Iron from haemoglobin and haemin modulates nucleotide hydrolysis inTrichomonas vaginalis

Abstract

Extracellular ATP may act as a danger signalling molecule, inducing inflammation and immune responses in infection sites. The ectonucleotidases NTPDase and ecto-5’-nucleotidase are enzymes that modulate extracellular nucleotide levels; these enzymes have been previously characterised in Trichomonas vaginalis. Iron plays an important role in the complex trichomonal pathogenesis. Herein, the effects of iron on growth, nucleotide hydrolysis and NTPDase gene expression in T. vaginalis isolates from female and male patients were evaluated. Iron from different sources sustainedT. vaginalis growth. Importantly, iron from haemoglobin (HB) and haemin (HM) enhanced NTPDase activity in isolates from female patients and conversely reduced the enzyme activity in isolates from male patients. Iron treatments could not alter the NTPDase transcript levels in T. vaginalis. Furthermore, our results reveal a distinct ATP, ADP and AMP hydrolysis profile between isolates from female and male patients influenced by iron from HB and HM. Our data indicate the participation of NTPDase and ecto-5’-nucleotidase in the establishment of trichomonas infection through ATP degradation and adenosine production influenced by iron.

Trichomonas vaginalis; iron; nucleoside triphosphate diphosphohydrolase; ecto-5’-nucleotidase; nucleotide hydrolysis

Trichomonosis caused by the flagellate protozoan Trichomonas vaginalisrepresents the most prevalent nonviral sexually transmitted disease worldwide (WHO-DRHR 2012). In women, the symptoms are cyclic and often worsen around the menstruation period. In men, trichomonosis is largely asymptomatic and these men are considered to be carriers of T. vaginalis (Petrin et al. 1998). This infection has been associated with birth outcomes (Klebanoff et al. 2001), infertility (Grodstein et al. 1993), cervical and prostate cancer (Viikki et al. 2000, Sutcliffe et al. 2012) and pelvic inflammatory disease (Cherpes et al. 2006). Importantly, T. vaginalis is a co-factor in human immunodeficiency virus transmission and acquisition (Sorvillo et al. 2001, Van Der Pol et al. 2008). Therefore, it is important to study the host-parasite relationship to understand T. vaginalisinfection and pathogenesis. Colonisation of the mucosa by T. vaginalisis a complex multi-step process that involves distinct mechanisms (Alderete et al. 2004). The parasite interacts with mucin (Lehker & Sweeney 1999), adheres to vaginal epithelial cells (VECs) in a process mediated by adhesion proteins (AP120, AP65, AP51, AP33 and AP23) and undergoes dramatic morphological changes from a pyriform to an amoeboid form (Engbring & Alderete 1998,Kucknoor et al. 2005, Moreno-Brito et al. 2005). After adhesion to VECs, the synthesis and gene expression of adhesins are increased (Kucknoor et al. 2005). These mechanisms must be tightly regulated and iron plays a pivotal role in this regulation.

Iron is an essential element for all living organisms, from the most primitive to the most complex, as a component of haeme, iron-sulphur clusters and a variety of proteins. Iron is known to contribute to biological functions such as DNA and RNA synthesis, oxygen transport and metabolic reactions. T. vaginalis has developed multiple iron uptake systems such as receptors for hololactoferrin, haemoglobin (HB), haemin (HM) and haeme binding as well as adhesins to erythrocytes and epithelial cells (Moreno-Brito et al. 2005, Ardalan et al. 2009). Iron plays a crucial role in the pathogenesis of trichomonosis by increasing cytoadherence and modulating resistance to complement lyses, ligation to the extracellular matrix and the expression of proteases (Figueroa-Angulo et al. 2012). In agreement with this role, the symptoms of trichomonosis worsen after menstruation. In addition, iron also influences nucleotide hydrolysis in T. vaginalis(Tasca et al. 2005, de Jesus et al. 2006).

The extracellular concentrations of ATP and adenosine can markedly increase under several conditions such as inflammation and hypoxia as well as in the presence of pathogens (Robson et al. 2006, Sansom 2012). In the extracellular medium, these nucleotides can act as immunomodulators by triggering immunological effects. Extracellular ATP acts as a proinflammatory immune-mediator by triggering multiple immunological effects on cell types such as neutrophils, macrophages, dendritic cells and lymphocytes (Bours et al. 2006). In this sense, ATP and adenosine concentrations in the extracellular compartment are controlled by ectoenzymes, including those of the nucleoside triphosphate diphosphohydrolase (NTPDase) (EC: 3.1.4.1) family, which hydrolyze tri and diphosphates and ecto-5’-nucleotidase (EC: 3.1.3.5), which hydrolyses monophosphates (Zimmermann 2001). Considering that de novo nucleotide synthesis is absent in T. vaginalis (Heyworth et al. 1982,1984), this enzyme cascade is important as a source of the precursor adenosine for purine synthesis in the parasite (Munagala & Wang 2003). Extracellular nucleotide metabolism has been characterised in several parasite species such as Toxoplasma gondii, Schistosoma mansoni, Leishmania spp, Trypanosoma cruzi, Acanthamoeba, Entamoeba histolytica, Giardia lamblia and fungi,Saccharomyces cerevisiae, Cryptococcus neoformans, Candida parapsilosisand Candida albicans (Sansom 2012). In T. vaginalis, NTPDase and ecto-5’-nucleotidase activities have been characterised and they are involved in host-parasite interactions by controlling ATP and adenosine levels (Matos et al. 2001, d, de Jesus et al. 2002, Tasca et al. 2003).

Considering that (i) iron plays a crucial role in the pathogenesis of trichomonosis, (ii) ATP exerts a proinflammatory effect in inflammation, (iii) adenosine is important toT. vaginalis growth and acts as an antiinflammatory factor (Frasson et al. 2012) and (iv) ectonucleotidases modulate the nucleotide levels at infection sites (such as those observed in trichomonosis), the aim of this study was to investigate the effect of iron on the extracellular nucleotide hydrolysis and gene expression of T.vaginalis.

SUBJECTS, MATERIALS AND METHODS

Parasite cultures - T. vaginalis isolates 30236 and 30238 from American Type Culture Collection, TV-LACM1 and TV-LACM2 (fresh clinical isolates from female patients) and TV-LACH1 and TV-LACH2 (fresh clinical isolates from male patients), all from Clinical and Toxicological Analysis Laboratory, Faculty of Pharmacy, Federal University of Rio Grande do Sul (UFRGS), Brazil (UFRGS Ethical Committee, project 18923) were used in this study. The parasites were cultured in trypticase-yeast extract-maltose (TYM) medium (Diamond 1957), pH 6.0, supplemented with 10% heat-inactivated bovine serum and incubated at 37ºC. Organisms in the logarithmic phase of growth and exhibiting motility and normal morphology were used in the experiments.

Iron treatment - Low-iron-grown trichomonads were obtained by cultivating T. vaginalis at a starting density of 2.0 x 10⁵ trophozoites/mL in TYM-serum containing 50 μM of the iron chelator 2,2-bipyridyl (2,2-BP) at 37ºC for 24 h (Lehker et al. 1991). These organisms were then suspended in TYM-serum supplemented with 50 μM 2,2-DP for an additional 24 h before experiments. To obtain different iron-organism conditions, low-iron parasites were washed once and suspended in TYM-serum medium containing (i) 50 μM 2,2-BP, (ii) 25 μM protoporphyrin (PP), (iii) 100 μM ferrous sulphate (FS), (iv) 25 μM HB or (v) 25 μM HM and incubated for 24 h at 37ºC as the control (untreated organisms), representing 72 h of iron treatment. All experiments were performed at least three times in triplicate with different trophozoite suspensions. The iron chelator 2,2-BP, PP, FS, HB and HM were purchased from Sigma Chemical Co (USA).

Kinetic growth assay - Kinetic growth curves were performed with all isolates at an initial density of 2.0 x 10⁵ trophozoites/mL in TYM medium supplemented with 2,2-BP, PP, FS, HB and HM, as previously described. The trophozoites were counted using a haemocytometer, considering motility and normal morphology and were expressed as 10⁶ trophozoites/mL. Growth experiments were performed in triplicate on at least three different occasions.

Enzyme assays - After 72 h of iron treatment, parasites were immediately harvested and washed three times with a 0.9-0.2% NaCl-glucose solution. The reaction mixture contained 50 mM Tris buffer (pH 7.2) and 5.0 mM CaCl₂ for measuring ATP and ADP hydrolysis (Matos et al. 2001) and 50 mM Tris buffer (pH 7.5) and 3.0 mM MgCl₂ for quantifying AMP hydrolysis (Tasca et al. 2003). The intact trophozoites were added to the reaction mixture and the reaction was started by adding substrate (1.0 mM ATP or ADP or 3.0 mM AMP). ATP, ADP or AMP hydrolysis was stopped by adding 200 μL of 10% trichloroacetic acid and chilling on ice for 10 min before assaying the release of inorganic phosphate (Pi) (Chan et al. 1986). The incubation time and protein concentration were defined based on curves that were previously determined for linearity of the reactions for each isolate used (data not shown). Controls with intact organisms added to the reaction mixtures after the reaction was stopped were used to correct for non-enzymatic hydrolysis of the substrates. The specific activity was expressed as nmol Pi/min/mg protein. All samples were run in triplicate and similar results were achieved in at least three different parasite suspensions.

Protein measurement - Protein was measured according to the Coomassie Blue method (Bradford 1976) using bovine serum albumin as standard.

Analysis of gene expression by reverse transcriptase-polymerase chain reaction (RT-PCR) - Semiquantitative RT-PCR assay was performed with HB and HM treated-organisms. The NTPDase sequences were found using the BLAST function of the GenBank database and specific primers for NTPDase A and B were designed (Table) (Carlton et al. 2007). RNA extraction was performed using TRIzol reagent (Invitrogen, USA) in accordance with the manufacturer’s instructions. Afterwards, cDNA species were synthesised using the ImProm-II™ Reverse Transcription System (Promega^®) following the supplier’s instructions. All conditions for PCR were described in previous studies (Kucknoor et al. 2005, Giordani et al. 2010).

TABLE
Polymerase chain reaction (PCR) primers design

Enzymes	Primer sequences	Anneling temperature (°C)	PCR product (bp)	GenBank accession (mRNA)
NTPDase A	F - TGAAGAAGAGTTGAAGGGCAAAG R - AATTCTTCGACAGGAGGCATTG	53	342	XM_001298945
NTPDase B	F - CGACTACATCATCTCTTGCCGATC R - GACTCTCTTATGTATCTTTGGGCAG	53	397	XM_001579653
α-tubulin	F - CCAACATGATGGTTAAGTGCGATCCAC R - CAGCTTCTTCCATACCCTCACCGACG	61	355	XM_001330630

• NTPDase: nucleoside triphosphate diphosphohydrolase.

Statistical analysis - The results were expressed as the means ± standard deviations. Statistical analysis was conducted by ANOVA followed by Tukey’spost hoc multiple comparisons and Student’s ttest. Statistical significance was considered at p < 0.05. All analyses were performed using Statistical Package for the Social Sciences (SPSS) software v.14.

RESULTS

Lack of iron hampers T. vaginalis growth - T. vaginalis kinetic growth was analysed for all of the isolates; however, taking into account that the growth rate and iron requirement were comparable, a representative experiment using the 30236 isolate was shown (Fig. 1). The organisms were first counted 12 h after beginning the incubation. Subsequently, counts were performed every 24 h and compared to untreated cells. The control exhibited the classical growth peak after 24 h of incubation and trophozoites treated with PP, FS, HB and HM demonstrated a similar growth peak. However, 2,2-BP-treated parasites, i.e., those in a low-iron condition, did not exhibit a growth peak (Fig. 1) and reduced viability was observed (data not shown). Thus, the lack of iron in the culture medium impairedT. vaginalis growth.

Fig. 1
: Trichomonas vaginalis kinetic growth of a representative experiment performed with isolate 30236. Kinetic growth experiments with all T. vaginalis isolates were performed on three different occasions (different parasite suspensions), with similar results. Numbers of parasite densities were determined by a haemocytometer counting.

Iron from HB and HM modulates nucleotide hydrolysis - The effects of different iron treatments on ATP, ADP and AMP hydrolysis were evaluated inT. vaginalis. Cellular integrity was evaluated by assessing the motility and viability of the trophozoites by trypan blue exclusion before and after all enzyme assays. Trophozoite integrity was not affected by any iron treatment. Treatment with HB and HM induced a significant increase in ATP and ADP hydrolysis in 30236 and 30238 (long-term-growth isolates) and TV-LACM1 and TV-LACM2 (fresh clinical isolates) (Fig. 2A, D). However, the fresh clinical isolates, TV-LACH1 and TV-LACH2, treated with HB and HM exhibited significantly decreased ATP and ADP hydrolysis (Fig. 2E, F).

Fig. 2
: effect of the different iron treatments on Trichomonas vaginalis nucleoside triphosphate diphosphohydrolase (NTPDase) activity. Bars represent the mean ± standard deviation of three different experiments (parasite suspensions) performed in triplicate. Data from haemoglobin (HB) and haemin (HM) treatments were analysed by Student t test (p ≤ 0.05) (Statistical Package for the Social Sciences). *: ATP hydrolysis statistically different from control; #: ADP hydrolysis statistically different from control. BP: bipyridyl; FS: ferrous sulphate; PP: protoporphyrin; TV-LACH1 and TV-LACH2: fresh clinical isolates from male patients; TV-LACM1 and TV-LACM2: fresh clinical isolates from female patients.

Moreover, the effect of different iron treatments on ecto-5’-nucleotidase activity was evaluated. Notably, AMP was not hydrolysed in the TV-LACM1 and TV-LACM2 isolates under control or treatment conditions. Nevertheless, in the 30236 and 30238 isolates, HB and HM promoted a significant reduction in AMP hydrolysis (Fig. 3A, B). The TV-LACH1 and TV-LACH2 isolates treated with low iron levels demonstrated significantly higher AMP hydrolysis (Fig. 3C, D). In this context, it is possible to suggest that extracellular nucleotide hydrolysis is heterogeneous among T. vaginalis isolates.

Fig. 3
: effect of the different iron treatments on Trichomonas vaginalis ecto-5’-nucleotidase activity. Bars represent the mean ± standard deviation of three different experiments. Data were analysed by Student t test (p ≤ 0.05) (Statistical Package for the Social Sciences). Asterisk means AMP hydrolysis statistically different from control. BP: bipyridyl; FS: ferrous sulphate; HM: haemin; HB: haemoglobin; Pi: inorganic phosphate; PP: protoporphyrin; TV-LACH1 and TV-LACH2: fresh clinical isolates from male patients.

Iron did not affect NTPDase transcription - To assess the effect of HB and HM treatments on NTPDase gene expression, semiquantitative RT-PCR experiments were performed with all isolates. The different experimental conditions evaluated did not alter the NTPDase transcript levels in T. vaginalis (Fig. 4).

Fig. 4
: gene expression patterns for nucleoside triphosphate diphosphohydrolase (NTPDase) A and B after haemoglobin (HB) and haemin (HM) treatments in Trichomonas vaginalis 30236 and 30238, fresh clinical isolates from female patients (TV-LACM1 and TV-LACM2) and fresh clinical isolates from male patients (TV-LACH1 and TV-LACH2). Bars represent the mean ± standard deviation of three different experiments. C: control.

DISCUSSION

Iron is an essential cation for the growth and maintenance of T. vaginalisinfection and plays a crucial role in the pathogenesis of trichomonosis (Figueroa-Angulo et al. 2012). Although the human host contains abundant iron, there is no free iron in the vagina or in the male urethra and T. vaginalis has developed multiple iron systems to acquire iron from iron-binding (lactoferrin) and iron-containing (HB) proteins (Moreno-Brito et al. 2005, Ardalan et al. 2009). In this report and in agreement with a previous study (Alderete et al. 2004), under conditions that maintain sufficient amounts of iron to meet the metabolic requirements (culture with PP, FS, HB and HM), the parasites demonstrated a similar growth peak to the control. Notably, the parasites adequately grew under PP treatment because although PP does not possess an iron moiety, the metal was not removed from the culture medium with a chelator; thus, this situation was similar to the control. As expected, trichomonads cultured in low-iron medium, i.e., TYM supplemented with the iron chelator bipyridyl, which removes iron from culture medium, exhibited reduced growth in comparison with the control, showing the importance of iron for trichomonad survival.

Although free haeme produces oxidative effects and inflammation (Dutra & Bozza 2014), these events were not significant enough to cause damage because the parasites were still viable after treatments with distinct iron sources, as observed in the kinetic growth assays. Although it is a critical component of the pathological processes and causes tissue damage, haeme is used by T. vaginalis to obtain iron through the iron-binding, multifunctional proteins AP51 and AP65 (Ardalan et al. 2009). Moreover, T. vaginalis is a microaerophilic protozoan that has fully developed mechanisms of adaptation to oxygen fluctuations in infection sites (Ellis et al. 1994).

Furthermore, apart from the importance of iron in T. vaginalisgrowth and multiplication, our results demonstrated that haeme-iron modulates extracellular ATP, ADP and AMP hydrolysis. These findings are sustained by testing PP as a control of the haeme ring for the effects of HB and HM because PP does not contain iron. Therefore, iron has an effect on NTPDase and ecto-5’-nucleotidase activities. Although de Jesus et al. (2004)have shown that well-established and fresh clinical isolates present distinct virulence against epithelial cells, our data revealed that both long-term-growth and fresh clinical isolates presented increased NTPDase and reduced ecto-5’-nucleotidase activities after the treatment of parasites with HB and HM.

With the aim to determine the importance of these effects of iron during infection, we discussed the role of this modulation considering the proinflammatory function of ATP vs. the antiinflammatory effect of adenosine. Considering that the enzyme cascade that hydrolyses extracellular ATP to adenosine is modulated by iron, it is conceivable that this purinergic signalling regulated by iron is involved in the immune response to trichomonosis. In addition, we observed that modulation of the iron from HB and HM on nucleotide hydrolysis is in agreement with clinical findings because women are symptomatic; in this study, T. vaginalis from female patients showed (i) higher NTPDase activity (the degradation of cytotoxic and proinflammatory ATP) and (ii) lower ecto-5’-nucleotidase activity (lower adenosine production, lessened antiinflammatory effects), which contribute to the well-known production of exacerbated symptoms, particularly shortly after menstruation (when high levels of HB are found) (Petrin et al. 1998).

In contrast, NTPDase activity decreased when the fresh clinical isolates from male patients were treated with HB and HM and the ecto-5’-nucleotidase activity was higher in iron chelator-treated isolates from male patients. This findings support our hypothesis because compared with isolates from female patients, the opposite effect was observed among T. vaginalis isolates from male patients: (i) lower NTPDase activity, ATP accumulation, a unfavourable conditions for parasitism because of the cytotoxic and proinflammatory features of ATP and (ii) treatment with the iron chelator generated low levels of iron, which caused increased ecto-5’-nucleotidase activity and adenosine accumulation. These effects led to two consequences: first, an antiinflammatory milieu to attenuate symptoms (men are asymptomatic) and, second, trichomonads took up the accumulated adenosine, an essential nucleoside for metabolism, under these conditions as a strategy to overcome the hostile environment produced by the high ATP levels. Therefore, adenosine contributes to parasite survival and persistence, leading to infection silencing at male sites associated with an antiinflammatory milieu. These data are in agreement with recent studies by Sutcliffe et al. (2012) that demonstrated the relationship between T. vaginalisand prostate cancer.

To investigate the possible role of transcription factors on NTPDase activity, RT-PCR was performed. In this assay, only organisms treated with HB and HM were used because these organisms present significantly different ATP and ADP hydrolysis. Although all of the isolates present comparable expression patterns, treatment with HB and HM did not affect NTPDase transcription. Conversely, previous research has shown that iron modulates the gene expression of adhesins and proteinases involved in trichomonosis pathogenesis (Lehker et al. 1991, Garcia et al. 2003, Alderete et al. 2004, Kucknoor et al. 2005, Alvarez-Sanchez et al. 2007). This was not the case in the present study; it can be suggested that iron produced these effects through direct interactions with the enzymes. Moreover, these data reveal the promptness of the response of these isolates to microenvironment conditions because the effects of HB and HM were observed on NTPDase activity rather than at the transcriptional level. Further studies are necessary to explain the mechanism of iron modulation onT. vaginalis extracellular nucleotide hydrolysis.

Overall, the present study demonstrates the role of iron from HB and HM in T. vaginalis growth and extracellular nucleotide hydrolysis. Notably, our results suggest heterogeneity of the nucleotide hydrolysis profiles between isolates from female and male patients treated with HB and HM. These results contribute to the understanding of T. vaginalis infection through a fine regulation of NTPDase and ecto-5’-nucleotidase by iron, implicating purinergic signalling in the pathogenesis via antagonistic immune consequences produced by ATP and adenosine as well as a nucleoside-uptake strategy for survival.

REFERENCES

• Alderete JF, Nguyen J, Mundodi V, Lehker MW 2004. Heme-iron increases levels of AP65-mediated adherence by Trichomonas vaginalis Microb Pathog 36: 263-271.
• Alvarez-Sanchez ME, Solano-Gonzalez E, Yanez-Gomez C, Arroyo R 2007. Negative iron regulation of the CP65 cysteine proteinase cytotoxicity inTrichomonas vaginalis Microbes Infect 9: 1597-1605.
• Ardalan S, Lee BC, Garber GE 2009. Trichomonas vaginalis: the adhesins AP51 and AP65 bind heme and hemoglobin.Exp Parasitol 121: 300-306.
• Bours MJ, Swennen EL, Di Virgilio F, Cronstein BN, Dagnelie PC 2006. Adenosine 5’-triphosphate and adenosine as endogenous signaling molecules in immunity and inflammation. Pharmacol Therapeut 112: 358-404.
• Bradford MM 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248-254.
• Carlton JM, Hirt RP, Silva JC, Delcher AL, Schatz M, Zhao Q, Wortman JR, Bidwell SL, Alsmark UC, Besteiro S, Sicheritz-Ponten T, Noel CJ, Dacks JB, Foster PG, Simillion C, Van de Peer Y, Miranda-Saavedra D, Barton GJ, Westrop GD, Muller S, Dessi D, Fiori PL, Ren Q, Paulsen I, Zhang H, Bastida-Corcuera FD, Simoes-Barbosa A, Brown MT, Hayes RD, Mukherjee M, Okumura CY, Schneider R, Smith AJ, Vanacova S, Villalvazo M, Haas BJ, Pertea M, Feldblyum TV, Utterback TR, Shu CL, Osoegawa K, de Jong PJ, Hrdy I, Horvathova L, Zubacova Z, Dolezal P, Malik SB, Logsdon JM, Jr., Henze K, Gupta A, Wang CC, Dunne RL, Upcroft JA, Upcroft P, White O, Salzberg SL, Tang P, Chiu CH, Lee YS, Embley TM, Coombs GH, Mottram JC, Tachezy J, Fraser-Liggett CM, Johnson PJ 2007. Draft genome sequence of the sexually transmitted pathogen Trichomonas vaginalisScience 315: 207-212.
• Chan KM, Delfert D, Junger KD 1986. A direct colorimetric assay for Ca2₊-stimulated ATPase activity. Anal Biochem 157: 375-380.
• Cherpes TL, Wiesenfeld HC, Melan MA, Kant JA, Cosentino LA, Meyn LA, Hillier SL 2006. The associations between pelvic inflammatory disease,Trichomonas vaginalis infection and positive herpes simplex virus type 2 serology. Sex Transm Dis 33: 747-752.
• de Jesus JB, de Sa Pinheiro AA, Lopes AH, Meyer-Fernandes JR 2002. An ectonucleotide ATP-diphosphohydrolase activity in Trichomonas vaginalis stimulated by galactose and its possible role in virulence. Z Naturforsch C 57: 890-896.
• de Jesus JB, Ferreira MA, Cuervo P, Britto C, Silva-Filho FC, Meyer-Fernandes JR 2006. Iron modulates ecto-phosphohydrolase activities in pathogenic trichomonads. Parasitol Int 55: 285-290.
• de Jesus JB, Vannier-Santos MA, Britto C, Godefroy P, Silva-Filho FC, Pinheiro AAS, Rocha-Azevedo B, Lopes AHCS, Meyer-Fernandes JR 2004.Trichomonas vaginalis virulence against epithelial cells and morphological variability: the comparison between a well-established strain and a fresh isolate. Parasitol Res 93: 369-377.
• Diamond LS 1957. The establishment of various trichomonads of animals and man in axenic cultures. J Parasitol 43: 488-490.
• Dutra FF, Bozza MT 2014. Heme on innate immunity and inflammation.Front Pharmacol 5: 115.
• Ellis JE, Yarlett N, Cole D, Humphreys MJ, Lloyd D 1994. Antioxidant defences in the microaerophilic protozoan Trichomonas vaginalis: comparison of metronidazole-resistant and sensitive strains.Microbiology 140: 2489-2494.
• Engbring JA, Alderete JF 1998. Three genes encode distinct AP33 proteins involved in Trichomonas vaginalis cytoadherence.Mol Microbiol 28: 305-313.
• Figueroa-Angulo EE, Rendon-Gandarilla FJ, Puente-Rivera J, Calla-Choque JS, Cardenas-Guerra RE, Ortega-Lopez J, Quintas-Granados LI, Alvarez-Sanchez ME, Arroyo R 2012. The effects of environmental factors on the virulence of Trichomonas vaginalis Microbes Infect 14: 1411-1427.
• Frasson AP, Charão MF, Rosemberg DB, Souza AP, Garcia SC, Bonorino C, Bogo MR, De Carli GA, Tasca T 2012. Analysis of the NTPDase and ecto-5’-nucleotidase profiles in serum-limited Trichomonas vaginalis Mem Inst Oswaldo Cruz 107: 170-177.
• Garcia AF, Chang TH, Benchimol M, Klumpp DJ, Lehker MW, Alderete JF 2003. Iron and contact with host cells induce expression of adhesins on surface of Trichomonas vaginalis Mol Microbiol 47: 1207-1224.
• Giordani RB, Weizenmann M, Rosemberg DB, De Carli GA, Bogo MR, Zuanazzi JAS, Tasca T 2010. Trichomonas vaginalis nucleoside triphosphate diphosphohydrolase and ecto-5′-nucleotidase activities are inhibited by lycorine and candimine. Parasitol Int 59: 226-231.
• Grodstein F, Goldman MB, Cramer DW 1993. Relation of tubal infertility to history of sexually transmitted diseases. Am J Epidemiol 137: 577-584.
• Heyworth PG, Gutteridge WE, Ginger CD 1982. Purine metabolism inTrichomonas vaginalis FEBS Let 141: 106-110.
• Heyworth PG, Gutteridge WE, Ginger CD 1984. Pyrimidine metabolism inTrichomonas vaginalis FEBS Let 176: 55-60.
• Klebanoff MA, Carey JC, Hauth JC, Hillier SL, Nugent RP, Thom EA, Ernest JM, Heine RP, Wapner RJ, Trout W, Moawad A, Leveno KJ, Miodovnik M, Sibai BM, Van Dorsten JP, Dombrowski MP, O’Sullivan MJ, Varner M, Langer O, McNellis D, Roberts JM 2001. Failure of metronidazole to prevent preterm delivery among pregnant women with asymptomatic Trichomonas vaginalisinfection. N Engl J Med 345: 487-493.
• Kucknoor AS, Mundodi V, Alderete JF 2005. Adherence to human vaginal epithelial cells signals for increased expression of Trichomonas vaginalis genes. Infect Immun 73: 6472-6478.
• Lehker MW, Arroyo R, Alderete JF 1991. The regulation by iron of the synthesis of adhesins and cytoadherence levels in the protozoanTrichomonas vaginalis J Exp Med 174: 311-318.
• Lehker MW, Sweeney D 1999. Trichomonad invasion of the mucous layer requires adhesins, mucinases and motility. Sex Transm Infect 75: 231-238.
• Matos JAA, Borges FP, Tasca T, Bogo McR, De Carli GA, da Graça Fauth M, Dias RD, Bonan CD 2001. Characterisation of an ATP diphosphohydrolase (Apyrase, EC 3.6.1.5) activity in Trichomonas vaginalisInt J Parasitol 31: 770-775.
• Moreno-Brito V, Yanez-Gomez C, Meza-Cervantez P, Avila-Gonzalez L, Rodriguez MA, Ortega-Lopez J, Gonzalez-Robles A, Arroyo R 2005. ATrichomonas vaginalis 120 kDa protein with identity to hydrogenosome pyruvate:ferredoxin oxidoreductase is a surface adhesin induced by iron. Cell Microbiol 7: 245-258.
• Munagala NR, Wang CC 2003. Adenosine is the primary precursor of all purine nucleotides in Trichomonas vaginalis Mol Biochem Parasitol 127: 143-149.
• Petrin D, Delgaty K, Bhatt R, Garber G 1998. Clinical and microbiological aspects of Trichomonas vaginalis Clin Microbiol Rev 11: 300-317.
• Robson SC, Sevigny J, Zimmermann H 2006. The E-NTPDase family of ectonucleotidases: structure function relationships and pathophysiological significance. Purinergic Signal 2: 409-430.
• Sansom FM 2012. The role of the NTPDase enzyme family in parasites: what do we know and where to from here? Parasitology 139: 963-980.
• Sorvillo F, Smith L, Kerndt P, Ash L 2001. Trichomonas vaginalis, HIV and African-Americans. Emerg Infect Dis 7: 927-932.
• Sutcliffe S, Neace C, Magnuson NS, Reeves R, Alderete JF 2012. Trichomonosis, a common curable STI and prostate carcinogenesis - a proposed molecular mechanism. PLoS Pathog 8: e1002801.
• Tasca T, Bonan CD, Carli GA, Battastini AM, Sarkis JJ 2003. Characterization of an ecto-5’-nucleotidase (EC 3.1.3.5) activity in intact cells of Trichomonas vaginalis Exp Parasitol 105: 167-173.
• Tasca T, Bonan CD, De Carli GA, Sarkis JJ, Alderete JF 2005. Heterogeneity in extracellular nucleotide hydrolysis among clinical isolates ofTrichomonas vaginalis Parasitology 131: 71-78.
• Van Der Pol B, Kwok C, Pierre-Louis B, Rinaldi A, Salata RA, Chen PL, van de Wijgert J, Mmiro F, Mugerwa R, Chipato T, Morrison CS 2008.Trichomonas vaginalis infection and human immunodeficiency virus acquisition in African women. J Infect Dis 197: 548-554.
• Viikki M, Pukkala E, Nieminen P, Hakama M 2000. Gynaecological infections as risk determinants of subsequent cervical neoplasia. Acta Oncol 39: 71-75.
• WHO-DRHR - World Health Organization, Department of Reproductive Health and Research 2012. Global incidence and prevalence of selected curable sexually transmitted infections - 2008, WHO, Genebra, 20 pp.
• Zimmermann H 2001. Ectonucleotidases: some recent developments and a note on nomenclature. Drug Develop Res 52: 44-56.

• Financial support: REDE NANOBIOTEC-CAPES (-23038.019022/2009-68), CNPq (475315/2011-1) PBV receive scholarship from CAPES, AJM and TT are supported by a research fellowship from CNPq.

Publication Dates

• Publication in this collection
  Apr 2015

History

• Received
  1 Sept 2014
• Accepted
  26 Jan 2015