY (308124/2020-0). We also would like to thank Dr Ralph Gruppi Thomé and Dr Marina Quadrio R.B. Rodrigues for assistance during this work.

References

• ABE, K.T., MARIGUELA, T.C., AVELINO, G.S., FORESTI, F. and OLIVEIRA, C., 2014. Systematic and historical biogeography of the Bryconidae (Ostariophysi: Characiformes) suggesting a new rearrangement of its genera and an old origin of Mesoamerican ichthyofauna. BMC Evolutionary Biology, vol. 14, no. 1, pp. 152. http://doi.org/10.1186/1471-2148-14-152 PMid:25005252.
  » http://doi.org/10.1186/1471-2148-14-152
• ACUÑA, J. J. A. and RANGEL, J.L.H., 2009. Effects of hypophyseal extract of common carp and the analogue of the GnRH on the final maturation oocyte and the spawning of cachama negra (Colossoma macropomum). Revista Científica, vol. 19, pp. 486-494.
• ASSOCIAÇÃO BRASILEIRO DA PISCICULTURA – PEIXE BR, 2023 [viewed 30 September 2024]. Anuário brasileiro da piscicultura [online]. Available from: https://www.peixebr.com.br/anuario
  » https://www.peixebr.com.br/anuario
• BIGOT, L., ZATYLNY-GAUDIN, C., RODET, F., BERNAY, B., BOUDRY, P. and FAVREL, P., 2012. Characterization of GnRH-related peptides from the Pacific oyster Crassostrea gigas Peptides, vol. 34, no. 2, pp. 303-310. http://doi.org/10.1016/j.peptides.2012.01.017
  » http://doi.org/10.1016/j.peptides.2012.01.017
• BLANCHARD, J.L., ANDERSEN, K.H., SCOTT, F., HINTZEN, N.T., PIET, G. and JENNINGS, S., 2014. Evaluating targets and trade‐offs among fisheries and conservation objectives using a multispecies size spectrum model. Journal of Applied Ecology, vol. 51, no. 3, pp. 612-622. http://doi.org/10.1111/1365-2664.12238
  » http://doi.org/10.1111/1365-2664.12238
• BOGMANS, C.W.J. and VAN SOEST, D., 2022. Can global aquaculture growth help to conserve wild fish stocks? Theory and empirical analysis. Natural Resource Modeling, vol. 35, no. 1, e12323. http://doi.org/10.1111/nrm.12323
  » http://doi.org/10.1111/nrm.12323
• BOYD, C.E., MCNEVIN, A.A. and DAVIS, R.P., 2022. The contribution of fisheries and aquaculture to the global protein supply. Food Security, vol. 14, no. 3, pp. 805-827. http://doi.org/10.1007/s12571-021-01246-9 PMid:35075379.
  » http://doi.org/10.1007/s12571-021-01246-9
• BRITO-SANTOS, J.L., DIAS-SILVA, K., BRASIL, L.S., SILVA, J.B., SANTOS, A.M., SOUSA, L.M. and VIEIRA, T.B., 2021. Fishway in hydropower dams: a scientometric analysis. Environmental Monitoring and Assessment, vol. 193, no. 11, pp. 752. http://doi.org/10.1007/s10661-021-09360-z PMid:34709469.
  » http://doi.org/10.1007/s10661-021-09360-z
• BUENO, M.L., MAGALHAES, A.L.B., ANDRADE NETO, F.R., ALVES, C.B.M., ROSA, D.D.M., JUNQUEIRA, N.T., PESSALI, T.C., POMPEU, P.S. and ZENNI, R.D., 2021. Alien fish fauna of southeastern Brazil: species status, introduction pathways, distribution and impacts. Biological Invasions, vol. 23, no. 10, pp. 3021-3034. http://doi.org/10.1007/s10530-021-02564-x
  » http://doi.org/10.1007/s10530-021-02564-x
• CAO, Y.-L., CAPUTO, L.I., CHENG, H., DA SILVA CARMO, F.M., DE CARVALHO, L.C., DE MENEZES YAZBECK, G., OLIVEIRA TEIXEIRA, Z., FU, J., GUERRERO, J.A., HU, G., LI, J., LIN, Z., LIU, C., LIU, Y.-G., LIU, L.-X., LU, F., MAO, Y., MONTES-CARRETO, L.M., MORENO SANTILLÁN, D.D., ORTEGA, J., OUYANG, S., PAN, L., QIN, Y., RIZO-AGUILAR, A., SUN, T.-T., WU, X.-P., YANG, W., ZANATTA, D.T., ZHANG, G., ZHANG, R., ZHENG, R. and ZHOU, C.-H., 2016. Microsatellite records for volume 8, issue 3. Conservation Genetics Resources, vol. 8, no. 3, pp. 359-370. http://doi.org/10.1007/s12686-016-0581-4
  » http://doi.org/10.1007/s12686-016-0581-4
• CAROLSFELD, J., POWELL, J.F., PARK, M., FISCHER, W.H., CRAIG, A.G., CHANG, J.P., RIVIER, J.E. and SHERWOOD, N.M., 2000. Primary structure and function of three gonadotropin-releasing hormones, including a novel form, from an ancient teleost, herring. Endocrinology, vol. 141, no. 2, pp. 505-512. http://doi.org/10.1210/endo.141.2.7300 PMid:10650929.
  » http://doi.org/10.1210/endo.141.2.7300
• CASTEEL, C. O. and SINGH, G., 2020. Physiology, gonadotropin-releasing hormone. Treasure Island: StatPearls Publishing. PMid:32644418.
• CHEHADE, C., AMARAL, F.G., BRANCO, G.S., CASSEL, M., JESUS, L.W., COSTA, F.G. and BORELLA, M.I., 2020. Molecular characterization of different preproGnRHs in Astyanax altiparanae (Characiformes): effects of GnRH on female reproduction. Molecular Reproduction and Development, vol. 87, no. 6, pp. 720-734. http://doi.org/10.1002/mrd.23351
  » http://doi.org/10.1002/mrd.23351
• COWX, I.G., ARLINGHAUS, R. and COOKE, S.J., 2010. Harmonizing recreational fisheries and conservation objectives for aquatic biodiversity in inland waters. Journal of Fish Biology, vol. 76, no. 9, pp. 2194-2215. http://doi.org/10.1111/j.1095-8649.2010.02686.x PMid:20557659.
  » http://doi.org/10.1111/j.1095-8649.2010.02686.x
• DELLA FLORA, M.A., MASCHKE, F., FERREIRA, C.C. and ARAÚJO PEDRON, F., 2010. Biologia e cultivo do dourado (Salminus brasiliensis). Acta Veterinaria Brasilica, vol. 4, no. 1, pp. 7-14.
• DIAS, R.M., PELÁEZ, O., LOPES, T.M., OLIVEIRA, A.G.D., ANGULO-VALENCIA, M.A. and AGOSTINHO, A.A., 2022. Importance of protection strategies in the conservation of the flagship species “dourado” Salminus brasiliensis (Characiformes: bryconidae). Neotropical Ichthyology, vol. 20, no. 4, e220046. http://doi.org/10.1590/1982-0224-2022-0046
  » http://doi.org/10.1590/1982-0224-2022-0046
• DUCKERT, P., BRUNAK, S. and BLOM, N., 2004. Prediction of proprotein convertase cleavage sites. Protein Engineering, Design & Selection, vol. 17, no. 1, pp. 107-112. http://doi.org/10.1093/protein/gzh013 PMid:14985543.
  » http://doi.org/10.1093/protein/gzh013
• EILERT, S.J., 2020. The future of animal protein: feeding a hungry world. Animal Frontiers, vol. 10, no. 4, pp. 5-6. http://doi.org/10.1093/af/vfaa033 PMid:33150005.
  » http://doi.org/10.1093/af/vfaa033
• ERISMAN, B., MASCAREÑAS-OSORIO, I., LÓPEZ-SÁGASTEGUI, C., MORENO-BÁEZ, M., JIMÉNEZ-ESQUIVEL, V. and ABURTO-OROPEZA, O., 2015. A comparison of fishing activities between two coastal communities within a biosphere reserve in the Upper Gulf of California. Fisheries Research, vol. 164, pp. 254-265. http://doi.org/10.1016/j.fishres.2014.12.011
  » http://doi.org/10.1016/j.fishres.2014.12.011
• FENG, K., LUO, H., HOU, M., LI, Y., CHEN, J., ZHU, Z. and HU, W., 2018. Alternative splicing of GnRH2 and GnRH2-associated peptide plays roles in gonadal differentiation of the rice field eel, Monopterus albus General and Comparative Endocrinology, vol. 267, pp. 9-17. http://doi.org/10.1016/j.ygcen.2018.05.021 PMid:29782841.
  » http://doi.org/10.1016/j.ygcen.2018.05.021
• FERREIRA, D.G., GALINDO, B.A., APOLINÁRIO-SILVA, C., NASCIMENTO, R.H.C., FRANTINE-SILVA, W., CAVENAGH, A.F., SILVA, M.M., FELICIANO, D.C., AGGIO, C.E.G., ZANATTA, A.S., CARVALHO, S. and SOFIA, S.H., 2023. Influences of small hydroelectric plants on the genetic differentiation of Neotropical freshwater fish populations: a case study. Studies on Neotropical Fauna and Environment, vol. 58, no. 3, pp. 527-539. http://doi.org/10.1080/01650521.2021.1994349
  » http://doi.org/10.1080/01650521.2021.1994349
• FIGSHARE, 2024. ##gff-version 3.http://doi.org/10.6084/m9.figshare.11796468.v1
  » http://doi.org/10.6084/m9.figshare.11796468.v1
• FOOD AND AGRICULTURE ORGANIZATION OF UNITED NATIONS – FAO, 2022. The state of world fisheries and aquaculture 2022: towards blue transformation Rome: FAO, 236 p.
• GAILLARD, A.L., TAY, B.H., PÉREZ SIRKIN, D.I., LAFONT, A.G., DE FLORI, C., VISSIO, P.G., MAZAN, S., DUFOUR, S., VENKATESH, B. and TOSTIVINT, H., 2018. Characterization of gonadotropin-releasing hormone (GnRH) genes from cartilaginous fish: evolutionary perspectives. Frontiers in Neuroscience, vol. 12, pp. 607. http://doi.org/10.3389/fnins.2018.00607 PMid:30237760.
  » http://doi.org/10.3389/fnins.2018.00607
• GANECO, L.N., FRANCESCHINI-VICENTINI, I.B. and NAKAGHI, L.S.O., 2009. Structural analysis of fertilization in the fish Brycon orbignyanus. Zygote, vol. 17, no. 2, pp. 93-99. http://doi.org/10.1017/S0967199408005030 PMid:19032803.
  » http://doi.org/10.1017/S0967199408005030
• GONÇALVES, T.L., BAZZOLI, N. and BRITO, M.F.G., 2006. Gametogenesis and reproduction of the matrinxã Brycon orthotaenia (Günther, 1864) (Pisces: Characidae) in the São Francisco River, Minas Gerais, Brazil. Brazilian Journal of Biology = Revista Brasileira de Biologia, vol. 66, no. 2A, pp. 513-522. http://doi.org/10.1590/S1519-69842006000300018 PMid:16862307.
  » http://doi.org/10.1590/S1519-69842006000300018
• GONZÁLEZ-MARTÍNEZ, D., MADIGOU, T., MAÑANOS, E., CERDÁ-REVERTER, J.M., ZANUY, S., KAH, O. and MUÑOZ-CUETO, J.A., 2004. Cloning and expression of gonadotropin-releasing hormone receptor in the brain and pituitary of the European sea bass: an in situ hybridization study. Biology of Reproduction, vol. 70, no. 5, pp. 1380-1391. http://doi.org/10.1095/biolreprod.103.022624 PMid:14724132.
  » http://doi.org/10.1095/biolreprod.103.022624
• GRACIANO, R.C.D., OLIVEIRA, R.S., SANTOS, I.M. and YAZBECK, G.M., 2022. Genomic resources for Salminus brasiliensis. Frontiers in Genetics, vol. 13, pp. 855718. http://doi.org/10.3389/fgene.2022.855718 PMid:35419039.
  » http://doi.org/10.3389/fgene.2022.855718
• JONES, D.T., TAYLOR, W.R. and THORNTON, J.M., 1992. The rapid generation of mutation data matrices from protein sequences. Computer Applications in the Biosciences, vol. 8, no. 3, pp. 275-282. http://doi.org/10.1093/bioinformatics/8.3.275 PMid:1633570.
  » http://doi.org/10.1093/bioinformatics/8.3.275
• KAVANAUGH, S.I., NOZAKI, M. and SOWER, S.A., 2008. Origins of gonadotropin-releasing hormone (GnRH) in vertebrates: identification of a novel GnRH in a basal vertebrate, the sea lamprey. Endocrinology, vol. 149, no. 8, pp. 3860-3869. http://doi.org/10.1210/en.2008-0184 PMid:18436713.
  » http://doi.org/10.1210/en.2008-0184
• KIM, D.K., CHO, E.B., MOON, M.J., PARK, S., HWANG, J.I., KAH, O., SOWER, S.A., VAUDRY, H. and SEONG, J.Y., 2011. Revisiting the evolution of gonadotropin-releasing hormones and their receptors in vertebrates: secrets hidden in genomes. General and Comparative Endocrinology, vol. 170, no. 1, pp. 68-78. http://doi.org/10.1016/j.ygcen.2010.10.018
  » http://doi.org/10.1016/j.ygcen.2010.10.018
• KIM, N.N., SHIN, H.S., HABIBI, H.R., LEE, J. and CHOI, C.Y., 2012. Expression profiles of three types of GnRH during sex-change in the protandrous cinnamon clownfish, Amphiprion melanopus: effects of exogenous GnRHs. Comparative Biochemistry and Physiology. Part B, Biochemistry & Molecular Biology, vol. 161, no. 2, pp. 124-133. http://doi.org/10.1016/j.cbpb.2011.10.003
  » http://doi.org/10.1016/j.cbpb.2011.10.003
• KUMAR, S., STECHER, G., LI, M., KNYAZ, C. and TAMURA, K., 2018. MEGA X: molecular evolutionary genetics analysis across computing platforms. Molecular Biology and Evolution, vol. 35, no. 6, pp. 1547-1549. http://doi.org/10.1093/molbev/msy096 PMid:29722887.
  » http://doi.org/10.1093/molbev/msy096
• LETHIMONIER, C., MADIGOU, T., MUÑOZ-CUETO, J.A., LAREYRE, J.J. and KAH, O., 2004. Evolutionary aspects of GnRHs, GnRH neuronal systems and GnRH receptors in teleost fish. General and Comparative Endocrinology, vol. 135, no. 1, pp. 1-16. http://doi.org/10.1016/j.ygcen.2003.10.007
  » http://doi.org/10.1016/j.ygcen.2003.10.007
• MUÑOZ-CUETO, J.A., ZMORA, N., PAULLADA-SALMERÓN, J.A., MARVEL, M., MAÑANOS, E. and ZOHAR, Y., 2020. The gonadotropin-releasing hormones: lessons from fish. General and Comparative Endocrinology, vol. 291, pp. 113422. http://doi.org/10.1016/j.ygcen.2020.113422 PMid:32032603.
  » http://doi.org/10.1016/j.ygcen.2020.113422
• NATIONAL LIBRARY OF MEDICINE – NLM, 2024 [viewed 9 February 2024]. SRX13657039: DNA-Seq of Salminusbrasiliensis [online]. Bethesda: NLM. Available from: https://www.ncbi.nlm.nih.gov/sra/SRR17486808
  » https://www.ncbi.nlm.nih.gov/sra/SRR17486808
• NAYLOR, R.L., HARDY, R.W., BUSCHMANN, A.H., BUSH, S.R., CAO, L., KLINGER, D.H., LITTLE, D.C., LUBCHENCO, J., SHUMWAY, S.E. and TROELL, M., 2021. A 20-year retrospective review of global aquaculture. Nature, vol. 591, no. 7851, pp. 551-563. http://doi.org/10.1038/s41586-021-03308-6 PMid:33762770.
  » http://doi.org/10.1038/s41586-021-03308-6
• NELSON, J.S., GRANDE, T.C. and WILSON, M.V.H., 2016. Fishes of the world 5th ed. New Jersey: Wiley. http://doi.org/10.1002/9781119174844
  » http://doi.org/10.1002/9781119174844
• NIKOLICS, K., MASON, A.J., SZŐNYI, É., RAMACHANDRAN, J. and SEEBURG, P.H., 1985. A prolactin-inhibiting factor within the precursor for human gonadotropin-releasing hormone. Nature, vol. 316, no. 6028, pp. 511-517. http://doi.org/10.1038/316511a0 PMid:2863757.
  » http://doi.org/10.1038/316511a0
• NOCILLADO, J., PALMA, P., WANG, T., JESUS-AYSON, E.G., LEVAVI-SIVAN, B. and ELIZUR, A., 2022. Intracellular production of recombinant GnRH1 in yeast, Pichia pastoris, and its potential as oral treatment to advance gonadal development in juvenile orange-spotted grouper, Epinephelus coioides. Aquaculture, vol. 554, pp. 738115. http://doi.org/10.1016/j.aquaculture.2022.738115
  » http://doi.org/10.1016/j.aquaculture.2022.738115
• OGAWA, S., YAMAMOTO, N., HAGIO, H., OKA, Y. and PARHAR, I.S., 2022. Multiple gonadotropin‐releasing hormone systems in non‐mammalian vertebrates: ontogeny, anatomy, and physiology. Journal of Neuroendocrinology, vol. 34, no. 5, e13068. http://doi.org/10.1111/jne.13068 PMid:34931380.
  » http://doi.org/10.1111/jne.13068
• OKUBO, K. and NAGAHAMA, Y., 2008. Structural and functional evolution of gonadotropin‐releasing hormone in vertebrates. Acta Physiologica, vol. 193, no. 1, pp. 3-15. http://doi.org/10.1111/j.1748-1716.2008.01832.x PMid:18284378.
  » http://doi.org/10.1111/j.1748-1716.2008.01832.x
• ONUMA, T.A., BAN, M., MAKINO, K., KATSUMATA, H., HU, W., ANDO, H., FUKUWAKA, M., AZUMAYA, T. and URANO, A., 2010. Changes in gene expression for GH/PRL/SL family hormones in the pituitaries of homing chum salmon during ocean migration through upstream migration. General and Comparative Endocrinology, vol. 166, no. 3, pp. 537-548. http://doi.org/10.1016/j.ygcen.2010.01.015
  » http://doi.org/10.1016/j.ygcen.2010.01.015
• PAULINO, M.S., SAMPAIO, M., MILIORINI, A.B., MURGAS, L.D.S., LIMA, F.S.M. and FELIZARDO, V.O., 2011. Desempenho reprodutivo do pacu, piracanjuba e curimba induzidos com extrato de buserelina. Boletim do Instituto de Pesca, vol. 37, no. 1, pp. 39-45.
• PEIXER, J. and PETRERE JÚNIOR, M., 2009. Socio-economic characteristics of the Cachoeira de Emas small-scale fishery in Mogi-Guaçu River, State of São Paulo, Brazil. Brazilian Journal of Biology = Revista Brasileira de Biologia, vol. 69, no. 4, pp. 1047-1058. http://doi.org/10.1590/S1519-69842009000500008 PMid:19967175.
  » http://doi.org/10.1590/S1519-69842009000500008
• PELICICE, F.M., AGOSTINHO, A.A., AZEVEDO-SANTOS, V.M., BESSA, E., CASATTI, L., GARRONE-NETO, D., GOMES, L.C., PAVANELLI, C.S., PETRY, A.C., SANTOS POMPEU, P., REIS, R.E., OLIVEIRA ROQUE, F., SABINO, J., SOUSA, L.M., VILELLA, F.S. and ZUANON, J., 2023. Ecosystem services generated by Neotropical freshwater fishes. Hydrobiologia, vol. 850, no. 12-13, pp. 2903-2926. http://doi.org/10.1007/s10750-022-04986-7
  » http://doi.org/10.1007/s10750-022-04986-7
• RAMZY, A. and KIEFFER, T.J., 2022. Altered islet prohormone processing: a cause or consequence of diabetes? Physiological Reviews, vol. 102, no. 1, pp. 155-208. http://doi.org/10.1152/physrev.00008.2021 PMid:34280055.
  » http://doi.org/10.1152/physrev.00008.2021
• REIS, R.E., ALBERT, J.S., DI DARIO, F., MINCARONE, M.M., PETRY, P. and ROCHA, L.A., 2016. Fish biodiversity and conservation in South America. Journal of Fish Biology, vol. 89, no. 1, pp. 12-47. http://doi.org/10.1111/jfb.13016 PMid:27312713.
  » http://doi.org/10.1111/jfb.13016
• ROCH, G.J., BUSBY, E.R. and SHERWOOD, N.M., 2014. GnRH receptors and peptides: skating backward. General and Comparative Endocrinology, vol. 209, pp. 118-134. http://doi.org/10.1016/j.ygcen.2014.07.025 PMid:25107740.
  » http://doi.org/10.1016/j.ygcen.2014.07.025
• RUEDA, E.C., AMAVET, P., BRANCOLINI, F., SOMMER, J. and ORTÍ, G., 2011. Isolation and characterization of eight polymorphic microsatellite markers for the migratory characiform fish, Salminus brasiliensis. Journal of Fish Biology, vol. 79, no. 5, pp. 1370-1375. http://doi.org/10.1111/j.1095-8649.2011.03109.x PMid:22026613.
  » http://doi.org/10.1111/j.1095-8649.2011.03109.x
• SAN HAN, Y., YU, J.Y.L., LIAO, I.C. and TZENG, W.N., 2003. Salinity preference of silvering Japanese eel Anguilla japonica: evidence from pituitary prolactin mRNA levels and otolith Sr: Ca ratios. Marine Ecology Progress Series, vol. 259, pp. 253-261. http://doi.org/10.3354/meps259253
  » http://doi.org/10.3354/meps259253
• SANCHES, R.A.K. and PIANA, P.A., 2020. The influence of catch-and-release on mortality of Salminus brasiliensis (Cuvier, 1816). Brazilian Journal of Biology = Revista Brasileira de Biologia, vol. 80, no. 4, pp. 705-710. http://doi.org/10.1590/1519-6984.204168 PMid:31778476.
  » http://doi.org/10.1590/1519-6984.204168
• SILVER, M.R., KAWAUCHI, H., NOZAKI, M. and SOWER, S.A., 2004. Cloning and analysis of the lamprey GnRH-III cDNA from eight species of lamprey representing the three families of Petromyzoniformes. General and Comparative Endocrinology, vol. 139, no. 1, pp. 85-94. http://doi.org/10.1016/j.ygcen.2004.07.011 PMid:15474539.
  » http://doi.org/10.1016/j.ygcen.2004.07.011
• SIMAKOV, O., MARLÉTAZ, F., YUE, J.-X., O’CONNELL, B., JENKINS, J., BRANDT, A., CALEF, R., TUNG, C.-H., HUANG, T.-K., SCHMUTZ, J., SATOH, N., YU, J.-K., PUTNAM, N.H., GREEN, R.E. and ROKHSAR, D.S., 2020. Deeply conserved synteny resolves early events in vertebrate evolution. Nature Ecology & Evolution, vol. 4, no. 6, pp. 820-830. http://doi.org/10.1038/s41559-020-1156-z
  » http://doi.org/10.1038/s41559-020-1156-z
• SMITH, J.J., KURAKU, S., HOLT, C., SAUKA-SPENGLER, T., JIANG, N., CAMPBELL, M.S., YANDELL, M.D., MANOUSAKI, T., MEYER, A., BLOOM, O.E., MORGAN, J.R., BUXBAUM, J.D., SACHIDANANDAM, R., SIMS, C., GARRUSS, A.S., COOK, M., KRUMLAUF, R., WIEDEMANN, L.M., SOWER, S.A., DECATUR, W.A., HALL, J.A., AMEMIYA, C.T., SAHA, N.R., BUCKLEY, K.M., RAST, J.P., DAS, S., HIRANO, M., MCCURLEY, N., GUO, P., ROHNER, N., TABIN, C.J., PICCINELLI, P., ELGAR, G., RUFFIER, M., AKEN, B.L., SEARLE, S.M.J., MUFFATO, M., PIGNATELLI, M., HERRERO, J., JONES, M., BROWN, C.T., CHUNG-DAVIDSON, Y.-W., NANLOHY, K.G., LIBANTS, S.V., YEH, C.-Y., MCCAULEY, D.W., LANGELAND, J.A., PANCER, Z., FRITZSCH, B., DE JONG, P.J., ZHU, B., FULTON, L.L., THEISING, B., FLICEK, P., BRONNER, M.E., WARREN, W.C., CLIFTON, S.W., WILSON, R.K. and LI, W., 2013. Sequencing of the sea lamprey (Petromyzon marinus) genome provides insights into vertebrate evolution. Nature Genetics, vol. 45, no. 4, pp. 415-421. http://doi.org/10.1038/ng.2568
  » http://doi.org/10.1038/ng.2568
• SOUZA, F.N., MARTINS, E.D.F.F., CORRÊA FILHO, R.A.C., DE ABREU, J.S., PIRES, L.B., STREIT JUNIOR, D.P. and POVH, J.A., 2018. Ovopel® and carp pituitary extract for induction of reproduction in Colossoma macropomum females. Animal Reproduction Science, vol. 195, pp. 53-57. http://doi.org/10.1016/j.anireprosci.2018.05.005
  » http://doi.org/10.1016/j.anireprosci.2018.05.005
• SOUZA, T.G.D., KURADOMI, R.Y., RODRIGUES, S.M. and BATLOUNI, S.R., 2020. Wild Leporinus friderici induced spawning with different dose of mGnRHa and metoclopramide or carp pituitary extract. Animal Reproduction, vol. 17, no. 1, e20190078. http://doi.org/10.21451/1984-3143-AR2019-0078 PMid:32399066.
  » http://doi.org/10.21451/1984-3143-AR2019-0078
• TAKAHASHI, A., KANDA, S., ABE, T. and OKA, Y., 2016. Evolution of the hypothalamic-pituitary-gonadal axis regulation in vertebrates revealed by knockout medaka. Endocrinology, vol. 157, no. 10, pp. 3994-4002. http://doi.org/10.1210/en.2016-1356 PMid:27560548.
  » http://doi.org/10.1210/en.2016-1356
• TEUFEL, F., ALMAGRO ARMENTEROS, J.J., JOHANSEN, A.R., GÍSLASON, M.H., PIHL, S.I., TSIRIGOS, K.D., WINTHER, O., BRUNAK, S., VON HEIJNE, G. and NIELSEN, H., 2022. SignalP 6.0 predicts all five types of signal peptides using protein language models. Nature Biotechnology, vol. 40, no. 7, pp. 1023-1025. http://doi.org/10.1038/s41587-021-01156-3
  » http://doi.org/10.1038/s41587-021-01156-3
• TOSTIVINT, H., 2011. Evolution of the gonadotropin-releasing hormone (GnRH) gene family in relation to vertebrate tetraploidizations. General and Comparative Endocrinology, vol. 170, no. 3, pp. 575-581. http://doi.org/10.1016/j.ygcen.2010.11.017 PMid:21118690.
  » http://doi.org/10.1016/j.ygcen.2010.11.017
• VALENTI, W.C., BARROS, H.P., MORAES-VALENTI, P., BUENO, G.W. and CAVALLI, R.O., 2021. Aquaculture in Brazil: past, present and future. Aquaculture Reports, vol. 19, pp. 100611. http://doi.org/10.1016/j.aqrep.2021.100611
  » http://doi.org/10.1016/j.aqrep.2021.100611
• VIVEIROS, A.T., GONÇALVES, A.C., DI CHIACCHIO, I.M., NASCIMENTO, A.F., ROMAGOSA, E. and LEAL, M.C., 2013. Gamete quality of streaked prochilod Prochilodus lineatus (Characiformes) after GnRHa and dopamine antagonist treatment. Zygote, vol. 23, no. 2, pp. 212-221. http://doi.org/10.1017/S0967199413000440
  » http://doi.org/10.1017/S0967199413000440
• WHITE, S.A., BOND, C.T., FRANCIS, R.C., KASTEN, T.L., FERNALD, R.D. and ADELMAN, J.P., 1994. A second gene for gonadotropin-releasing hormone: cDNA and expression pattern in the brain. Proceedings of the National Academy of Sciences of the United States of America, vol. 91, no. 4, pp. 1423-1427. http://doi.org/10.1073/pnas.91.4.1423 PMid:8108425.
  » http://doi.org/10.1073/pnas.91.4.1423
• ZANIBONI-FILHO, E., RIBOLLI, J., HERMES-SILVA, S. and NUÑER, A.P., 2017. Wide reproductive period of a long-distance migratory fish in a subtropical river, Brazil. Neotropical Ichthyology, vol. 15, no. 1. http://doi.org/10.1590/1982-0224-20160135
  » http://doi.org/10.1590/1982-0224-20160135
• ZOHAR, Y., MUÑOZ-CUETO, J.A., ELIZUR, A. and KAH, O., 2010. Neuroendocrinology of reproduction in teleost fish. General and Comparative Endocrinology, vol. 165, no. 3, pp. 438-455. http://doi.org/10.1016/j.ygcen.2009.04.017
  » http://doi.org/10.1016/j.ygcen.2009.04.017
• ZOHAR, Y., ZMORA, N., TRUDEAU, V.L., MUÑOZ‐CUETO, J.A. and GOLAN, M., 2022. A half century of fish gonadotropin‐releasing hormones: breaking paradigms. Journal of Neuroendocrinology, vol. 34, no. 5, e13069. http://doi.org/10.1111/jne.13069 PMid:34913529.
  » http://doi.org/10.1111/jne.13069

Publication Dates

• Publication in this collection
  25 Oct 2024
• Date of issue
  2024

History

• Received
  09 Feb 2024
• Accepted
  13 Aug 2024