Detection of efflux pump CmeABC in enrofloxacin resistant Campylobacter spp. strains isolated from broiler chickens (Gallus gallus domesticus) in the state of Rio de Janeiro, Brazil

Detecção da bomba de efluxo CmeABC em cepas de Campylobacter spp. resistentes à enrofloxacina isoladas de frangos de corte (Gallus gallus domesticus) no Estado do Rio de Janeiro, Brasil

ABSTRACT:

Fowls are the main reservoirs of the highly important food-originating pathogen called Campylobacter spp. and broilers’ meat and byproducts are the main vehicles of this microorganism. Increasing of Campylobacter spp. resistant strains to fluorquinolones, an antimicrobial class often employed in poultry farming and in human medicine has become a great concern to poultry breeders. In fact, several studies evaluated increasing bacterial resistance against these antimicrobial agents. The role of CmeABC efflux system has been underscored among the resistance mechanisms in Campylobacter spp. to fluorquinolones. This study investigated the occurrence of CmeABC efflux pump in 81 and 78 enrofloxacin resistant strains of Campylobacter jejuni and C. coli respectively, isolated from broilers collected from six abattoirs situated at São José do Vale do Rio Preto/RJ poultry center and from two commercial abattoirs situated at Metropolitan Region of Rio de Janeiro, from 2013 to 2016. The resistance to enrofloxacin was assessed by agar dilution to determine minimum inhibitory concentration (MIC). The CmeABC efflux system was investigated through the detection of genes genes cmeA, cmeB and cmeC by PCR. The activity of CmeABC efflux pump was investigated in 20 strains by using the efflux pump inhibitor Phenylalanine-Arginine β-Naphthylamide (PAβN). The three genes cmeA, cmeB and cmeC were detected in 94.3% of the strains (C. jejuni = 80 and C. coli = 70), whereas the system was absent or incomplete in 5.7% of strains (C. jejuni = 1 and C. coli = 8). MIC varied between 0.5μg/ml and 64μg/ml, and 88.7% of strains were enrofloxacin resistant and 11.3% featuring intermediate resistance. The inhibition of the efflux pump by PAβN reduced the MIC to enrofloxacin up to eight times in fifteen strains (75%). These results indicate that this system is frequent and active in Campylobacter spp. Resistant strains in the presence of enrofloxacin.

INDEX TERMS: Efflux pump; CmeABC; enrofloxacin; Campylobacter spp.; broiler chickens; Gallus gallus domesticus; Rio de Janeiro; Brazil; resistance; chickens

RESUMO:

As aves são os principais reservatórios de Campylobacter spp., importante patógeno de origem alimentar e a carne de frango e produtos derivados são os principais veículos desse microrganismo. O aumento de cepas de Campylobacter spp. resistentes às fluorquinolonas, uma classe antimicrobiana frequentemente empregada na avicultura e na medicina humana, tornou-se uma grande preocupação para os produtores de aves e vários estudos avaliaram o aumento da resistência bacteriana a esses antimicrobianos. O papel do sistema de efluxo CmeABC tem sido enfatizado entre os mecanismos de resistência em Campylobacter spp. à fluorquinolonas. O presente estudo investigou a ocorrência da bomba de efluxo CmeABC em 81 cepas de Campylobacter jejuni e 78 cepas de Campylobacter coli resistentes à enrofloxacina, isoladas de frangos de corte coletados em seis abatedouros situados no polo avícola de São José do Rio Preto/RJ e de dois abatedouros comerciais situados na Região Metropolitana do Rio de Janeiro, de 2013 a 2016. A resistência à enrofloxacina foi avaliada pelo método de diluição em ágar para determinar a concentração inibitória mínima (CIM). O sistema de efluxo CmeABC foi investigado através da detecção dos genes cmeA, cmeB e cmeC por PCR. A atividade da bomba de efluxo CmeABC foi investigada em 20 cepas utilizando o inibidor da bomba de efluxo Phenylalanine-Arginine β-Naftilamida (PAβN). Os três genes cmeA, cmeB e cmeC foram detectados em 94,3% das cepas (C. jejuni = 80 e C. coli = 70), enquanto o sistema estava ausente ou incompleto em 5,7% das cepas (C. jejuni = 1 e C coli = 8). A CIM variou entre 0,5μg/ml e 64μg/ml e 88,7% das cepas foram resistentes à enrofloxacina, enquanto 11,3% apresentaram resistência intermediária. A inibição da bomba de efluxo pelo PAβN reduziu a CIM da enrofloxacina até oito vezes em quinze cepas (75%). Estes resultados indicam que este sistema é frequente e ativo em cepas resistentes de Campylobacter spp. na presença de enrofloxacina.

TERMOS DE INDEXAÇÃO: Bomba de efluxo; CmeABC; cepas; Campylobacter spp.; enrofloxacina; frangos de corte; Gallus gallus domesticus; Rio de Janeiro; Brasil; resistência

Introduction

The food-borne zoonotic pathogen Campylobacter spp. is one of the main gastroenteritis agents worldwide, especially in developing countries (Zhou et al. 2016). In the EU, 246.307 cases of campylobacteriosis were reported in 2016, featuring the most relevant cause of gastroenteritis since 2005 (EFSA & ECDC 2017). In the USA, Campylobacter was the most registered cause of bacterial gastroenteritis, with an estimate of 1.3 million cases a year (CDC 2017). Most campylobacteriosis cases are associated to the ingestion of raw and undercooked chicken meat or to cross-contaminated meat. Its prevalence in broilers’ carcasses ranges from 0.29% to 96.7% (Aquino et al. 2002, Garin et al. 2012, Wang et al. 2013).

In developing countries, such as Brazil, information on outbreaks is often incomplete and diarrheal diseases are endemic. Although Brazil is the largest exporter of chicken meat in the world, the presence of Campylobacter spp. is not investigated in most cases of human bacterial gastroenteritis. This is probably due to the particularities of its isolation and characterization methodology, which is different from that applied to detect enteropathogenic bacteria, such as Escherichia coli, Salmonella and Shigella (Panzenhagen et al. 2016a).

Resistance to fluoroquinolones in Campylobacter spp. strains has been reported in several countries, with different results in the treatment of infections (Helms et al. 2005). The first reported resistance case in human treatment for C. jejuni occurred when enrofloxacin was used in the treatment of broilers in Holland in the winter of 1987 (Endtz et al. 1991).

Mutation in the Quinolones Resistance-Determining Region (QRDR) of gene gyrA, which codifies for subunit A of the DNA gyrase enzyme, substitutes Tre-86-Ile and is the main resistance mechanism to fluoroquinolones (Wieczorek & Osek 2013). However, several studies show that mutation in QRDR may not be the sole mechanism in the resistance to these drugs and reveal that efflux pump codified by cmeA, cmeB and cmeC genes is an important factor in Campylobacterspp. resistance to several antimicrobial agents (Poole 2005, Iovine 2013, Wieczorek & Osek 2013), alone or coupled to other mechanisms.

The inhibitor of efflux pump Phenylalanine-Arginine β-Naphthylamide (PAβN) is efficient against several Gram-negative bacteria and compromises nutrient uptake and excretion of toxic compounds through its inhibition. Several authors also underscore that the inhibition of the CmeABC efflux system by PAβN increases the susceptibility of C. jejuni to different antibiotics, including macrolides and fluoroquinolones, which are important drugs for the treatment of human campylobacteriosis (Mamelli et al. 2003, Chollet et al. 2004, Hasdemir et al. 2004, Saenz et al. 2004).

This study investigated the presence of the CmeABC efflux system and its activity in enrofloxacin resistant C. jejuni and C. coli strains isolated from broilers in the state of Rio de Janeiro, Brazil.

Materials and Methods

Sample collection and species identification. Strains were obtained from samples of broilers’ intestines, retrieved immediately after evisceration collected from six abattoirs situated at São José do Vale do Rio Preto poultry center with state inspection, and from two commercial abattoirs of State of Rio de Janeiro, from 2013 to 2016. In each collect, 10 broilers’ intestines were collected and taken to the laboratory, for processing at the same day. Swabs with caecum material were diluted in 2mL of sterilized distilled water, 0.30ml was filtered by cellulose acetate membrane (Sartorius) (0.65μm), and spreaded on Columbia agar plates, supplemented with activated coal (0.4%) and CAMPYLOFAR^® (CEFAR) (Aquino et al. 2002). Plates were incubated at 37°C for 48 hours in microaerophilic conditions. Suspect colonies were confirmed by PCR technique (Harmon et al. 1997) and Campylobacter jejuni ATCC 33560 and Campylobacter coli ATCC 33559 strains were employed as positive control.

Detection of antibiotic resistance genes. Eighty-one Campylobacter jejuni strains and 78 C. coli strains, classified as resistant to enrofloxacina by the agar dilution assay (CLSI 2013),were investigated to detect the CmeABC efflux system. Genes cmeA, cmeB and cmeC were detected by PCR, following Lin et al. (2002) and Obeng et al. (2012) as described: 25uL with 2μl of sample DNA; 2.5μl of 10X PCR Buffer; 0.2mmol l^-1 of deoxyribonucleotide phosphates (dATP, dCTP, dGTP and dTTP); 0.4μmol l^-1 of each starter (Table 1); 2.5U of Taq polymerase (Ludwig, Alvorada, Brasil) were employed and Thermal Cycler (ThermoElectron Corporation - Px2 ThermalCycler) was used to run the PCR. Initial denaturalization was undertaken at 96°C for 1 min, followed by 30 cycles with denaturalization for 30 seconds at 94°C; annealing temperature at 54°C for 45 seconds; at 72°C for 1 minute; final extension at 72°C for 5 min. Table 1 provides sequences of primers. For the visualization of the PCR product, 5μL of amplicon was performed in a horizontal electrophoresis tank ‘Electrophoresis Cell (BioAmérica) at Power Pac 300 (Bio-Rad) in agar gel 1.5%, buffer TBE (1.0M Tris, 0.01M boric acid, 0.01M EDTA, pH 8.0) (Ludwig, Alvorada, Brasil), and 1μlGelRed with 1μl loading buffer. Image was visualized and photographed in ultraviolet transilluminator (Nova Instruments).

Table 1.
Primers used in the PCR to detect the CmeABC efflux system in Campylobacter strains

Target gene	Primer sequence (5′-3′)		Amplicon size (bp)	Reference
	Forward	Reverse
cmeA	TTTGGATCCTTGATGGCTAAGGCAACTTTC	CTCCAATTTCTTAAGCTTCGCTACCAA	771	(Lin et al. 2002)
cmeB C. jejuni	GGTACAGATCCTGATCAAGCC	AGGAATAAGTGTTGCACGGAAATT	820	(Lin et al. 2002)
cmeB C. coli	TCCTAGCAGCACAATATG	AGCTTCGATAGCTGCATC	241	(Obeng et al. 2012)
cmeC	GCTTGGATCCTTATCTTGGGAAAAA	TTTTTAAAGCTTTAAGGTAATTTTCTT	624	(Lin et al. 2002)

Antibiotic susceptibility test. Resistance to enrofloxacin was investigated by agar dilution method to determine Minimum Inhibitory Concentration (MIC) (CLSI 2013). Suspension of inoculated Campylobacter was adjusted to turbidity, equivalent at McFarland 0.5 standard. Mueller Hinton agar plates were supplemented with sheep blood (7%) and enrofloxacin (64μg/ml, 32μg/ml, 16μg/ml, 8μg/ml, 4μg/ml, 2μg/ml, 1μg/ml, 0.5μg/ml, 0.25μg/ml, and 0.125μg/ml) to determine MIC. The plates were incubated at 37°C for 48 hours under microaerophilic conditions. The strains were classified according to the MIC value (μg/ml) as resistant (≥2μg/ml), intermediate (1μg/ml-0.5μg/ml) or susceptible (≤0.25μg/ml).

Effect of efflux pump inhibitor on antimicrobial resistance. The twenty most recently isolated strains harboring the three genes (by cmeA, cmeB and cmeC) had the activity of CmeABC efflux investigated, by efflux pump inhibitor Phenylalanine-Arginine β-Naphthylamide (PAβN) (MP Biomedicals, Santa Ana, California, USA). To determine the efflux pump activity, MIC was determined by agar dilution method with and without the inhibitor PaβN according to Hungaro et al. (2015). Mueller Hinton agar plates were supplemented with sheep blood (7%), inhibitor PAβN (5μg ml^-1) and enrofloxacin (64μg/ml, 32μg/ml, 16μg/ml, 8μg/ml, 4μg/ml, 2μg/ml, 1μg/ml, 0.5μg/ml, 0.25μg/ml, 0.125μg/ml). The plates were incubated at 37°C for 48 hours under microaerophilic conditions and changes in the MIC value were investigated.

Results and Discussion

The three genes, cmeA, cmeB and cmeC, were detected in 94.3% (150) of 159 strains. Nine strains (5.7%) failed to have the full efflux system as described below: in one Campylobacter coli strain, the three genes were absent and in five C. coli strains the cmeB was not detected; the genes cmeB and cmeC were not detected in one C. coli strain and cmeA was not detected in one Campylobacter jejuni and in one C. coli strain.

In this study, the efflux pump system was observed in most C. jejuni e C. coli strains isolated from broilers. These results are in agreement with those of others authors from Brazil and other countries (Hungaro et al. 2015, Lin et al. 2002, Van Deun et al. 2007, Cantero et al. 2018) which frequently observed the presence of this efflux system in Campylobacter strains. Of the nine strains in which the full efflux system was not detected, one was isolated from a commercial abattoir and eight were from the poultry center located São José do Vale do Rio Preto.

Two efflux systems involved in the resistance mechanism of Campylobacter have been well characterized, namely, Campylobacter multidrug efflux CmeABC and CmeDEF, belonging to the proton motive force-dependent group, and Resistance-Nodulation-Division family (RND) (Jeon et al. 2011). The family RND is usually registered in Gram-negative bacteria and its efflux system works by a tripartite system that includes a periplasmatic membrane fusion protein, an inner membrane drug transporter and an outer membrane protein, which are codified, respectively, by genes cmeA, cmeB and cmeC in Campylobacter (Lin et al. 2005, Poole 2005). The three proteins are codified by a three-gene operon, (CmeABC), working together to expel toxic substrates from the interior of the bacterial cell (Lin et al. 2002).

Efflux systems in Campylobacter participate in the uptake of essential nutrients and ions, in the excretion of bacterial metabolism products and toxic substances. They also participate in the communication processes between cells and the environment. They have also been studied as a potential target to reduce resistance to antibiotics in Campylobacterspp. and as an alternative strategy to limit contaminations and prevent infections (Možina et al. 2011, Nikaido & Jean-Marie 2012).

Resistance-nodulation-division (RND) efflux systems contribute towards Campylobacter’s intrinsic resistance for a wide range of structurally non-related antimicrobial agents. They may acquire resistance to fluoroquinolones by super-expression of efflux proteins or by synergic interaction with resistance mechanisms to non-efflux fluoroquinolones, such as mutations in gene gyrA (Lin et al. 2002, Luo et al. 2003). Luangtongkum et al. (2009) showed that CmeABC system works synergically with gyrA in the mediation of resistance to fluoroquinolones, whereas strains resistant to fluoroquinolones without Tre-86-Ile mutation have already been reported (Hungaro et al. 2015).

Minimum Inhibitory Concentration (MIC) in this study ranged from 0.5 to 64μg/mL, and 88.7% of the strains were resistant, whereas 11.3% showed intermediate resistance. The highest levels of resistance were observed in abattoir 3 (Table 2), a commercial abattoir, located at metropolitan region of Rio de Janeiro In Brazil, enrofloxacin is frequently employed in poultry breeding, and there is no effective control by regulatory agencies of its use in small producers, as may be verified in the report of the State Program for the Control of Veterinary Medicine Wastes in Animal-derived Food (PAMvet) in the state of Paraná, Brazil (Machinski Junior et al. 2005). In fact, Panzenhagen et al. (2016b) registered enrofloxacin wastes in 72.2% of broilers’ samples collected in the state of Rio de Janeiro, analyzed by Enzyme-Linked Immunosorbent Assay (ELISA), albeit at rates lower than the Maximum Waste Limits. In Spain, Cantero et al. (2018) reported that isolated strains of broilers were predominantly resistant to quinolones, perhaps due to the frequent use of enrofloxacin in poultry breeding. The 2016 EU´s report similarly described resistance to antimicrobial agents in zoonotic bacteria and in indicating bacteria from humans, animals and food. In fact, Campylobacter strains isolated from humans and broilers showed high to extremely high resistance to ciprofloxacin (EFSA & ECDC 2018).High minimum inhibitory concentration for enrofloxacin in broiler-derived strains in this study may compromise the efficaciousness of fluoroquinolones in the treatment of human infections caused by poultry-derived strains.

Table 2.
Strains, origin and determination of MIC with and without PAβN inhibitor in 20 Campylobacter spp. strains

Campylobacter strains	Source	CmeA	CmeB	CmeC	MIC (μg/mL)	MIC with PAβN (μg/mL)
C. coli	Abattoir 1	+	+	+	4(R)	1(I)
C. coli	Abattoir 1	+	+	+	2(R)	1(I)
C. coli	Abattoir 2	+	+	+	2(R)	1(I)
C. coli	Abattoir 2	+	+	+	2(R)	1(I)
C. coli	Abattoir 2	+	+	+	1(I)	1(I)
C. coli	Abattoir 2	+	+	+	2(R)	1(I)
C. coli	Abattoir 2	+	+	+	1(I)	1(I)
C. coli	Abattoir 2	+	+	+	2(R)	1(I)
C. coli	Abattoir 3	+	+	+	64(R)	8(R)
C. coli	Abattoir 3	+	+	+	8(R)	4(R)
C. coli	Abattoir 3	+	+	+	8(R)	8(R)
C. coli	Abattoir 3	+	+	+	8(R)	1(I)
C. coli	Abattoir 3	+	+	+	8(R)	8(R)
C. coli	Abattoir 3	+	+	+	8(R)	4(R)
C. coli	Abattoir 3	+	+	+	8(R)	4(R)
C. coli	Abattoir 3	+	+	+	16(R)	2(R)
C. jejuni	Abattoir 3	+	+	+	4(R)	2(R)
C. jejuni	Abattoir 3	+	+	+	4(R)	2(R)
C. jejuni	Abattoir 3	+	+	+	4(R)	4(R)
C. jejuni	Abattoir 3	+	+	+	16(R)	8(R)

• Abattoir 1 = located in São José do Vale do Rio Preto, Abattoir 2 and 3 = located in Metropolitan Region of Rio de Janeiro, R = resistant strain, I = intermediate resistance.

MIC varied from 8 to 32μg/mL in strains without cmeA or cmeC, whereas resistance ranged from 0.5 to 32μg/mL in 7 strains in which the gene cmeB was not detected. These findings suggest the participation of another resistance mechanism besides the efflux pump. The lack of genes cmeA and cmeC in a study by Hungaro et al. (2015) failed to affect MIC, whereas Pumbwe & Piddock (2002) reported that the absence of cmeB made possible the recovery of levels of sensitiveness. The gene cmeB codifies the internal membrane which transports drugs and it is fundamental for the functioning of the CmeABC efflux system. Our study investigated the activity of efflux pump with inhibitor PAβN in Campylobacter spp. strains with complete efflux system and revealed a decrease in MIC of enrofloxacin from two to eight times in 15 (75%) strains. Despite the MIC decreasing, eight strains remained resistant and seven strains showed intermediate resistance (Table 2). No change in the MIC of 5 (25%) strains with the complete efflux system was observed, suggesting that the efflux system was inactive.

Effective participation of the CmeABC efflux system in the Campylobacter fluoroquinolone resistance has not always been reported. Mavri & Možina (2012) reported MIC reductions for ciprofloxacin with PAβN inhibitor in only 50% of strains derived from broilers, pigs, humans and surface water. Corcoran et al. (2005) demonstrated that PAβN inhibitor did not cause significant decrease in resistance to fluoroquinolones in Campylobacter spp. isolates from broilers and humans. On the other hand, Kurinčič et al. (2012) reported MIC decrease in fluoroquinolones and the reestablishment of susceptibility with PAβN inhibitor in Campylobacter isolates from food, animals, water and humans. These results indicate that the efflux mechanism is involved in the resistance to enrofloxacin in Campylobacter, but not as a single mechanism. In fact, in our study, several resistant strains did not have the full CmeABC efflux system or the activity of the efflux pump was not reduced by the use of PAβN inhibitor.

Several studies have been undertaken recently on natural compounds which may inhibit the efflux system of bacteria (Chérigo et al. 2009, Fadli et al.2011, Ramalhete et al. 2011, Roy et al. 2012, Možina et al.2018). Due to the crucial role of the CmeABC system in the adaptation of Campylobacterspp. in the intestine tract, it has been suggested that this would be a proper target for the control of infections by Campylobacterspp. The inhibition of efflux systems in C. jejuni may be a new approach to decrease resistance to antibiotics and prevent infection by Campylobacter spp. in human beings and animal reservoirs. The employment of CmeABC inhibitors as food additives in poultry breeding systems to prevent or decrease intestine colonization and reduce the dissemination of Campylobacter resistant strains may be considered an advance in the use of inhibitors. In fact, many cases of human campylobacteriosis are attributed to the intake of raw or undercooked chicken meat (Hungaro et al. 2015, Možina et al. 2018). Further, several regulating mechanisms that change CmeABC expression have been described (Lin et al. 2005) and information on them and knowledge on the structure, functions and regulation of other efflux pumps in Campylobacter may identify new targets for the therapeutic intervention of Campylobacter (Možina et al. 2018).

Conclusions

Our findings suggest that CmeABC efflux system is an important mechanism in the Campylobacter resistance to enrofloxacin .However, the lack of a full efflux system in resistant strains and the MIC maintenance in the presence of the inhibitor PAβN indicates the participation of other mechanisms or a synergic activity in the resistance of enrofloxacin.

The use of efflux pump inhibitors may offer perspectives to reduce antimicrobial resistance and the colonization of Campylobacter spp. in broilers.

Acknowledgements

The author would to thank the Coordination for the Upgrading of Higher Education Personnel (CAPES) for the scholarship awarded to Regina Júlia Nascimento.

References

• Aquino M.H.C., Pacheco A.P.G., Ferreira M.C.S. & Tibana A. 2002. Frequency of isolation and identification of thermophilic campylobacters from animals in Brazil. Vet. J. 164(2):159-161. <http://dx.doi.org/10.1053/tvjl.2001.0698> <PMid:12359474>
  » https://doi.org/10.1053/tvjl.2001.0698
• Cantero G., Correa-Fiz F., Ronco T., Strube M., Cerdà-Cuéllar M. & Pedersen K. 2018. Characterization of Campylobacter jejuni and Campylobacter coli broiler Isolates by whole-genome sequencing. Foodborne Pathog. Dis. 15(3):145-152. <http://dx.doi.org/10.1089/fpd.2017.2325> <PMid:29256637>
  » https://doi.org/10.1089/fpd.2017.2325
• CDC 2017. FoodNet surveillance report for 2016. Foodborne Diseases Active Surveillance Network (FoodNet), Centers for Disease Control and Prevention, U.S. Department of Health and Human Services, Atlanta, GA.
• Chérigo L., Pereda-Miranda R. & Gibbons S. 2009. Bacterial resistance modifying tetrasaccharide agents from Ipomoea murucoides Phytochemistry 70(2):222-227. <http://dx.doi.org/10.1016/j.phytochem.2008.12.005> <PMid:19136125>
  » https://doi.org/10.1016/j.phytochem.2008.12.005
• Chollet R., Chevalier J., Bollet C., Pages J.M. & Davin-Regli A. 2004. Ram A is an alternate activator of the multidrug resistance cascade in Enterobacter aerogenes Antimicrob. Agents Chemother. 48(7):2518-2523. <http://dx.doi.org/10.1128/AAC.48.7.2518-2523.2004> <PMid:15215103>
  » https://doi.org/10.1128/AAC.48.7.2518-2523.2004
• CLSI 2013. VET01-S2: Performance standards for antimicrobial disk and dilution susceptibility tests for bacteria isolated from animals, second informational supplement. Clinical and Laboratory Standards Institute, Wayne, PA.
• Corcoran D., Quinn T., Cotter L. & Fanning S. 2005. Relative contribution of target gene mutation and efflux to varying quinolone resistance in Irish Campylobacter isolates. FEMS Microbiol. Lett. 253(1):39-46. <http://dx.doi.org/10.1016/j.femsle.2005.09.019> <PMid:16213669>
  » https://doi.org/10.1016/j.femsle.2005.09.019
• EFSA & ECDC 2017. The European Union summary report on trends and sources of zoonoses, zoonotic agents and food-borne outbreaks in 2016. EFSA J. 15(12):5077.
• EFSA & ECDC 2018. The European Union summary report on antimicrobial resistance in zoonotic and indicator bacteria from humans, animals and food in 2016. EFSA J. 16(2):5182.
• Endtz H.P., Ruijs G.J., Van Klingeren B., Jansen W.H., Van Der Reyden T. & Mouton R.P. 1991. Quinolone resistance in Campylobacter isolated from man and poultry following the introduction of fluoroquinolones in veterinary medicine. J. Antimicrob. Chemother. 27(2):199-208. <http://dx.doi.org/10.1093/jac/27.2.199> <PMid:2055811>
  » https://doi.org/10.1093/jac/27.2.199
• Fadli M., Chevalier J., Saad A., Mezrioui N.E., Hassani L. & Pages J.M. 2011. Essential oils from Moroccan plants as potential chemosensitisers restoring antibiotic activity in resistant Gram-negative bacteria. Int. J. Antimicrob. Agents 38(4):325-330. <http://dx.doi.org/10.1016/j.ijantimicag.2011.05.005> <PMid:21752605>
  » https://doi.org/10.1016/j.ijantimicag.2011.05.005
• Garin B., Gouali M., Wouafo M., Perchec A.M., Pham M.T., Ravaonindrina N., Urbès F., Gay M., Diawara A., Leclercq A., Rocourt J. & Pouillot R. 2012. Prevalence, quantification and antimicrobial resistance of Campylobacter spp. on chicken neck-skins at points of slaughter in five major cities located on four continents. Int. J. Food Microbiol. 157(1):102-107. <http://dx.doi.org/10.1016/j.ijfoodmicro.2012.04.020> <PMid:22607809>
  » https://doi.org/10.1016/j.ijfoodmicro.2012.04.020
• Harmon K.M., Ransom G.M. & Wesley I.V. 1997. Differentiation of Campylobacter jejuni and Campylobacter coli by polymerase chain reaction. Mol. Cell Proteomics 11(3):195-200. <http://dx.doi.org/10.1006/mcpr.1997.0104> <PMid:9232618>
  » https://doi.org/10.1006/mcpr.1997.0104
• Hasdemir U.O., Chevalier J., Nordmann P. & Pagès J.M. 2004. Detection and prevalence of active drug efflux mechanism in various multidrug-resistant Klebsiella pneumoniae strains from Turkey. J. Clin. Microbiol. 42(6):2701-2706. <http://dx.doi.org/10.1128/JCM.42.6.2701-2706.2004> <PMid:15184455>
  » https://doi.org/10.1128/JCM.42.6.2701-2706.2004
• Helms M., Simonsen J., Olsen K.E. & Mølbak K. 2005. Adverse health events associated with antimicrobial drug resistance in Campylobacter species: a registry-based cohort study. J. Infect. Dis. 191(7):1050-1055. <http://dx.doi.org/10.1086/428453> <PMid:15747238>
  » https://doi.org/10.1086/428453
• Hungaro H.M., Mendonça R.C.S., Rosa V.O., Badaró A.C.L., Moreira M.A.S. & Chaves J.B.P. 2015. Low contamination of Campylobacter spp. on chicken carcasses in Minas Gerais state, Brazil: molecular characterization and antimicrobial resistance. Food Control 51:15-22. <http://dx.doi.org/10.1016/j.foodcont.2014.11.001>
  » https://doi.org/10.1016/j.foodcont.2014.11.001
• Iovine E.N.M. 2013. Resistance mechanisms in Campylobacter jejuni Virulence 4(3):230-240. <http://dx.doi.org/10.4161/viru.23753> <PMid:23406779>
  » https://doi.org/10.4161/viru.23753
• Jeon B., Wang Y., Hao H., Barton Y. & Zhang Q. 2011. Contribution of CmeG to antibiotic and oxidative stress resistance in Campylobacter jejuni J. Antimicrob. Chemother. 66(1):79-85. <http://dx.doi.org/10.1093/jac/dkq418> <PMid:21081547>
  » https://doi.org/10.1093/jac/dkq418
• Kurinčič M., Klančnik A. & Možina S.S. 2012. Epigallocatechin gallate as a modulator of Campylobacter resistance to macrolide antibiotics. Int. J. Antimicrob. Agents 40(5):467-471. <http://dx.doi.org/10.1016/j.ijantimicag.2012.07.015> <PMid:22999765>
  » https://doi.org/10.1016/j.ijantimicag.2012.07.015
• Lin J., Michel L.O. & Zhang Q. 2002. CmeABC functions as a multidrug efflux system in Campylobacter jejuni Antimicrob. Agents Chemother. 46(7):2124-2131. <http://dx.doi.org/10.1128/AAC.46.7.2124-2131.2002> <PMid:12069964>
  » https://doi.org/10.1128/AAC.46.7.2124-2131.2002
• Lin J., Akiba M., Sahin O. & Zhang Q. 2005. CmeR functions as a transcriptional repressor for the multidrug efflux pump CmeABC in Campylobacter jejuni. Antimicrob. Agents Chemother. 49(3):1067-1075. <http://dx.doi.org/10.1128/AAC.49.3.1067-1075.2005> <PMid:15728904>
  » https://doi.org/10.1128/AAC.49.3.1067-1075.2005
• Luangtongkum T., Jeon B., Han J., Plummer P., Logue C.M. & Zhang Q. 2009. Antibiotic resistance in Campylobacter: emergence, transmission and persistence. Future Microbiol. 4(2):189-200. <http://dx.doi.org/10.2217/17460913.4.2.189> <PMid:19257846>
  » https://doi.org/10.2217/17460913.4.2.189
• Luo N., Sahin O., Lin J., Michel L.O. & Zhang Q. 2003. In vivo selection of Campylobacter isolates with high levels of fluoroquinolone resistance associated with gyrA mutations and the function of the CmeABC efflux pump. Antimicrob. Agents Chemother. 47(1):390-394. <http://dx.doi.org/10.1128/AAC.47.1.390-394.2003> <PMid:12499221>
  » https://doi.org/10.1128/AAC.47.1.390-394.2003
• Machinski Junior M., Benini A., Netto D.P., Nunes M.P., Vedovello Filho D., Benatto A., Scucato E.S., Machado E., Belmonte I.L., Alberton M., Lopes M.O. & Bosquiroli S.L. 2005. Medicamentos veterinários utilizados na avicultura de postura no estado do Paraná. Relatório Anual do PAMvet, Paraná. 24p.
• Mamelli L., Amoros J.P., Pagès J.M. & Bolla J.M. 2003. A phenylalanine-arginine β-naphthylamide sensitive multidrug efflux pump involved in intrinsic and acquired resistance of Campylobacter to macrolides. Int. J. Antimicrob. Agents 22(3):237-241. <http://dx.doi.org/10.1016/S0924-8579(03)00199-7> <PMid:13678827>
  » https://doi.org/10.1016/S0924-8579(03)00199-7
• Mavri A. & Možina S.S. 2012. Involvementof efflux mechanisms in biocide resistance of Campylobacter jejuni and Campylobacter coli J. Med. Microbiol. 61(Pt 6):800-808. <http://dx.doi.org/10.1099/jmm.0.041467-0> <PMid:22361460>
  » https://doi.org/10.1099/jmm.0.041467-0
• Možina S.S., Kurinčič M., Klančnik A. & Mavri A. 2011. Campylobacter and its multi-resistance in the food chain. Trends Food Sci. Technol. 22(2/3):91-98. <http://dx.doi.org/10.1016/j.tifs.2010.09.003>
  » https://doi.org/10.1016/j.tifs.2010.09.003
• Možina S.S., Klančnik A., Kovac J., Jeršek B. & Bucar F. 2018. Antimicrobial natural products against Campylobacter, p.3-30. In: Mérillon J.M. & Riviere C. (Eds), Natural Antimicrobial Agents. Springer, Switzerland. <http://dx.doi.org/10.1007/978-3-319-67045-4_1>
  » https://doi.org/10.1007/978-3-319-67045-4_1
• Nikaido H. & Jean-Marie P. 2012. Broad-specificity efflux pumps and their role in multidrug resistance of Gram-negative bacteria. FEMS Microbiol. Rev. 36(2):340-363. <http://dx.doi.org/10.1111/j.1574-6976.2011.00290.x> <PMid:21707670>
  » https://doi.org/10.1111/j.1574-6976.2011.00290.x
• Obeng A.S., Rickard H., Sexton M., Pang Y., Peng H. & Barton M. 2012. Antimicrobial susceptibilities and resistance genes in Campylobacter strains isolated from poultry and pigs in Australia. J. Appl. Microbiol. 113(2):294-307. <http://dx.doi.org/10.1111/j.1365-2672.2012.05354.x> <PMid:22672511>
  » https://doi.org/10.1111/j.1365-2672.2012.05354.x
• Panzenhagen P.H.N., Aguiar W.S., Frasão B.S., Pereira V.L.A., Abreu D.L.C., Rodrigues D.P. & Aquino M.H.C. 2016a. Prevalence and fluoroquinolones resistance of Campylobacter and Salmonella isolates from poultry carcasses in Rio de Janeiro, Brazil. Food Control 61:243-247. <http://dx.doi.org/10.1016/j.foodcont.2015.10.002>
  » https://doi.org/10.1016/j.foodcont.2015.10.002
• Panzenhagen P.H.N., Aguiar W.S., Gouvêa R., Oliveira A.M., Barreto F., Pereira V.L.A. & Aquino M.H.C. 2016b. Investigation of enrofloxacin residues in broiler tissues using ELISA and LC-MS/MS. Food Addit. Contam. A 33(4):639-643. <http://dx.doi.org/10.1080/19440049.2016.1143566> <PMid:26930030>
  » https://doi.org/10.1080/19440049.2016.1143566
• Poole K. 2005. Efflux-mediated antimicrobial resistance. J. Antimicrob. Chemother. 56(1):20-51. <http://dx.doi.org/10.1093/jac/dki171> <PMid:15914491>
  » https://doi.org/10.1093/jac/dki171
• Pumbwe L. & Piddock L.J.V. 2002. Identification and molecular characterization of CmeB, a Campylobacter jejuni multidrug efflux pump. FEMS Microbiol. Lett. 206(2):185-189. <http://dx.doi.org/10.1111/j.1574-6968.2002.tb11007.x> <PMid:11814661>
  » https://doi.org/10.1111/j.1574-6968.2002.tb11007.x
• Ramalhete C., Spengler G., Martins A., Martins M., Viveiros M., Mulhovo S., Ferreira M.J.U. & Amaral L. 2011. Inhibition of efflux pumps in meticillin-resistant Staphylococcus aureus and Enterococcus faecalis resistant strains by triterpenoids from Momordica balsamina Int. J. Antimicrob. Agents 37(1):70-74. <http://dx.doi.org/10.1016/j.ijantimicag.2010.09.011> <PMid:21075604>
  » https://doi.org/10.1016/j.ijantimicag.2010.09.011
• Roy S.K., Pahwa S., Nandanwar H. & Jachak S.M. 2012. Phenylpropanoids of Alpinia galanga as efflux pump inhibitors in Mycobacterium smegmatis mc2 155. Fitoterapia 83(7):1248-1255. <http://dx.doi.org/10.1016/j.fitote.2012.06.008> <PMid:22735598>
  » https://doi.org/10.1016/j.fitote.2012.06.008
• Sáenz Y., Ruiz J., Zarazaga M., Teixidó M., Torres C. & Vila J. 2004. Effect of the efflux pump inhibitor Phe-Arg-beta-naphthylamide on the MIC values of the quinolones, tetracycline and chloramphenicol, in Escherichia coli isolates of different origin. J. Antimicrob. Chemother. 53(3):544-545. <http://dx.doi.org/10.1093/jac/dkh117> <PMid:14762057>
  » https://doi.org/10.1093/jac/dkh117
• Van Deun K., Haesebrouck F., Heyndrickx M., Favoreel H., Dewulf J., Ceelen L., Dumez L., Messens W., Leleu S., Van Immerseel F., Ducatelle R. & Pasmans F. 2007. Virulence properties of Campylobacter jejuni isolates of poultry and human origin. J. Med. Microbiol. 56(Pt 10):1284-1289. <http://dx.doi.org/10.1099/jmm.0.47342-0> <PMid:17893162>
  » https://doi.org/10.1099/jmm.0.47342-0
• Wang J., Guo Y.C. & Li N. 2013. Prevalence and risk assessment of Campylobacter jejuni in chicken in China. Biomed. Environ. Sci. 26(4):243-248. <PMid:23534464>
• Wieczorek K. & Osek J. 2013. Antimicrobial resistance mechanisms among Campylobacter BioMed Res. 2013:1-12. <PMid:23865047>
• Zhou J., Zhang M., Yang W., Fang Y., Wang G. & Hou F. 2016. A seventeen-year observation of the antimicrobial susceptibility of clinical Campylobacter jejuni and the molecular mechanisms of erythromycin-resistant isolates in Beijing, China. Int. J. Infect. Dis. 42:28-33. <http://dx.doi.org/10.1016/j.ijid.2015.11.005> <PMid:26594011>
  » https://doi.org/10.1016/j.ijid.2015.11.005

Publication Dates

• Publication in this collection
  04 Nov 2019
• Date of issue
  Sept 2019

History

• Received
  20 Feb 2019
• Accepted
  06 May 2019