Rh E^w antigen in a multi-transfused patient with sickle cell disease

Introduction

The Rh blood system is the second in clinical importance in transfusions and gestations¹; however, it is the most complex with more than 50 antigens already having been described.² Of the antigens, D, C, c, E and e, whose alloantibodies react at 37 °C and cause hemolysis, are responsible by the vast majority of intercurrences in transfusions and gestations.³ The E antigen is expressed by the RHCE gene and differs from the e antigen by a single nucleotide polymorphism (SNP) (676C>G; Pro226Ala).⁴

The E^w antigen, a rare variant of the E antigen, was described for the first time in 1955.⁵ According to some reports in the literature, it is only found in Caucasians with a frequency of less than 0.1%.^5-9 A hemolytic disease of the newborn (HDN) caused by anti-E^w maternal antibodies was reported in two of these reports^5,7; in another, an anti-E alloantibody was found in an E^w positive patient, after receiving E positive red blood cells (RBCs).⁶ Although the antigen has been described only in Caucasians (and at a very low frequency), in this study, we found the phenotype with a molecular basis in a patient of mixed ethnicity (neither White nor Black) and sickle cell disease (SCD), highlighting the high level of miscegenation in Brazil.

Case report

We report on the case of a 30-year-old male patient with A RhD+ blood type and SCD and a history of more than 100 packed RBC transfusions at the Hemocentro Regional de Uberaba/Fundação Hemominas. He was of mixed ethnicity (White and Black) as were his ancestors (parents and grandparents). In 2009, his results of RBC alloantibody screening were positive; however, the antibody (present as a low titer) was not identified. In the same year, his erythrocyte phenotyping was performed by the Immunohematology Center of the Fundação Hemominas (Belo Horizonte, Brazil) and defined as Rh [C-c+ (Cw−); E+ (weak positive) e+]; K−; Fy (a+b+); Jk (a+b+); S-s+.

In 2014, after he gave his consent, a new blood sample was collected, with the RBCs submitted to a repeat phenotyping test using the gel centrifugation technique and the ID-DiaClon Rh-Subgroups+K card (Diamed-BioRad Latin America, Lagoa Santa, Minas Gerais, Brazil), with monoclonal antibodies,⁸ while the leucocytes had the DNA extracted using the Flexigene kit (Qiagen, Hilden, Germany). In both tests, the manufacture's recommendations were followed. The DNA was submitted to RBC genotyping by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP)¹⁰ and BeadChip wRHCE2.1 (Bioarray Solutions, Immucor, Warren, NJ, USA), also following the manufacture's recommendations.

PCR was performed with 50-100 ng of DNA, 0.25 µM of each primer, 0.25 mM of each dNTP, 2.5 mM of MgCl₂, 1.0 U Taq DNA polymerase and buffer 1×. PCR amplification was performed in a Veriti™ 96-well Thermal Cycler (Applied Biosystems, Foster City, CA, USA). The following conditions were used: denaturation at 95 °C for 15 min, followed by 35 cycles at 95 °C for 30 s, 62 °C for 30 s and 72 °C for 40 s, and a final extension step of 72 °C for 10 min. Amplified products were analyzed by electrophoresis in 1.5% agarose gel in Tris-Borate EDTA buffer (TBE). For enzyme digestion, the PCR product was incubated with Mnl I restriction enzyme overnight at 37 °C according to the manufacture's recommendation. All reagents used in the PCR reactions were obtained from Applied Biosystems, Foster City, CA, USA. The RFLP analysis was performed after electrophoresis in 3.5% agarose gel in TBE. Primer sequences used in the PCR are described in Table 1.

Table 1
Primer sequences used in polymerase chain reaction-restriction fragment length polymorphism for RHCE*E/e genotyping.

Primer	Primer sequence (5'→3')
CEI4 (sense)	GGCAACAGAGCAAGAGTCCA
CEX5 (antisense)	CTGATCTTCCTTTGGGGGTG

As one result of phenotyping (Rh(E-e+)) and genotyping (RHCE*E/RHCE*e) was discrepant, and he had not received transfusions of red blood cells in the 12 months preceding the last blood collection, his DNA sample was submitted to a sequencing of the RHCE gene, in order to identify the cause of the discrepancy.

All 10 exons of RHCE were sequenced. Amplification was performed with RHCE-specific primers designed to target flanking intronic regions (7) and sequencing analysis was performed in a 3500xL Genetic Analyzer (Applied Biosystems, Foster City, CA, USA). Primer sequences and annealing temperature used are described in Table 2.

Table 2
Sequences and annealing temperature of the primers used in the sequencing of the RHCE gene.

Exon	Primer sequence (5'→3')	Annealing temperature
1 (S)	catagacaggccagcacag	55 °C
1 (AS)	cctgctatctgctcctgtga
2 (S)	ctcgtccttctcgccatct	55 °C
2 (AS)	ggattccttgtgatacacggagta
3 (S)	atcctggctctccttctca	55 °C
3 (AS)	caagtgatcttccctcctcaa
4 (S)	tgaactttctccaaggaccat	55 °C
4 (AS)	aatttagcaaacactactcaaagaag
5 (S)	tggagcaggagtgtgattct	55 °C
5 (AS)	gtgaccacccagcattctt
6 (S)	agaggtggtttcaggatcag	55 °C
6 (AS)	agccaaagcagagagcatta
7 (S)	ccattgatgtgagtacacatt	50 °C
7 (AS)	gtaggggctggacataatt
8 (S)	agccagggagaggacccttg	60 °C
8 (AS)	gggaaggagatggggcaaatag
9 (S)	aaggatttctgttgagacact	50 °C
9 (AS)	agcaagtcaacatatataccca
10 (S)	cccagggaggtgcagtataa	56 °C
10 (AS)	gcgtttctcacgtacaaatgc

• (S): sense; (AS): antisense.

Three polymorphisms were identified by sequencing (361A>T, 380C>T and 383G>A) compatible with the RHCE*cE.15.02/RHCE*ce genotype (Figure 1). The RHCE*cE.15.02 allele is a rare variant, leading to a weakened expression of the E antigen.

Figure 1
Result of the RHCE gene sequencing, with three polymorphisms compatible with the RHCE*cE.15.02/RHCE*ce genotype.

Discussion

In the present case, although the patient was genotyped as RHCE*E/RHCE*e, his respective phenotype was defined as E+ (weak positive) and E negative in the first and the second phenotyping tests, respectively. This discrepancy was due to the presence of three polymorphisms (361A>T, 380C>T and 383G>A) identified in the RHCE gene sequencing, responsible for the E^w antigen. A different molecular basis had already been identified: 500T>A; Met167Lys.^6,9 As already cited, there is a report of anti-E alloimmunization in a E^w positive patient after receiving E positive erythrocytes.⁶ It is thus advisable to transfuse only E negative RBCs in these individuals.

Our results clearly reinforce the importance of erythrocyte phenotyping and genotyping as complementary tests in the transfusion routine of multi-transfused patients or candidates for chronic transfusions of RBCs, as in some cases, the detection of a certain allele by one molecular technique does not necessarily mean its complete or partial expression. In these situations, DNA sequencing is paramount, including in other cases where RBC phenotype and genotype discrepancies cannot be solved by molecular methodologies currently used in the routine and the patient has no history of recent transfusions.

Lastly, it is important to highlight the singularity of this case, considering that the phenotype has been detected in about 1:1000 Caucasians, with no reports in other ethnicities; however, here it was identified in a patient with sickle cell disease, which originates from the Black population. As the patient was mixed and reported that his parents and grandparents had the same ethnicity, this shows the high level of miscegenation of the Brazilian population.

Acknowledgements

To Emília Ângela Sippert, PhD, for performing the BeadChip technique and RHCE gene sequencing at the Laboratório de Biologia Molecular de Grupos Sanguíneos da Universidade Estadual de Campinas (UNICAMP).

References

• ¹
  Flegel WA. The genetics of the Rhesus blood group system. Blood Transfusion. 2007;5(2):50-7.
• ²
  Castilho L, Pellegrino Junior J, Reid ME. Fundamentos de Imuno-hematologia. 1st ed. São Paulo: Atheneu; 2015. p. 2.
• ³
  Castilho L. Sistema de grupo sanguíneo Rh. In: Bordin JO, Langhi Júnior DM, Covas DT, editors. Hemoterapia: Fundamentos e Prática. São Paulo: Atheneu; 2007. p. 138–44.
• ⁴
  Mouro I, Colin Y, Chérif-Zahar B, Cartron J-P, Le Van Kim C. Molecular genetic basis of the human Rhesus blood group system. Nat Genet. 1993;5(1):62-5.
• ⁵
  Greenwalt TJ, Sanger R. The Rh antigen E^w Br J Haematol. 1955;1(1):52-4.
• ⁶
  Strobel E, Noizat-Pirenne F, Hofmann S, Cartron JP, Bauer MF. The molecular basis of the Rhesus antigen E^w Transfusion. 2004;44(3):407-9.
• ⁷
  Grobel RK, Cardy JD. Hemolytic disease of the newborn due to anti-E^w A fourth example of the Rh antigen, Ew. Transfusion. 1971;11(2):77-8.
• ⁸
  Bugert P, Scharberg EA, Geisen C, Von Zabern I, Flegel WA. RhCE protein variants in Southwestern Germany detected by serologic routine testing. Transfusion. 2009;49:1793-802.
• ⁹
  Noizat-Pirenne F, Mouro I, Gane P, Okubo Y, Hori Y, Rouger P, et al. Heterogeneity of blood group RhE variants revealed by serological analysis and molecular alteration of the RHCE gene and transcript. Br J Haematol. 1998;103(2):429-36.
• ¹⁰
  Castilho L, Rios M, Bianco C, Pellegrino Junior J, Alberto FL, Saad ST, Costa FF. DNA-based typing of blood groups for the management of multiply-transfused sickle cell disease patients. Transfusion. 2002;42(2):232-8.

Publication Dates

• Publication in this collection
  Oct-Dec 2018

History

• Received
  10 Dec 2017
• Accepted
  19 Feb 2018
• Published
  23 Apr 2018