Characterization of Phytophthora nicotianae isolates from tobacco plants (Nicotiana tabacum) in Colombia

ABSTRACT

The black shank disease caused by Phytophthora nicotianae causes losses in tobacco crops up 100%. In Colombia, P. nicotianae populations are poorly known causing wrong diagnostics and erratic management. Amplification of the Ypt1 gene and morphological characteristics of colonies, sporangia, chlamydospores and hyphae were used to identify P. nicotianae isolates. Races were identified according to the reaction induced by each isolate on the differential tobacco varieties Hicks, L8, KY 14 x L8 and NC 1071. As results, 71 isolates of P. nicotianae were identified and classified by races. Colonies of P. nicotianae were of white color, cottony and fluffy texture with smooth, non-swollen hyphae; spherical papillae with an average of 1.26 μm and non-papillated and intercalary chlamydospores of medium size of 1.02 μm that are typical characteristics of P. nicotianae. A species-specific PCR-amplified band of 389 bp was detected in all isolates tested. The presence of races 0, 1 and 3 of P. nicotianae were determined in the Colombian departments of Huila and Santander. To the best of our knowledge, this is the first report of physiological races 0, 1 and 3 of P. nicotianae in Colombia. Results are of relevance for disease management and tobacco breeding.

Keywords:
chlamydospores; black shank; oomycetes; races 0, 1, 3; sporangia; YpT1 gene.

INTRODUCTION

The black shank disease of tobacco is caused by the oomycete plant pathogen Phytophthora nicotianae van Breda de Haan. This disease is the most limiting phytosanitary problem in more than 120 countries where tobacco is grown including Colombia (Abad, 2008; Panabières et al., 2016; Gallup et al., 2018). P. nicotianae infects tobacco roots, stems and leaves during any stage of plant development, causing symptoms such as root and stem necrosis, chlorosis, stunting, leaf necrosis, wilt and finally plant death (Csinos, 2005; Lamour, 2013). Black shank disease develops faster under high temperature and humidity, conditions which are frequent in the growing areas of the departments of Huila and Santander where 66% of tobacco is produced in Colombia. Losses may reach 100% under favourable conditions for pathogen development, even with cultivars reported as highly resistant to P. nicotianae as was observed in Colombia in the Department of Huila with cv. K346 (Wilkinson et al., 2003).

P. nicotianae has a wide host range with more than 255 plant genera in 90 families and causes large losses in a number of crops around the world (Panabières et al., 2016). Some extent of host specialization has been detected in isolates collected from Citrus, Solanum and Nicotiana plants. In addition, isolates collected from nurseries usually show high heterozygosity and relative equilibria between A1 and A2 mating types (Biasi et al., 2016). Host resistance and crop rotation are the most economic measures to control black shank, but they are not always effective (Shew, 1987; Johnson et al., 2002). The primary reason for the difficulty in controlling P. nicotianae is the production of resistant chlamydospores and oospores that allow the pathogen survival under unfavorable conditions, as well as efficient dissemination in soil water, irrigation water and hydroponic solutions through mobile zoospores.

The ability of P. nicotianae populations to infect tobacco cultivars with different resistance genes defines five physiological races (i.e., 0, 1, 2, 3 and 4) (Sullivan et al., 2005a,b; Gallup & Shew, 2006; Sullivan et al., 2010). The predominant physiological races, 0 and 1, are widely distributed throughout China, the United States and other major tobacco growing countries (Apple, 1962; Li, 2015). Previous studies using tobacco cultivars with moderate or high levels of resistance found that race 0 has higher virulence and ecological fitness levels than race 1, in fact, more RxLR effector genes were found in the genome of race 0 than in that of race 1 (Liu et al., 2016), suggesting that the difference in virulence between the two races is affected by additional genetic factors (Sullivan et al., 2005a,b). In addition, several authors have reported high variability in virulence and in the physiological races of P. nicotianae: 0, 1, 2, 3 and 4, in different places and countries around the world (Apple, 1962; Csinos & Bertrand, 1994; Van Jaarsveld et al., 2002; Sullivan et al., 2005a,b; Gallup & Shew, 2010). P. nicotianae is heterothallic requiring mating types A1 and A2 to produce oospores (Panabières et al., 2016). Most research on sexual variability has been performed under laboratory controlled conditions, thereby the potential of genetic adaptation to new hosts and fungicide applications derived from sexual recombination on field crops is mostly unknown (Panabières et al. 2016; Gallup et al., 2018).

Wild Nicotiana species N. longiflora (gene phl) and N. plumbaginifolia (gene php) are completely resistant to Race 0, N. nesophila is resistant to Race 3 (McIntyre & Taylor, 1978) and N. plumbaginifolia shows resistance to Race 4 but susceptibility to race 1 (Csinos & Bertrand, 1994; Gallup & Shew, 2010). Evidence suggests that tobacco plants that have the gene Php are resistant to Race 3 (Gallup & Shew, 2010; Gallup et al., 2018). Tobacco cv. Delcrest 202 (MK 95 x MK165) exhibits a single dominant gene with resistance to Race 2 (Mclntyre & Taylor, 1978; Van Jaarsveld et al. 2002). Cultivars from USA are resistant to Race 0 and susceptible to Race 1; when those cultivars are grown continuously, Race 1 is selected and becomes prevalent in tobacco crops (Sullivan et al., 2005a). Cv. Fla 301 is partially resistant to races 0 and 1, therefore is an option when both races of P. nicotianae are present (Apple, 1967; Lucas, 1975; Carlson et al., 1997; Csinos, 2005). Race 4 is able to overcome single-gene resistance conferred by the Phl gene from N. longiflora but not the Php gene from N. plumbaginifolia (Gutiérrez & Mila, 2007). In Colombia, most seeds used for commercial crops are imported from USA, where they are improved using cv Fla 301 (Johnson et al., 2002; Csinos, 2005). However, cv. Fla 301 may not be viable in tropical places with high levels of disease pressure (Csinos, 2005).

To apply appropriate control methods for plant diseases and to establish successful breeding programs, it is crucial to accurately identify the causal agent and to characterize populations investigating prevalent races to deploy appropriate cultivars. P. nicotianae has been identified using morphological characters such as sporangium, hyphae, growth pattern in culture media and other parameters (Erwin & Ribeiro, 1996; Abad, 2008; Gallup & Shew, 2010). Additionally, molecular markers based on the Internal Transcribed Spacer (ITS) and other regions, have been successfully used to discriminate P. nicotianae from other Phytophthora species (Meng & Wang, 2010; Monday et al., 2010). However, it has been not possible to differentiate P. nicotianae races using morphological characteristics or molecular markers (Mclntyre & Taylor, 1978; Abad, 2008). To date, physiological races of P. nicotianae are still differentiated using differential cultivars (Sullivan et al., 2005a,b; Gutiérrez & Mila, 2007).

To the best of our knowledge, in Colombia information about P. nicotianae populations and races affecting tobacco crops is mostly unknown and in most cases limited to internal reports in private companies. Therefore, accurate pathogen identification and characterization of prevalent races is very important for a sustainable tobacco industry in Colombia. The present research had as objective the morphological, pathogenic, immunological and molecular characterization of P. nicotianae populations present in Colombian tobacco growing areas, located mainly in the Departments of Santander and Huila.

MATERIALS AND METHODS

Isolates

Isolates were obtained using diseased tissues of tobacco plants. A piece of plant tissues taken from the edge of the lesion including green healthy and diseased tissue was placed in sterile oat-agar media culture. Petri dishes were incubated in laboratory conditions and transferred to fresh media (oat- agar) every two months; in addition, agar plugs containing mycelia were transferred every year to sterile tap water and incubated at room temperature.

Immunological and Molecular identification of isolates

ELISA test (Agdia® kit) was used to confirm the genus Phytophthora following the manufacturer instructions. Mycelia of purified isolates grown for 15 days in oat-agar media were macerated. Two wells of the plate for ELISA test were used as replicates per each isolate tested. Two wells without mycelia were used as negative controls. As positive control, mycelium from an identified isolate of P. nicotianae kindly donated by Dr. Csinos from Department of Plant Pathology of University of Georgia, USA, was used, in addition to the standards available in the kit. A well with solution of strong yellow color was considered positive for Phytophthora and a well containing transparent solution was considered negative.

DNA extraction

Isolates were grown in 100 mL of sterile liquid pea-sucrose broth for 10 days (pea 100 g/L, sucrose 10 g/L, distilled water up to 1L), supplemented with 60 μl of ampicillin (20mg/L) and incubated at 24°C±2°C in darkness without shaking for ten days. Mycelium was vacuum-filtered and freeze-dried for 24 h at room temperature; then, was macerated in a mortar with a pestle with liquid nitrogen until a fine powder was obtained and stored at -20 °C for further use.

DNA was extracted following the method described by Álvarez et al. (2004). 600 μL of extraction buffer SDS (SDS 1%, NaCL 1.4M, EDTA 20mM and Tris-HCl pH 8.0 100 mM) were added to mycelia (100-150µL) powder and were incubated at 65°C for 30 min; then 200μL of ammonium acetate7.5M were added and incubated at room temperature for 10 min, followed by centrifugation; supernatant was recovered and mixed with 500μL of chloroform : isoamyl alcohol (24:1); then nucleic acids were precipitated by adding 500μL of isopropyl alcohol and RNA eliminated with RNase (10mg/mL) incubated for 30 min at 37°C. Finally, nucleic acids were precipitated by centrifugation. DNA was dissolved in 60 µL of buffer Tris-EDTA (Tris - HCL 10 mM, EDTA 1 mM; pH 8.0). DNA was analyzed by agarose (0.8%) gel electrophoresis in Buffer TBE1x, at 80v. Images were taken under UV using a Biometra BioDoc equipment (Biometra GmbH, Goettingen Germany). DNA was quantified by fluorometry (Qubit®, Invitrogen Corporation), and diluted at a final concentration of 10 ng/μL, for PCR amplification.

PCR amplification of regions of the Ypt1 gene

Primers Pn1 (5’GACTTTGTAAGTGCCACCATAC3’) and Pn2 (5’CTCAGCTCTTTTCCTTGGATCT3’) were used for specific amplification of Ypt1 gene (Meng & Wang, 2010), in a reaction containing: Taq buffer 1X (Tris HCl 100mM pH 8, MgCl₂ 2.5 mM and KCl 500 mM), 0.1 mM of each of dNTPs, 0.2μM of each primer, 2.5 mM of MgCl₂, 1.2ng/μL of DNA, 0.05 U/μL of DNA Taq polimerase (Fermentas) and HPLC-ultrapure water to complete a final volume of 25 µL. PCR amplification was performed in a thermalcycler equipment Biometra TPersonal (Biometra GmbH, Goettingen Germany) using the following program: initial denaturation at 94°C for 5 min, followed by 35 cycles of 30 s at 94°C, 30 s at 64°C, 30 s at 72°C and a final extension at 72°C for 10 min. Amplified products (6µL) were separated by agarose (1%) gel electrophoresis in TBE buffer 1x, at 5 V/cm for 1 h, stained with SYBRSafe (3μL for 100mL of agarose), and visualized under UV and photographed using an equipment Biometra BioDoc (Biometra GmbH, Goettingen Germany). Bands in the gel electrophoresis were compared with a molecular marker (1Kb, Gibco®), to verify the size of the amplified product.

Pathogenicity tests

Two pathogenicity tests were performed. The first was made to fulfill the Koch postulates to verify that isolates were tha causal agents of observed symptoms. The second was made to determine P. nicotianae races present in the collected isolates.

Koch postulates and disease severity quantification were performed for 71 isolates of P. nicotianae. Isolates were inoculated on tobacco plants cv. Hicks of 50 days old, which is considered highly susceptible to all known races of P. nicotianae (Bowman & Sisson, 2000; Xiao et al., 2013). Tests were performed following the methods described by (Csinos, 2005) with a minor modification consistent in an incubation temperature of 23-25°C. Each isolate was inoculated in stems and roots; in stems, basal leaves were removed and an agar disk with the isolate was applied on the insertion zone of the removed leaf. A humid cotton speck was placed on the isolate and covered with parafilm tape (Parafilm MR) to avoid desiccation. Roots were inoculated with 5mL of a solution with zoopores at a concentration of 10⁶ zoospores/mL.

A severity scale from 0 to 10 was used to measure the pathogenicity index (Sullivan et al., 2005a). Disease development was recorded daily from the third day after inoculation (dai) and until 21 dai. A value of 10 in the scale was assigned to plants that died three dai; a value of 8 was for plants dead 5 dai; a value of 6 for plants dead 7dai; 4 was for plants dead 14 dai; 2 for plants dead at 21 dai and 0 was for plants without symptom development at 21 dai. A completely randomized experimental design with three replicates per treatment, was applied, i.e., three plants inoculated per each isolate for a total of 210 plants inoculated for 71 isolates. A plant of cv. Hicks, which is considered highly susceptible to all known races of P. nicotianae, of 50 days old was considered as an experimental unit (Xiao et al. 2013, Bowman & Sisson 2000).

Disease severity was determined as the sum of pathogenicity indexes divided by the total number of plants inoculated with each isolate (Equation 1):

Equation 1

$Severity=\frac{\sum _{i=1}^n{n}_i}{N}$ (1)

Where,

N: total number of plants inoculated with each isolate

n: pathogenicity index for each plant inoculated

Determination of physiological races of isolates

71 isolates from Colombian and a reference isolate from USA, were tested using the methodology proposed by Gallup & Shew (2010) and Gutiérrez & Mila (2007), but using tobacco differentials Hicks, KY 14xL8, L8 and NC 1071, which harbor different types of resistance to P. nicotianae (Table 1). Tobacco differentials were kindly donated by Dr. Ramses Lewis from North Carolina State University, USA. Each isolate of P. nicotianae was inoculated on the four tobacco differentials mentioned above. Thirty plants of each cultivar were inoculated with each isolate with two replicates and a non-inoculated control of each cultivar tested, for a total of 60 plants of each cultivar per each isolate.

Table 1:
Differential cultivars of tobacco used for determination of physiological races of P. nicotianae

Cultivar	Type of tobacco	Resistance gene	Type of resistance
NC 1071b	FLUE CURED	Php	Complete resistance to Race 0. No resistance to Race 1.
HICKSa	FLUE CURED	No Php	susceptible to all known races
L8b	BURLEY	Phl (homozygous)	Complete resistance to Race 0. Low resistance to Race 1.
KY 14 x L8a	BURLEY	Phl (heterozygous)	No resistance to Race 0. Complete resistance to Race 1.

• a: commercial cultivar; b: improved line.

Plant distribution and maintenance

Plants of each differential were sown in plastic boxes of 12 wells (Corning Incorporated®). Ten seed were placed in each well. Sterile distilled water was added between wells to keep moisture. Plastic boxes were kept in humid chambers incubated at room temperature (~23°C) and 13 hours of light. Plants were fertilized twice per week with 0,5 mL of a solution with 200ppm of N-P-K (20-10-20). A completely randomized experimental design with six replicates, was used. Each plastic box was considered as an experimental unit. Tobacco cultivars Hicks, NC1071, L8 and KY 14 x L8, were used to test P. nicotianae isolates (Table 1).

Preparation of inocula and plant inoculation

Leaf disks of 5mm of diameter of tobacco plants cv. Hicks were surface sterilized in sodium hypochlorite (5,25%) for 3 min, followed by three rinses in sterile distilled water. Sterile disks were placed in circular form in Petri dishes containing oat-agar medium. A plug of agar with P. nicotianae mycelia from a culture grown for 15 days was placed in the center of each Petri dish containing leaf disks. Petri dishes were incubated at 23^oC ± 2°C in complete darkness for 10 days.

Tobacco seedlings were inoculated 25 days after seeds were sown, by placing a leaf disk of tobacco cv. Hicks infected with P. nicotianae in each well. Two microplates of 12 wells each were inoculated and another microplate of 12 wells was used as a non-inoculated control. Microplates inoculated with each isolate were incubated in a humid chamber at 27^oC with 13 hours of light and 11 hours of darkness for 14 days.

Evaluation of results

Incidence was measured 14 dai considering a plant infected by P. nicotianae as the one showing total chlorosis, wilt, dark roots, necrosis and death. A plant genotype has been considered as susceptible/positive to P. nicotianae if more than 5% of a total of 60 inoculated plants were infected, otherwise has been considered negative (Gutiérrez & Mila, 2007). Races were determined following the dichotomic response (negative or positive) method. Race 0 is positive in cv. Hicks but negative in cv. NC 1071, KY 14 x L8 and L8. Race 1 is positive for cv. Hicks, NC 1071, KY 14 x L8 and L8. Race 3 is positive for cv. Hicks, KY 14 x L8 and L8, but negative for cv. NC 1071 (Sullivan et al., 2005a,b; Gallup & Shew, 2010; Gallup et al., 2018).

Morphological characterization of P. nicotianae

Isolates of P. nicotianae grown for 15 days in oat-agar media culture were used for morphological characterization of sporangia (shape, size, presence/absence of papillae, pore opening and length of the pedicel), sporangiophore (shape), hyphae (shape, growth type), chlamydospores (presence, position, size) and colony in culture media (growth, color) (Appiah et al., 2003; Abad, 2008). Measurements were performed in the light microscope at 100X (Nikon). Three copies of each isolate were measured, considering one petri dish as an experimental unit. Normal distribution of residuals was determined by Shapiro-Wilks and Kolmogorov-Smirnov tests and homoscedasticity was determined using the Levene test (P < 0.05). Analysis of variance (ANOVA) followed by the Tukey test (P < 0.05), were performed to determine significant differences between isolates. Non-parametric data were analyzed using the Kruskall-Wallis test (P < 0.05) and post-hoc Dunn test.

RESULTS

Identification of P. nicotianae

ELISA test results were positive for Phytophthora spp. in all isolates tested. Primers Pn1 and Pn2 amplified the expected 389 bp DNA fragment for 100% of isolates, which confirmed positive identification of isolates of tobacco from Colombia and the USA as Phytophthora nicotianae (Figure 1).

Figure 1:
Molecular identification of P. nicotianae based on the Ypt1 gene. M: 1 Kb DNA molecular weight marker. Wells 2-9: isolates CPn 1 to 71 from the Department of Huila, Colombia. Wells 10-13: isolates CPn 10 to 40 from the Department of Santander, Colombia C-: negative control.

Pathogenicity of P. nicotianae isolates

Seedlings showed a rapid response to inoculation with the pathogen on stems and roots. The faster appearance of symptoms was recorded at 24 hours and continue up to three dai. Most P. nicotianae isolates (86%) showed a PI of 10 according to the severity scale of disease used, showing typical wilt, necrosis in the basal part of the stem and death of seedlings (Figure 2, Table 2). At 7 dai, plants showed from 10 to 30% of mortality and at 14 dai, most plants were dead.

Figure 2:
Tobacco seedlings cv. Hicks showing disease symptoms by P. nicotianae three days after inoculation: a) inoculated tobacco seedling under laboratory conditions, b) tobacco seedlings showing epinasty symptoms, c) stem necrosis, d) stem necrosis and epinasty symptoms.

Table 2:
Number of isolates of P. nicotianae, codes and locations of the tobacco fields in Colombia sampled, pathogenicity index (IP) values, detection of races in differential tobacco hosts and percentages of each race by location

Number	Isolate code	Region	Location	Sidewalk	PI/Isolate	Race	Ratio proportion by area (%)
							R0 R1 R3 RU TOTAL
1	CPN 01	Huila	Altamira	Llano de la Virgen	10	R1	16,67	55,56	16,67	11,11	100
2	CPN 03		Altamira	Llano de la Virgen	3,3	R0
3	CPN 05		Altamira	Llano de la Virgen	10	R0
4	CPN 18		Campoalegre	Rio Frio	2,9	RU
5	CPN 34		Campoalegre	Bajo Piravante	10	R1
6	CPN 36		Campoalegre	Bajo Piravante	3,3	R1
7	CPN 38		Campoalegre	Bajo Piravante	10	R1
8	CPN 65		Campoalegre	Piravante	10	R1
9	CPN 67		Campoalegre	Piravante	5,7	R1
10	CPN 69		Algeciras	Lagunilla	10	R0
11	CPN 71		Algeciras	Lagunilla	10	R3
12	CPN 73		Algeciras	Lagunilla	10	RU
13	CPN 74		Algeciras	Lagunilla	10	R1
14	CPN 28		Garzon	Alto Sertenejo	10	R1
15	CPN 76		Garzón	Alto Zartenejo	10	R3
16	CPN 32		Garzón	(lote: El Campamento)	10	R1
17	CPN 75		Rivera	Riverita	10	R3
18	CPN 78		El Agrado	La Escalerita	10	R1
19	CPN 04	Santander	Capitanejo	Junta	10	RU	45,24	28,57	11,9	14,29	100
20	CPN 23		Capitanejo	La Parada	10	R1
21	CPN 40		Capitanejo	La Loma del Negro	10	R1
22	CPN 55		Capitanejo	Junta	10	R1
23	CPN 60		Capitanejo	N.A.	10	R3
24	CPN 27		Capitanejo (Miranda)	Popagá	9	R1
25	CPN 10		Villanueva	N.A.	10	R1
26	CPN 37		Villanueva	El Hato	10	R0
27	CPN 41		Villanueva	Centro	10	R1
28	CPN 42		Villanueva	Hato viejo	10	R3
29	CPN 43		Villanueva	Macaregua Hato	10	R0
30	CPN 49		Villanueva	Trigo	10	R0
31	CPN 50		Los Santos	Macaregua	10	R3
32	CPN 68		Los Santos	Hato viejo	10	R0
33	CPN 70		Los Santos	Trigo	3,3	R0
34	CPN 79		Los Santos	Centro	10	R0
35	CPN 80		Los Santos	Centro	10	R0
36	CPN 15		Los Santos	Delicias	10	RU
37	CPN 17		Los Santos	Delicias	10	R0
38	CPN 19		Los Santos	Delicias	10	R0
39	CPN 29		Los Santos	Espinal	10	R1
40	CPN 31		Los Santos	Lanadas	10	R1
41	CPN 33		Los Santos	Delicias	10	R1
42	CPN 35		Barichara	N.A.	10	R0
43	CPN 45		Barichara	La Purnia	10	RU
44	CPN 46		Barichara	Garvanzal	10	R1
45	CPN 47		Barichara	Delicias	5,7	R0
46	CPN 62		Barichara	Garbanzal	10	R0
47	CPN 66		Barichara	Garvanzal	10	R0
48	CPN 51		Cabrera	Caraquitas	10	R1
49	CPN 52		Cabrera	Higueras	10	R3
50	CPN 54		Pie de cuesta	Higueras	10	RU
51	CPN 56		Enciso	Higueras	8	R0
52	CPN 59		San Gil	Paramito	10	R0
53	CPN 61		Jordan	Paramito	10	R0
54	CPN 44		Curiti	Cuchillas	10	R1
55	CPN 72		Los Santos	Ojo de Agua	10	R0
56	CPN 16		Los Santos	Guatiguará	10	R0
57	CPN 21		Los Santos	Mosgua	10	RU
58	CPN 48		Los Santos	Flora	10	R0
59	CPN 63		Los Santos	Pomaroso	10	R3
60	CPN 13		Los Santos	La Peña	10	RU
61	CPN 02	Carolina Norte USA	N.A.	N.A.	10	R0	81,82	18,18	0	0	100
62	CPN 06	Tolima	Espinal	Dindalito	10	R0
63	CPN 08	Tolima	Espinal	Dindalito	10	R0
64	CPN 12	Tolima	Espinal	Saman	6,7	R1
65	CPN 14	Tolima	Espinal	Saman	10	R1
66	CPN 09	Boyaca	Covarachia	Soldado Bravo	3,3	R0
67	CPN 11	Boyaca	Covarachia	Soldado Bravo	10	R0
68	CPN 07	Valle	N.A.	N.A.	10	R0
69	CPN 53	Valle	Candelaria	N.A.	10	R0
70	CPN 58	Valle	N.A.	N.A.	10	R0
71	CPN 25	Quindio	Calarca	N.A.	10	R0

• RU= Unknown race. NA= not known. PI= Pathogenicity Index

Identification of physiological races of P. nicotianae

Results evidenced that races R0 (43.66%) and R1 (33.8%) showed the highest incidence for all isolates collected from Colombian Departments. Race 3 (incidence of 11.27%) was identified only in the Departments of Santander and Huila (Table 3). Race 1 was present in 55.56% of isolates from Huila and in 28.57% of isolates from Santander growing areas. Race 0 was present in 16.67% of isolates from Huila and in 45.24% of isolates from Santander (Table 2 and 3). Race 3 was identified in 16.67% of isolates from Huila and in 11.9% of isolates from Santander. Sixty three isolates of P. nicotianae were accurately identified as race R0, R1 or R3. For remaining eight isolates it was not possible to determine a known Physiological race and were classified as IND (Not determined) (Table 2 and 3). Seven days after the inoculation, symptoms such as chlorosis, plant wilt, dark radicular system, general necrosis and death of the seedling, typical of plant reaction to races, were observed (Figure 3). Cv. NC 1071 showed complete resistance to R0, cv. KY 14 x L8 and L8 showed low resistance to both races, allowing a clear identification of R0 and R3 according to what was reported previously (Gutiérrez and Mila, 2007; Gallup & Shew, 2010; Gallup et al., 2018). Isolate No. 61 - CPN 02 used as a reference, kindly donated by Dr. Alex Csinos from University of Georgia, USA and certified as R0, reproduced the typical expected reactions supporting its previous classification. To the best of our knowledge, it is the first time that R3 is identified in Colombian tobacco fields. Significant differences in the pathogenicity index between the races of P. nicotianae (P = 0.05) were identified with Race 3 showing the highest PI value (Figure 4).

Table 3:
Incidence and number of isolates of each race found in each Department of Colombia

Race / Department	Santander	Huila	Other Departments	Total	Incidence (%)
R0	19	3	9	31	43.66
R1	12	10	2	24	33.8
R3	5	3	0	8	11.27
IND	6	2	0	8	11.27
Total number of isolates / Department	42	18	11	71	100

Figure 3:
Tobacco differential host assay for identification of physiological races of P. nicotianae. Plants showing symptoms 14 days after inoculation: a) plant showing R1 race response b) plant showing R0 response, c) plants showing R3 race response, d) seedlings showing wilting, chlorosis, necrosis and death.

Figure 4:
Pathogenicity index of P. nicotianae races isolates in Colombia. Asterisk indicates significant differences between races by Kruskall- Wallis test (p < 0.05), PI: Pathogenicity index. IND: race not-determined.

Morphological Characterization of P. nicotianae

Isolates of P. nicotianae from tobacco growing areas of Santander and Huila, presented very similar morphological characteristics with no significant differences between Races. Table 4 shows relevant micro-morphometric results for each race such as sporangia, chlamydospores and hyphae shape, type of sporangiophore and differences on growth rate in culture media (Figure 5).

Figure 5:
Morphological characteristics of P. nicotianae isolates from Colombia: Sporangia shape: A) pyriform, B) obpyriform, F) spherical. Pedicle length: C) short, D) medium, E) long, F) ND. chlamydospore position: G) terminal, H) intercalary. Sporangia exit pore: I) narrow, J) medium, K) wide. Hypha form: L) smooth, M) curled, N) spiral. Formation of hyphal swellings: O) swellings, P) non-swellings.

Table 4:
Morphological characteristics of P. nicotianae Races 0, 1, 3 and the group of isolates with undetermined race

MORPHOLOGICAL FEATURES	CHARACTERISTIC DESCRIPTION	RACE
		RACE 0	RACE 1	RACE 3	RU
COLONY PATTERN OBSERVED	cottony mycelium (cm), fluffy mycelium (fm), rosette (rm), radiate (ram), and clustered (clum)	cm 44,19%; fm 33,56%.	cm 37,40%; fm 31,58%	fm 32,12%; cm 19,06%	fm 51,01%; cm 21,05%
COLONY COLORS	white, yellow	white 87,5%	white 81,97%	white 75,45%	white 82,18%
SPORANGIOPHORE FORM	branched-Unbranched	Unbranched 64,79%	Unbranched 56,20%	Unbranched 71,48%	Unbranched 64,79%
SPORANGIA SHAPE	spherical-Ovoid-Ellipsoid-Pyriform Clavate	spherical 54,04%; Pyriform 34,50%	spherical 60,65%; Pyriform 29,65%	Spherical 49,81%; Pyriform 36,82%	spherical 53,03%; Pyriform34,41%
SPORANGIA PAPILLAE	papillate (size ≥3.5 μm)-semipapillate (size < 3.5 μm)	Papillate 81,16%	Papillate 77,90%	Papillate 77,26 %	Papillate 83,40%
PEDICLE LENGTH	short (< 5 µm) -medium (5-20 µm)-long (> 20µm)-ND	short 28,87%; ND 24,47%	ND 29,55%; short 29,15%	short 26,71%; ND 25,27%	ND 29,55%; short 29,15%
SPORANGIA DIMENSIONS	Length / width (l / w ratio µm)	1,27 ± 0,036	1,24 ± 0,016	1,26 ± 0,051	1,28 ± 0,029
SPORANGIA EXIT PORE	narrow-Medium-wide-ND	ND 83,80%	ND 74,03%	ND 76,17%	ND 83,80
HYPHAL FORM	smooth-curve-spiral	smooth 72,76%	smooth 77,84%	smooth 73,76%	smooth 80,83%
FORMATION OF HYPHAL SWELLINGS	swellings / Non swellings / angle > 90° / angle < 90°	non swellings 69,7%; angle < 90° (34,8%)	non swellings 70,9%; angle < 90° (31.3%)	non swellings 73,4%; angle < 90° (30,7%)	non swellings 69%; angle < 90° (34,3%)
FORMATION OF CHLAMYDOSPORES	formed-absent	formed 98%	formed 93%	formed 92%	formed 96%
CHLAMYDOSPORES POSITION	intercalary and terminal	intercalary 70%	intercalary 77%	intercalary 70%	intercalary 59%
CHLAMYDOSPORES DIMENSIONS	Length / width (l / b ratio µm)	1,0280 ± 0,013	1,0254 ± 0,023	1,0118 ± 0,040	1,0271 ± 0,025
Number Isolated Totals Observed / Race		568	516	277	247

• RU= Unknown race. ND= character non determined due to either loss, lack of information or not present in the isolate. Colony pattern was determined in oat grain-agar culture medium.

Culture medium: White colony color predominate on different media culture, mostly with fluffy and cottony texture, best growth temperature was 23 ± 1 °C, which is within the range reported for the species (Abad, 2008). Hyphae: irregular in relation to the angle of insertion and thickness, mostly smooth, showing some curves or spirals with thin and coenocytic walls (Figure 5), characteristics that correspond to those reported for P. nicotianae (Lucas, 1975; Erwin & Ribeiro, 1996; Álvarez et al., 2007; Meng et al., 2014). A large percentage of hyphae had a non-bloated growth rate with an insertion angle less than 90° as reported before (Hall, 1993; Erwin & Ribeiro, 1996) (Table 4, Figure 5), but in contrast to observations reported by Meng et al. (2014), who described sporadic presence of swollen hyphae. Sporangiophores: generally unbranched, indeterminate growth and branch out sympodially, in agreement to what was described previously (Waterhouse, 1963) (Figure 5). Sporangia: mostly (Figure 5), as reported (Waterhouse, 1963; Hall, 1993; Meng et al., 2014). Sporangia varied slightly in shape and size, with spherical and pyriform shape as the most abundant (Figure 5), with an average size of 37.15 x 28 μm (L x W) and a ratio of 1.26 (Figure 5 and 6), which was within the range reported for the species (Stamps et al., 1990; Hall, 1993; Abad, 2008).

In most isolates sporangia were papillated with very short or no pedicel present, few sporangia were semi-papillated and showed medium or long pedicels, with size within the ranges described by Stamps et al. (1990) (Figure 5). Statistical differences in sporangia size were identified between different races of isolates; Races 0, 1 and isolates for which a race was not possible to be determined (IND isolates) had higher size ratio (L x W) than isolates of R3 (Figure 6A). All sporangia measurements were within the range reported for P. nicotianae. In addition, isolates showed statistical differences in sporangia size according to their geographic origin; isolates from Huila showed smaller sporangia compared with those from Santander. Evenmore, smallest sporangia were measured in the group of isolates from Huila for which a race was not determined (IND) (Figure 6B). Chlamydospores: spherical in shape and mostly intercalary, with size (LxW) 30.33 x 28.69 μm and a ratio of 1.023 on average (Figure 5 and 6A), terminal chlamydospores were also found (Figure 5). Chlamydospores from isolates in race 1 were significantly smaller than chlamydospores from isolates in race 0, 3 and IND (Figure 6A). Similarly as found for sporangia size, isolates from Huila for which it was not possible to determine a race (IND-HUI) exhibited chlamydospores smaller than isolates from other Departments and races (Figure 6B). As found for sporangia, all chlamydopore measurements were within the range reported for P. nicotianae. All isolates grew at 23 ± 1ºC, a temperature within the optimum range reported for P. nicotianae (Erwin & Ribeiro, 1996; Gallegly & Hong, 2008).

Figure 6:
Relationship between sporangia and chlamydospore size ratio (L x W), races and Department of collection of P. nicotianae isolates. A) Graph showing relationship between sporangia and chlamydospore size ratio (L x W) with races of P. nicotianae. B) Interaction between sporangia and chlamydospore size ratio (L x W) with races and Department of collection of P. nicotianae isolates. Asterisks represent significant differences between races determined by the Kruskall- Wallis test (p < 0.05). IND = race not determined, HUI: Huila, SAN: Santander, QUI: Quindío, BOY: Boyacá, TOL: Tolima, VAL: Valle.

DISCUSSION

One of the first and most important steps for a prompt and appropriate integrated disease management program is the early and accurate identification of the causal agent. In the present research we identified 71 isolates causing the black shank disease in tobacco crops in the tobacco growing areas of Colombia, by immunological-based ELISA test, DNA amplification of specific fragments and morphology. We used the ELISA test for identification at the genus level and PCR-amplified DNA to the species level, because detection of pathogens using PCR is at least 10 times more sensitive than ELISA and ELISA test allows the identification only up to genus level (Peteira et al., 2008). In addition to P. nicotianae, other species of oomycetes have been reported causing diseases in tobacco such as Phytophthora spp. and Pythium spp. causing damping-off, P. glovera causing yellow stunt, (Abad et al., 2011), Peronospora tabacina causing blue mold or downy mildew (Derevnina et al., 2015) and others, that may be confused between them, highlighting the importance of correct identification for appropriate disease management. Even though, morphological parameters are important and valid for genus identification in Phytophthora and related oomycetes, it is laborious and requires high levels of experience. Molecular identification is nowadays an important tool that may be combined with morphological data for a more accurate identification of Phytophthora species and contributes to perform a more efficient management disease strategy for tobacco and other crops (Peteira et al., 2008).

P. nicotianae pathogenicity depends on the environment and the cultivar affected and is very important to quantify disease development as a tool for tobacco breeding programs. The pathogenicity index (PI) is a measure that reflects the magnitude and speed of disease development (Apple, 1957), being useful for genotype selection in tobacco fields. In the present research, P. nicotianae isolates induced symptoms as early as 24 hours after inoculation. Other authors had reported first disease symptoms 18 hours, post inoculation of tobacco plants (Meng & Wang, 2010), suggesting short incubation periods of P. nicotianae populations on cultivated genotypes of tobacco. In addition, most isolates tested here showed high PI values and cause plant death at 14 dai, indicating high aggressiveness and pathogen populations well adapted to the tobacco cultivars commonly grown in Colombia (Panabières et al., 2016). This finding is very important because implies that much more effort should be done in basic and applied research to support the tobacco breeding programs looking for resistant varieties to P. nicotianae.

Physiological races have been extensively used for characterization of plant pathogen populations (Flor, 1971). Pathogen races are determined according to the plant reaction when a given genotype of the plant host recognizes or not a given strain of the pathogen. When the plant recognizes the pathogen, the response leads to the hypersensitive response, a form of a programmed cell death similar to apoptosis in mammals (Pitsili et al., 2020). This reaction usually happens in a gene-for-gene interaction manner (Flor, 1971). Characterization of pathogen populations is useful to deploy commercial cultivars with genes conferring resistance to prevalent races of the pathogen in field crops. Here, we identified Races 0, 1 and 3 of P. nicotianae. It is the first time that race 3 is detected in Colombia, with incidences of 17% in the Department of Huila and 12% in Santander. Interestingly, for a group of isolates (ND) it was not possible to determine a given race. Considering controls and replicates if errors in the methods used are ruled out, it is reasonable to speculate that those isolates were not recognized by plant differentials used in the present research. Hence, genetic variants in pathogen populations of Colombia may exist, suggesting the need of further research on P. nicotianae diversity studies involving advanced methods such as multi-loci genotyping or even whole genome sequence analyses. Sexual recombination by crossing the A1 and A2 mating types maybe a source of new variants, although it is important to highlight that in asexual reproduction of filamentous microorganisms there are other sources of generation of genetic variation such as parasexuality, hyphal anastomosis, heterokaryon formation and others. Evenmore, the relative frequency of A1 and A2 isolates in P. nicotianae populations is often biased in nature, suggesting that the role of sexual reproduction may be less important than generally considered, and that the threat of emergence of new virulences generated by oospore production may be overestimate (Panabières et al., 2016). In the tree pathogen P. ramorum, structural variants (SVs) arising from somatic mutations considerable contribute to genetic variation within the pathogen population and parallel overlap of SVs with genes involved in pathogenicity such as RXLRs have the potential to change the course of an epidemic (Yuzon et al., 2020). In oomycetes such as P. nicotianae, the RXLRs proteins have been closely related with race structure since RXLRs genes encode for avirulence proteins recognized by R resistance proteins in the host plant, highlighting the importance of asexual reproduction in the pathogen race structure. However, sexual reproduction by mating types is important in pathogen populations. Since in the present research the mating type of isolates was not determined, it would be worth of further research to identify which mating types reported for P. nicotianae are present in Colombia and if sexual reproduction eventually has incidence in the pathogen population diversity and virulence observed.

High incidence in the Department of Santander of Races 1 (28.57%) and 3 (11.9%) (Table 2 and 3), may be due to continuous use of commercial varieties with complete, high or partial resistance to Race 0, exerting selection pressure that results in an increase in frequency of other pathogen races not recognized by current grown varieties (Csinos, 2005). Similar results have been observed in a number of pathosystems including Nicotiana spp. - P. nicotianae (Sullivan et al., 2010). Host specific lineages have been reported for P. nicotianae, evidence suggests that isolates may be more aggressive in their host of origin than in other plant hosts and clonality prevails in pathogen populations suggesting asexual dispersion (Mammella et al., 2013; Biasi et al., 2016; Chowdappa et al., 2016). Lamour et al. (2003) evaluated isolates from different geographic areas and observed a similar compatibility between them and the host, a characteristic maybe due to asexual reproduction of P. nicotianae. This suggested that asexual reproduction perhaps is the most frequent type in the tropics and may play an important role in pathogen dissemination and epidemics, which must be confirmed in Colombian populations of P. nicotianae not only from tobacco but from other plant hosts. As found in USA, most isolates collected from Colombia were highly aggressive independently of the geographical region of origin, which may indicate high adaptation to most commercial cultivars grown (Sullivan et al., 2010), which prompt for research on cultivars with novel genes for resistance to P. nicotianae as part of an integrated black shank disease management (Sullivan et al., 2005a,b; Nifong et al., 2011; McCorkle et al., 2013).

Micro-morphometric analyses have been successfully applied for the characterization of Phytophthora spp. populations including P. nicotianae (Hall, 1993; Appiah et al., 2003). Authors have shown morphological characteristics that may be used for P. nicotianae differentiation. Hall (1993) and Abad (2008) reported variation in sporangia size in different isolates of P. nicotianae and Gallegly & Hong (2008) considered sporangia size as a relevant characteristic for accurate identification of Phytophthora species. However and in contrast, Erwin & Ribeiro (1996) pointed out that sporangia size perhaps is not relevant, since it varies with growth conditions of each isolate. In our work, sporangia size was significantly different between isolates for which a race was not possible to be determined (ND), compared to a group composed of isolates of races 0, 1 and 3, and in addition, isolates from Huila were smaller than those from Santander, suggesting variation in the Colombian population of P. nicotianae. However, all measurements were found to be within the range reported for P. nicotianae. As in our work only isolates from tobacco were analyzed, it would be important to broaden research including isolates from other hosts and geographical regions for a better understanding of ecology, genetics and dynamics of the P. nicotianae populations. Sporangia identified here were non-caducous, characteristic that easily differentiates P. nicotianae from P. palmivora, which has caducous sporangia. Chamydospore measurements agreed with those reported previously (Hall, 1993; Gallegly & Hong, 2008; Meng et al., 2014), but interestingly isolates of race 1 exhibited smaller chlamydospores than isolates of race 0, that together with sporangia size, results indicate morphometric differences between races. P. nicotianae mycelia have been described as arachnoid and tuffy as characteristic and sometimes enough for identification of this species. However, Hall (1993) stands out that isolates may vary according to environmental conditions and the growth media used for cultures. Hence, for accurate characterization of Phytophthora spp. populations is more appropriate the use of combined morphological and molecular methods (Meng & Wang, 2010; Li et al., 2015; Liu et al., 2016).

CONCLUSIONS

Morphological, pathogenic and molecular characterization of P. nicotianae populations in Colombia allowed the identification of 3 races of highly aggressive isolates and a group for which a known race was not possible to be determined. It is the first time that race 3 is reported in Colombia.

REFERENCES

• Abad G (2008) Methods for Identification of Phytophthora Species. In: APS Centennial Meeting 2008, Minneapolis. Proceedings, USDA. 01-41p.
• Abad ZG, Ivors KL, Gallup CA, Abad JA & Shew HD (2011) Morphological and molecular characterization of Phytophthora glovera sp. nov. from tobacco in Brazil. Mycologia, 103:341-50.
• Álvarez LA, Perez-Sierra A, Armengol J & Garcia-Jimenez J (2007) Characterization of Phytophthora nicotianae isolates causing collar and root rot of lavender and rosemary in Spain. Journal of Plant Pathology, 89:261-264.
• Álvarez E, Ospina CA, Mejía JF & Llano GA (2004) Caracterización morfológica, patogénica y genética del agente causal de la antracnosis (Colletotrichum gloeosporioides) en guanábana (Annona muricata). Fitopatología Colombiana, 28:01-08.
• Appiah AA, Flood J, Bridge PD & Archer SA (2003) Inter- and intraspecific morphometric variation and characterization of Phytophthora isolates from cocoa. Plant Pathology, 52:168-180.
• Apple JL (1957) Pathogenic, Cultural and physiological variation within Phytophthora parasitica var. nicotianae. Phytopathology, 47:733-739.
• Apple JL (1962) Physiological specialization within Phytophthora parasitica var. nicotianae Phytopathology , 52:351-354.
• Apple JL (1967) Ocurrence of race 1 of Phytophthora parasitica var. nicotianae in North Carolina and its implications in breeding for disease resistance. Tobacco Science, 11:79-83.
• Biasi A, Martin FN, Cacciola SO, di San Lio GM, Grünwald NJ & Schena L (2016) Genetic analysis of Phytophthora nicotianae populations from different hosts using microsatellite markers. Phytopathology , 106:1006-1014.
• Bowman D & Sisson V (2000) A historical overview of flue-cured tobacco breeding in the U.S.A. Tobacco Science , 44:59-64.
• Carlson SR, Wolff MF, Shew HD & Wersnsman EA (1997) Inheritance of resistance to race 0 of Phytophthora parasitica var. nicotianae from the flue-cured tobacco cultivar Coker 371-Gold. Plant Disease, 81:1269-1274.
• Chowdappa P, Kumar BJN, Kumar SPM, Madhura S, Bhargavi BR & Lakshmi MJ (2016) Population structure of Phytophthora nicotianae reveals host-specific lineages on brinjal, ridge gourd, and tomato in South India. Phytopathology , 106:1553-1562.
• Csinos AS (2005) Relationship of isolate origin to pathogenicity of race 0 and 1 of Phytophthora parasitica var. nicotianae on tobacco cultivars. Plant Disease , 89:332-337.
• Csinos AS & Bertrand PF (1994) Distribution of Phytophthora parasitica var. nicotianae races and their sensitivity to metalaxyl in Georgia. Plant Disease , 78:471-474.
• Derevnina L, Chin-Wo-Reyes S, Martin F, Wood K, Froenicke L, Spring O & Michelmore R. (2015). Genome Sequence and Architecture of the Tobacco Downy Mildew Pathogen Peronospora tabacina Molecular Plant Microbe Interactions, 28:1198-215.
• Erwin DC & Ribeiro OK (1996) Phytophthora Diseases Worldwide. St Paul, American Phytopathological Society. 562p.
• Flor H (1971) Current Status of the Gene-For-Gene Concept. Annual Review of Phytopathology , 9:275-296.
• Gallegly ME & Hong C (2008) Phytophthora: Identifying Species by Morphology and DNA Fingerprints. St. Paul, American Phytopathological Society. 108p.
• Gallup CA, McCorkle KL, Ivors KL & Shew D (2018) Characterization of the Black Shank Pathogen, Phytophthora nicotianae, Across North Carolina Tobacco Production Areas. Plant Disease , 102:1108‐1114.
• Gallup CA & Shew HD (2010) Ocurrence of race 3 of Phytophthora nicotianae in North Carolina, the causal agent of black shank of tobacco. Plant Disease , 94:557-562.
• Gallup CA & Shew HD (2006) Race stability in Phytophthora nicotianae, the causal agent of black shank of tobacco. Phytopathology , 96:S37.
• Gutiérrez WA & Mila LA (2007) A rapid technique for determination of races of Phytophthora nicotianae on tobacco. Plant Disease , 91:985-989.
• Hall G (1993) An integrated approach to the analysis of variation in Phytophthora nicotianae and a redescription of the species. Mycological Research, 97:559-574.
• Johnson ES, Wolff MF & Wernsman EA (2002) Origin of the black shank resistance, gene, Ph, in tobacco cultivar Coker 371 Gold. Plant Disease , 86:1080-1084.
• Lamour KH (2013) Phytophthora: a global perspective. Knoxville, CAB International. 256p.
• Lamour KH, Daughtrey ML, Benson DM, Hwang J & Hausbeck MK (2003) Etiology of Phytophthora drechsleri and P. nicotianae (=P. parasitica) diseases affecting floriculture crops. Plant Disease , 87:854-858.
• Li B, Liu P, Xie S, Yin R, Weng Q & Chen Q (2015) Specific and Sensitive Detection of Phytophthora nicotianae by Nested PCR and Loop‐mediated Isothermal Amplification Assays. Journal of Phytopathology , 163:185-193.
• Liu H, Ma X, Yu H, Fang D, Ki Y, Wang X, Wang W & Dong Y (2016) Genomes and virulence difference between two physiological races of Phytophthora nicotianae Gigascience, 5:3.
• Lucas GB (1975) Diseases of Tobacco. Black Shank. 3^rd ed. Raleigh, Biological Consulting Associates. 239p.
• Mammella MA, Martin FN, Cacciola SO, Coffey MD, Faedda R & Schena L (2013) Analyses of the population structure in a global collection of Phytophthora nicotianae isolates inferred from mitochondrial and nuclear DNA sequences. Phytopathology , 103:610-622.
• McCorkle K, Lewis R & Shew D (2013) Resistance to Phytophthora nicotianae in tobacco breeding lines derived from variety Beinhart 1000. Plant Disease , 97:252-258.
• McIntyre JL & Taylor GS (1978) Race 3 of Phytophthora nicotianae var. Parasitica Phytopathology , 68:35-38.
• Meng J, Zhang Q, Ding W & Shan W (2014) Phytophthora parasitica: A Model Oomycete Plant Pathogen. Mycology, 5:43-51.
• Meng J & Wang Y (2010) Rapid Detection of Phytophthora nicotianae in Infected Tobacco Tissues and Soil Samples Based on Its Ypt1 Gene. Journal of Phytopathology , 158:01-07.
• Monday OA, Yin L & Koji K (2010) Development of SCAR markers and PCR assays for single or simultaneous species-specific detection of Phytophthora nicotianae and Pythium helicoides in ebb-and-flow irrigated kalanchoe. Journal of Microbiological Methods, 83:260-265.
• Nifong JM, Nicholson JS, Shew HD & Lewis RS (2011) Variability for resistance to Phytophthora nicotianae within a collection of Nicotiana rustica accessions. Plant Disease , 95:1443-1447.
• Panabières F, Shad AG, Bechir MA, Dalio R, Gudmestad N, Kuhn M, Guha S, Schena L & Zampounis A (2016) Phytophthora nicotianae diseases worldwide: new knowledge of a long-recognised pathogen. Phytopathologia Mediterranea, 55:20-40.
• Peteira B, Toledo V & Martínez B (2008) Variabilidad Molecular en Aislamientos de Phytophthora nicotianae Van Breda de Haan. Revista de Protección Vegetal, 23:183-190.
• Pitsili E, Phukan UJ & Coll NS (2020) Cell Death in Plant Immunity. Cold Spring Harbor Perspectives in Biology, 12: a036483.
• Shew HD (1987) Effect of Host Resistance on Spread of Phytophthora parasitica var. nicotianae and Subsequent Development of Tobacco Black Shank Under Field Conditions. Phytopathology , 77:1090-1093.
• Stamps DJ, Waterhouse GM, Newhook FJ & Hall GS (1990) Revised tubular key to the species of Phytophthora 2^a ed. Kew, CAB International. 28p.
• Sullivan MJ, Parks EJ, Cubeta MA, Gallup CA, Melton TA, Moyer JW & Shew HD (2010) An Assessment of the Genetic Diversity in a Field Population of Phytophthora nicotianae with a Changing Race Structure. Plant Disease , 94:455-460.
• Sullivan MJ, Melton TA & Shew HD (2005a) Fitness of races 0 and 1 of Phytophthora parasítica var. nicotianae. Plant Disease , 89:1220-1228.
• Sullivan MJ, Melton TA & Shew HD (2005b) Managing the race structure of Phytophthora parasitica var. nicotianae with cultivar rotation. Plant Disease , 89:1285-1294.
• Van Jaarsveld E, Wingfield MJ & Drenth A (2002) Evaluation of Tobacco Cultivars for Resistance to Races of Phytophthora nicotianae in South Africa. Journal of Phytopathology , 150:456-462.
• Waterhouse GM (1963) Key to the species of Phytophthora de Bary. Mycological Papers, 92:01-22.
• Wilkinson CA, Reed TD, Johnson CS & Jones JL (2003) Flue cured tobacco variety information for 2003. Blackstone, Southern Piedmont Agricultural Research and Extension Center. 7p. (Publication Number 436).
• Xiao B, Drake K, Vontimitt AV, Tong Z, Zhang X, Li M, Leng X, Li Y & Lewis R (2013) Location of Genomic Regions Contributing to Phytophthora nicotianae Resistance in Tobacco Cultivar Florida 301. Crop Science, 53:473-481.
• Yuzon JD, Travadon R, Malar CM, Tripathy S, Rank N, Mehl HK, Rizzo DM, Cobb R, Small C, Tang T, McCown HE, Garbelotto M & Kasuga T (2020) Asexual Evolution and Forest Conditions Drive Genetic Parallelism in Phytophthora ramorum Microorganisms, 8:940

Publication Dates

• Publication in this collection
  14 Jan 2022
• Date of issue
  Jan-Feb 2022

History

• Received
  04 June 2020
• Accepted
  07 Mar 2021