THE SINGLE NUCLEOTIDE POLYMORPHISMS OF MYOSTATIN GENE AND THEIR ASSOCIATIONS WITH GROWTH AND CARCASS TRAITS IN DAHENG BROILER

ABSTRACT

Myostatin (MSTN) is a negative regulator of skeletal muscle growth. In order to investigate whether there is a correlation between MSTN polymorphisms and chicken production performance, in this study, single nucleotide polymorphisms (SNPs) in MSTN gene were examined across 180 Daheng broilers by direct sequencing of PCR product, and the correlations between the genotype and body weight at the age of 1-10 weeks and carcass traits at the age of 73 day were analyzed. Five SNPs (rs313622770, rs313744840, rs316247861, rs314431084, rs317126751) of MSTN gene were identified across Daheng broiler samples, and four haplotypes were reconstructed based on the five SNPs. Results of association analysis showed that four (rs313622770, rs313744840, rs316247861 and rs317126751) of these SNPs had significant association with some growth traits (p<0.05), but there were no significant effect on carcass traits and the four SNPs were strong linkage. For rs314431084, there was no significant correlation between different genotypes and growth or carcass traits. The AA genotype of rs313622770, GG genotype of rs313744840, CC genotype of rs316247861, TT genotype of rs317126751 were good for chicken growth. Diplotypes were significantly associated with chest muscle and leg muscle weight (p<0.05). Overall, these results provide evidence that polymorphisms in MSTN gene are associated with growth traits in chicken. The SNPs in MSTN gene could be utilized as potential markers for marker-assisted selection (MAS) during chicken breeding.

Keywords:
Association analysis; Chicken; Production performance; MSTN; SNP

INTRODUCTION

Meat production is one of the most important economic traits in chicken, and how to improve meat production is one of the most important objectives of breeding researchers. The growth traits are regulated by multiple genetic loci. Recently, researchers have selected lots of candidate genes associated with growth traits, Myostatin (MSTN) is one of these genes identified as a negative regulation factor of skeletal muscle growth (Wehling et al., 2000).

MSTN, also known as growth differentiation factor 8 (GDF-8), is a member of the transforming growth factor beta (TGF-β) family. It has been widely investigated in livestock, poultry, rodents and humans (Schiffer et al., 2011; Varga et al., 2003; Wang et al., 2014). A number of evidence has shown that MSTN acts as a negative regulator of skeletal muscle growth, and loss or decrease of its activity will cause excessive development of animal muscle (Clop et al., 2006). In the embryo stage, MSTN controls embryonic myoblast proliferation to regulate skeletal muscle size, Kocamis et al. (1999) investigated the developmental pattern of MSTN gene in chicken embryonic development and found that the expression of MSTN gene has been detected as early as the blastoderm stage, and they suggested MSTN gene plays an important role in skeletal muscle development and embryogenesis in the chicken embryo. It also plays an important role in muscle regeneration and muscle wasting in adult animals (Sharma et al., 2001). In adult mice, MSTN is mainly expressed in skeletal muscle. Some studies have found that the MSTN knockout mice is 30% heavier than wild-type mice, the skeletal muscle mass in MSTN knockout mice is 86% more than wild-type mice, and individual muscles of MSTN knockout mice weigh 2-3 times more than those of wild-type mice(Mcpherron et al., 1997), it suggests that MSTN is the inhibitory factor of the skeletal muscle growth in adult mice. In addition, some reports also showed that MSTN regulates fat metabolism (Kim et al., 2001; Lin et al., 2002). Langley et al. (2002) have found that MSTN function is related to the MyoD, MSTN down-regulated MyoD to inhibit myoblast differentiation. In humans, SNPs of the MSTN gene are associated with obesity (Pan et al., 2012) and gross muscle hypertrophy (Schuelke et al., 2004). In livestock, the MSTN gene is widely studied for its association with muscular hypertrophy, some mutations of MSTN gene have been associated with double muscling in cattle (Gill et al., 2009), and sheep (Dhakad et al., 2017; Ranjan, 2017). Some SNPs were found in chicken MSTN. Zandi et al. (2013) found that MSTN had a high degree of polymorphism that significantly associated it with body weight in native chickens of Azerbaijan. Paswan et al. (2014) found a SNP in minimal promoter of MSTN that associated it with body weight in chicken. But there was little useful evidence of MSTN SNPs in chicken growth, it is necessary to study the relationship between SNPs of MSTN and chicken production traits.

Daheng broiler is a meat-type quality chicken population, it is a commercial broiler by a long-term breeding, and it is popularwith its excellent meat flavor in China. But its growth rate and meat production rate are much lower than those of international commercial broilers, such as Avain broilers. It is important to improve the growth traits of domestic commercial chicken. In this study, MSTN SNPs are identified to explore the relationship between their genotypes and growth, carcass traits in Daheng broiler, which provides the basic information for the marker-assisted selection in chicken.

MATERIALS AND METHODS

Experimental population

A total of 180 Daheng broiler from three strains were employed for testing, which were developed by Daheng Poultry Breeding Company (Chengdu, China), including S08 (30 females and 30 males), S07×S06 (30 females and 30 males) and S07×S08 (30 females and 30 males). All chickens were hatched on the same day and developed under the same conditions and diet. The BW (body weight) was measured in grams at hatch, 1wk (week), 2wk, 3wk, 4wk, 5wk, 6wk, 7wk, 8wk, 9wk and 10wk. All individuals were slaughtered at 73 days of age, after slaughtered, the carcass traits including live weight (LW), carcass weight (CW), eviscerated weight (EW), semi-eviscerated weight (SEW), breast muscle weight (BMW), and leg muscle weight (LMW) were measured and recorded on the same day. Before slaughtered, wing venous blood samples were collected, prepared for DNA extraction. Genomic DNA was isolated by the standard phenol/chloroform method, the purity and concentration of DNA samples were measured by Nucleic Acid Protein Analyzer Nanodrop 2000/2000C (Thermo, Germany). TE buffer was added to DNA samples extracted from the blood to produce a target concentration of 100ng/μL, then, the DNA samples were stored at -20°C.

All experimental procedures involving animals were approved by the Animal Care and Use Committee of College of Animal Science and Technology, Sichuan Agricultural University (No.YYS130125), and were carried out in accordance with the National Research Council’s Guide for the Care and Use of Laboratory Animals.

Amplification and genotyping

Primers for the chicken MSTN gene amplification and sequencing (Table 1) were designed in NCBI (National Center for Biotechnology Information) (Boschiero et al., 2013) based on the complete DNA sequence of Gallus gallus MSTN gene (EMBL ID: ENSGALG00000039458). Primer synthesis was completed by the Beijing TSINGKE Biological Technology Corporation (Beijing, China). PCR was carried out using a Gene Amp PCR System 9700 (Bio-Rad, USA) thermal cycler. The PCR reaction (25μL) contains 15μL 2×Taq MasterMix, 0.5μL forward primer (10nmol/L), 0.5μL reverse primer (10nmol/L), 1μL DNA, and 8μL ddH₂O. PCR cycles included 94°C for 2min; 35 cycles included 94°C for 45s, 52°C for 35s, and 72°C for 60s; and a final extension included 72°C for 10 min, ending with incubation at 4°C (Barnes, 1994). PCR products were sequenced by TSINGKE Biological Technology Corporation (Beijing, China).

Table 1
Primer information for detecting SNPs in MSTN gene.

Primer name	Target region	Primer sequences (5’-3’)	Annealing Temperature (ºC)	Product(bp)
M1	Exon1	F: GGTTTTGACGACATGAGCCT	52	540
		R:ACGAAAGCAGCAGGGTTGTTA
M2	Exon2	F: TTTCTTTTTGTTCCCTGTTCAGT	58.8	529
		R: TCATCTGCCATTCTCGAAGCA
M3	Exon3	F: TCCCAGAAGGGTAGAAAGTTCAG	52	648
		R: TGTTGGCAATGCCTAGCGTA

Statistical analysis

The general linear model (GLM) procedure of SAS 6.12 (Statistical Analysis Systems Institute Inc. Cary, NC) was built to test associations between the genotype and growth traits, significant associations were declared when p<0.05, the mixed model is as follows:

$Y=\mu +G+S+B+F+e_{ijkf}$

Where Y = the dependent variable, μ= the population mean, G = genotype value, S = fixed effects of sex, B = fixed effects of breed, F = family effect, and e_ijkf = random error.

The identified SNPs in this MSTN gene were tested for Hardy-Weinberg equilibrium, when p>0.05 indicated the genetic balance of population gene (Wigginton et al., 2005). The linkage disequilibria D’ and r² value of the SNPs were estimated by Haploview (Barrett et al., 2005). Significance of the least squares means was tested with the Duncan’s Multiple Range test. The polymorphism information content (PIC) was established (PIC>0.5 is high polymorphism, 0.25<PIC<0.5 is intermediate polymorphism, and PIC<0.25 is low polymorphism)(Elston, 2005).

Haplotypes were constructed based on each SNP of MSTN in all experimental animals by use of the PHASE program v. 2.0. The function of this program is to reconstruct haplotypes from the population data. The genetic status of the subjects was expressed as the combination of two haplotypes. The SAS 6.12 (Statistical Analysis Systems Institute Inc. Cary, NC) was used to analyze the associations between the Haplotypes and growth traits. Significant associations were declared when p<0.05.

RESULTS

Sequence polymorphism in chicken MSTN gene

In this study, the exons sequence of the MSTN gene were examined, a total of five SNPs (Table 2) have been detected in MSTN exon1 of Daheng broiler. They were genotyped in Daheng broiler to evaluate their genetic association with chicken growth and carcass traits by direct sequencing of PCR product. For each SNP(SNP1-SNP5), three genotypes were found in the total population. The genotypes, allele frequencies and the genetic information of the 5 SNPs are showed in Table 3. PIC test results indicate that SNP1, SNP2, SNP3 and SNP5were intermediate polymorphism (0.5>PIC>0.25), which could be good genetic markers, only SNP4 was low polymorphism (PIC<0.25). And all SNPs were in accordance with Hardy-Weinberg equilibrium (p>0.05).

Table 2
Detailed information of SNP1-SNP5 in chicken MSTN gene.

Markers	Source1	Chr position	Variation	Function
SNP1	rs313622770	7/218133	G/A	cds-synon
SNP2	rs313744840	7/218142	A/G	cds-synon
SNP3	rs316247861	7/218277	C/G	cds-synon
SNP4	rs314431084	7/218316	G/A	cds-synon
SNP5	rs317126751	7/218406	C/T	cds-synon

• ^1:
  SNP1-SNP5 was released by NCBI with accession number.Chr, chromosome. cds- synonomous.

Table 3
Genotypes, allele frequencies and the genetic information of the 5 SNPs.

SNPs	Genotype frequency			Allele frequency		PIC	P
SNP1	AA	AG	GG	A	G
	37.78%	46.67%	15.55%	61.11%	38.89%	0.3624	0.994
SNP2	AA	AG	GG	A	G
	5.56%	41.11%	53.33%	26.11%	73.89%	0.3114	0.7831
SNP3	CC	CG	GG	C	G
	51.11%	43.33%	5.56%	72.78%	27.22%	0.3177	0.5769
SNP4	AA	AG	GG	A	G
	74.44%	24.44%	1.12%	86.67%	13.33%	0.2044	0.846
SNP5	CC	CT	TT	C	T
	15.56%	47.78%	36.66%	39.44%	60.56%	0.3636	1

• PIC means polymorphism information content; P is the results of C² test of Hardy-Weinberg equilibrium.

Association of 5 MSTN SNPs with chicken growth and carcass traits

The factor analysis results indicated that the SNP1 was significantly associated with BW (body weight) at hatch (p=0.033), 1wk (p=0.042) and 8wk (p=0.044) but was not associated with other growth traits. The SNP2 was significantly associated with BW at hatch (p=0.031) and1wk (p=0.036) of age but was not associated with other growth traits. The SNP3 was only significantly associated with BW at hatch (p=0.048). The SNP4 was not associated with any growth traits. And the SNP5 was significantly associated with BW at hatch (p=0.041), 1wk (p=0.037) and 8wk (p=0.048) of age (Table 4). In addition, the results showed that there were no significant association of each SNP with any carcass traits (p>0.05) (Table 5).

Table 4
Association of MSTN polymorphisms with chicken growth traits.

SNPs	Body weight (p value)
	Hatch(g)	1wk(g)	2wk(g)	3wk(g)	4wk(g)	5wk(g)	6wk(g)	7wk(g)	8wk(g)	9wk(g)	10wk(g)
SNP1	0.033*	0.042*	0.698	0.76	0.992	0.772	0.674	0.1	0.044*	0.376	0.721
SNP2	0.031*	0.036*	0.191	0.775	0.308	0.893	0.769	0.14	0.245	0.498	0.653
SNP3	0.048*	0.08	0.45	0.502	0.435	0.54	0.893	0.289	0.299	0.587	0.665
SNP4	0.91	0.262	0.115	0.784	0.086	0.136	0.578	0.941	0.382	0.925	0.594
SNP5	0.041*	0.037*	0.634	0.79	0.944	0.732	0.667	0.171	0.048*	0.358	0.653

• *p≤0.05; wk means week of age.

Table 5
Association of MSTN polymorphisms with chicken carcass traits.

SNP	Carcass traits (p value of significant test)
	LW(g)	CW(g)	SEW(g)	EW(g)	LMW(g)	BMW(g)
SNP1	0.377	0.396	0.377	0.396	0.412	0.828
SNP2	0.788	0.795	0.808	0.833	0.72	0.691
SNP3	0.795	0.848	0.807	0.782	0.803	0.241
SNP4	0.634	0.659	0.667	0.8	0.601	0.776
SNP5	0.237	0.315	0.324	0.342	0.405	0.791

• LW=live weight, CW=carcass weight, SEW=semi-eviscerated weight, EW=eviscerated weight, BMW=breast muscle weight, LMW=leg muscle weight.

Meanwhile, SNP1 chickens with AA genotype had a higher BW athatch at 1wk and8wkthan those with genotypes AG and GG (p<0.05). In SNP2, chicken with the GG genotype had significant higher weight athatch and 1wk than those with AG and AA genotypes (p<0.05).In SNP3, the CC genotype had significant higher hatch weight than those with GG genotype (p<0.05), and there was no difference between chickens with CC and CG genotypes (p>0.05). And in SNP5, chicken at hatch, 1wk and 8 wk had significantly higher weights with the TT genotype than those chickens with the CC and CT genotypes (p>0.05) (Table 6).

Table 6
Association analysis between the SNP genotypes and growth traits.

SNP	Growthtraits	Genotypes			p-value
SNP1		AA	AG	GG
	Hatch	37.68±0.36a	36.55±0.32b	36.29±0.56b	0.033
	1wk	110.44±1.77a	105.83±1.59	102.86±2.76b	0.042
	8wk	1651.18±37.51a	1542.86±33.57b	1504.29±58.46b	0.044
SNP2		AA	AG	GG
	Hatch	35.4±0.93b	36.49±0.34b	37.44±0.3a	0.031
	1wk	100±4.6	104.86±1.69b	109.58±1.49a	0.036
SNP3		CC	CG	GG
	Hatch	37.41±0.31a	36.56±0.34	35.40±0.94b	0.048
SNP5		CC	CT	TT
	Hatch	36.29±0.56b	36.58±0.32b	37.67±0.36a	0.041
	1wk	102.86±2.75b	105.81±1.57b	110.61±1.79a	0.037
	8wk	1504.29±58.52b	1545.12±33.39b	1651.52±38.12a	0.048

• Results are expressed as mean ± standard errors. Different letters indicate significant differences (p<0.05);
• ^{a, b}
  Means there is no common superscript differ significantly within a row (p<0.05).

Construction of haplotypes and their associations with chicken growth and carcass traits

Haplotypes were constructed based on the 5 SNPs by using the Haploview program, haplotypes inferred from genotype data showed that four haplotypes were found, including H1 (‘AGCAT’ of 57.9%), H2 (‘GAGAC’ of 25.4%), H3 (‘GGCGC’ of 12.8%), H4 (‘AGGAT’ of 1.7%), and others (frequencies lower than 1%). According to the genotypes of 180 Daheng broilers, a total of 7 diplotypes were studied associated with growth and carcass traits that the frequencies were higher than 1%, including H1H1 (33.33%), H1H2 (31.11%), H1H3 (14.44%), H1H4 (3.33%), H2H2 (5.56%), H2H3 (8.89%), H3H3 (1.11%), and others (2.22%).

The association analysis indicated that there were significant associations between diplotypes and carcass traits (Table7), but no significant results were obtained for growth traits. Diplotypes were significantly associated with LMW and BMW (p<0.05). The H1H4 diplotype had significantly higher LMW and BMW than other diplotypes (p<0.05).

Table 7
Association between diplotypes and carcass traits.

Diplotypes	LW	CW	SEW	EW	LMW*	BMW*
H1H1	2118.33±58.25	1903.83±54.23	1800.33±54.07	1529.33±45.53	163.09±6.01b	112.09±3.19b
H1H2	2199.82±60.3	1971.43±56.14	1869.11±55.96	1591.07±47.13	169.09±6.22b	118.49±3.3b
H1H3	2274.17±92.11	2042.92±85.75	1931.67±85.49	1636.25±71.99	172.58±9.5b	117.72±5.39b
H1H4	2538.33±184.22	2305±171.5	2200±170.97	1881.67±143.99	231.48±19.01a	149.45±10.08a
H2H2	2104±142.7	1902±132.84	1792±132.43	1525±111.53	165.35±14.72b	123.31±7.8b
H2H3	2052.5±112.81	1847.5±105.02	1748.13±104.7	1485±88.17	154.54±11.64b	110.29±6.17b
H3H3	1920±319.07	1735±297.04	1625±296.13	1435±249.4	133.61±32.92b	106.58±17.45b
other	2215±225.62	1987.5±210.04	1865±209.4	1595±176.35	173.21±23.28	112.27±12.34b

• “*” means there is significant difference between Least mean squares for a certain trait; Bold represents the advantageous diplotype; Underline represents the negative diplotype^a,b means no common superscript differ significantly (p<0.05).

Linkage disequilibrium (LD) analysis

LD analysis was calculated from the genotypic data of 180 Daheng broilers. LD analysis (Fig.1A, B) indicates that SNP1, SNP2, SNP3 and SNP5 were strong LDs (D>0.8 and r²>0.33), SNP4 and others were weak LDs (D<0.8 and r²<0.33).

Figure 1
Linkage disequilibrium (LD) of SNPs in the chicken MSTN exon1. (A) shows D’, (B) shows r²

DISCUSSION

Myostatin is a negative regulator of skeletal muscle growth, and loss of myostatin function will lead to a dramatic and specific increase in skeletal muscle mass (Lee & Mcpherron, 1999). The mutations that lead to loss of myostatin function have been found in these double-muscled cattle breeds, which is one of the reasons that myostatin accounts for double-muscling in cattle (Karim et al., 2015). Therefore, it is important to investigate the associations and roles of MSTN SNPs in improving chicken growth performance.

A total of five SNPs have been detected in MSTN exon of Daheng broiler, all of them are associated with some growth traits, except SNP4, but there was no significant association of each SNP with any carcass traits, MSTN gene not only regulates muscle growth, but is also involved in fat metabolism. Lin et al. (2002) studied the muscle and fat growth in the myostatin knockout mice and found that myostatin knockout increased muscle growth, but decreased fat depots at 12 weeks, compared with wild type mice. Next, it is necessary to study the effect of MSTNSNPs in adipose tissue. Previous research also found that SNP2 was associated with body weight in chicken (Mitrofanova et al., 2017). All the four SNPs (except SNP4) have significant effect on hatch. It has been reported that MSTN controlled embryonic myoblast proliferation to regulate skeletal muscle size (Dushyanth et al., 2016).Zhang et al. (2012) found SNP4 was significantly associated with body weight in Bian chicken, the genotypes AA and GA had significantly higher body weights than those of genotype GG, but in this study, there is no significant correlation between different genotypes and body weight in SNP4. It is likely to be caused by the lower genotype frequency of GG (1.12%) in Daheng broiler (Table 3) the commercial broiler compared with Bian chicken-the native breed. Commercial broiler is generated with a long-term breeding, the disadvantaged genotype was eliminated gradually during the breeding process.

Both SNP1 and SNP5 have a significant effect on body weight athatch, 1wk and 8wk. Linkage disequilibrium (LD) analysis indicate that SNP1 and SNP5 are a close LD pair (D’=1 and r²=97) (Fig. 1A, B). Meanwhile, SNP1, SNP2, SNP3 and SNP4 have strong linkage (D>0.8 and r²>0.33), which suggested that these four mutations are associated with some specific traits of interest, these results showed that the four SNPs have a significant effect on body weight at hatch which supports this conclusion. And the mutant AA genotype of SNP1 and mutant TT genotype of SNP5 are good for chicken growth, the mutant GG genotype of SNP2 and CC genotype of SNP3 are good for chicken early growth (Table 6). All of these SNPs are synonymous mutants, which were found to be significant associated with some growth traits in chicken, although synonymous SNPs do not cause any change in the amino acid and protein that they encode, they could affect mRNA stability, structure, splicing, or protein folding, which significantly affect protein function (Sauna, 2009).

It is reported that haplotype (diplotypes) determined the usefulness of closely link markers in identifying genetically superior individuals and was an essential part of the genetic architecture (Wang et al., 2014). Kim et al. (2013) suggested that diplotypes were useful for identifying more precise and distinct signals over single-locus. Thus, it is necessary to analyze the effect of diplotypes on chicken growth and carcass traits and further find the application in marker-assisted selection. In this study, a total of 7 diplotypes were constructed to study their associations with growth and carcass traits, the results indicated that H1H4 diplotype had significantly higher LMW and BMW. There were some studies that revealed that MSTN haplogroups had a significant effect on body weight and carcass traits in chicken (Bhattacharya & Chatterjee, 2013; Dushyanth et al., 2016). But in this study, H1H4 diplotype frequency is 3.33% within the limited sample population, we cannot conclude H1H4 was the most advantageous diplotype for chest muscle and leg muscle growth in Daheng broiler. It needs to be further verified.

In summary, five SNPs were identified in the chicken MSTN exon, four of those (SNP1, SNP2, SNP3 and SNP5) showed significant association with some growth traits in Daheng broiler. And they were strong linkage, except SNP4. Diplotypes were significantly associated with chest muscle and leg muscle weight, but the most advantageous diplotype needs to be further verified. Anyhow, MSTN SNPs could be the genetic markers for future MAS of chicken muscle development.

ACKNOWLEDGMENTS

This research was supported by the Open Fund of Farm Animal Genetic Resources Exploration and Innovation Key Laboratory of Sichuan Province (Grant NO.2016NYZ0043 and 2017JZ0033).

REFERENCES

• Barnes. WM. PCR amplification of up to 35-kb DNA with high fidelity and high yield from lambda bacteriophage templates Proceedings of the National Academy of Sciences of the United States of America 1994;91:2216-2220.
• Barrett JC, Fry B, Maller J, Daly MJ. Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics 2005;21:263-265.
• Bhattacharya TK, Chatterjee RN. Polymorphism of the myostatin gene and its association with growth traits in chicken. Poultry Science 2013;92:910-915.
• Boschiero C, Jorge EC, Ninov K. Association of IGF1 and KDM5A polymorphisms with performance, fatness and carcass traits in chickens. Journal of Applied Genetics 2013;54(1):103-112.
• Clop A, Marcq F, Takeda H, Pirottin D, Tordoir X, Bibe B, et al., A mutation creating a potential illegitimate microRNA target site in the myostatin gene affects muscularity in sheep. Nature Genetics 2006;38:813-818
• Dhakad G, Gahlot G, Narula H, Agrawal V, Ashraf M, Kumar M, et al.,Genetic analysis of intron 2 of Muscling Gene Myostatin (MSTN) and its Association with body weight in marwari sheep. International Journal of Livestock Research 2017;7(5).
• Dushyanth K, Bhattacharya TK, Shukla R, Chatterjee RN, Sitaramamma T, Paswan C, et al.,Gene expression and polymorphism of myostatin gene and its association with growth traits in chicken. Animal Biotechnology 2016;27:269-277.
• Elston RC. Polymorphism information content. London: John Wiley & Sons; 2005.
• Gill JL, Bishop SC, Mccorquodale C, Williams JL, Wiener P. Associations between the 11-bp deletion in the myostatin gene and carcass quality in Angus-sired cattle. Animal Genetics 2009;40:97-100
• Karim L, Coppieters W, Grobet L, Valentini A, Georges M. Convenient genotyping of six myostatin mutations causing double-muscling in cattle using a multiplex oligonucleotide ligation assay. Animal Genetics 2015;31:396-399.
• Kim, HS, Liang, L, Dean, RG, Hausman, DB, Hartzell, DL, and Baile, CA Inhibition of preadipocyte differentiation by myostatin treatment in 3T3-L1 cultures Biochemical & Biophysical Research Communications 2001;281, 902.
• Kim S, Park KC, Shin C, Cho NH, Ko JJ, Koh IS. Diplotyper: diplotype-based association analysis. BMC Medical Genomics 2013;2:S5-S5.
• Kocamis H, Kirkpatrick-Keller DC, Richter J, Killefer J. The ontogeny of myostatin, follistatin and activin-B mRNA expression during chicken embryonic development. Growth Development and Aging 1999;63:143-150.
• Langley B, Thomas MA, Sharma M, Gilmour S, Kambadur R. Myostatin inhibits myoblast differentiation by down-regulating MyoD expression. Journal of Biological Chemistry 2002;277:49831-49840.
• Lee SJ, Mcpherron AC. Myostatin and the control of skeletal muscle mass. Current Opinion in Genetics & Devolopment 1999;9:604.
• Lin J, Arnold HB, Dellafera MA, Azain MJ, Hartzell DL, et al.,Myostatin knockout in mice increases myogenesis and decreases adipogenesis. Biochemical & Biophysical Research Communications 2002;291:701-706.
• Mcpherron AC, Lawler AM, Lee SJ. Regulation of skeletal muscle mass in mice by a new TGF-psuperfamily member. Nature1997;387:83.
• Mitrofanova OV, Dementeva NV, Krutikova AA, Yurchenko OP, Vakhrameev AB, Terletskiy VP. Association of polymorphic variants in MSTN, PRL, and DRD2 genes with intensity of young animal growth in Pushkin breed chickens. Cytology and Genetics 2017;51:179-184.
• Pan H, Ping XC, Zhu HJ, Gong FY, Dong CX, Li NS, et al.,Association of myostatin gene polymorphisms with obesity in Chinese north Han human subjects. Gene 2012;494:237-241.
• Paswan C, Bhattacharya TK, Nagaraj CS, Jayashankar RNC. SNPs in minimal promoter of myostatin (GDF-8) gene and its association with body weight in broiler chicken Journal of Applied Animal Research 2014;42:304-309.
• Ranjan A. Polymorphism in exon 3 of myostatin (MSTN) gene and its association with growth traits in Indian sheep breeds. Small Ruminant Research 2017;149:81-84.
• Sauna ZE. Silent (Synonymous) SNPs: should we care about them? Methods in Molecular Biology 2009;578:23.
• Schiffer T, Geisler S, Sperlich B, Strüder HK. MSTN mRNA after varying exercise modalities in humans. International Journal of Sports Medicine 2011;32:683-687.
• Schuelke M, Wagner KR, Stolz LE, Hübner C, Riebel T, Kömen W, et al.,Myostatin mutation associated with gross muscle hypertrophy in a child. New England Journal of Medicine 2004;350:2682.
• Sharma M, Langley B, Bass J, Kambadur R. Myostatin in muscle growth and repair. Exercise & Sport Sciences Reviews 2001;29:155.
• Varga L, Müller G, Szabó G, Pinke O, Korom E, Kovács B, et al.,Mapping modifiers affecting muscularity of the myostatin mutant (Mstn (Cmpt-dl1Abc)) compact mouse. Genetics 2003;165:257.
• Wang X, Yu H, Lei A, Zhou J, Zeng W, Zhu H, et al.,Generation of gene-modified goats targeting MSTN and FGF5 via zygote injection of CRISPR/Cas9 system. Scientific Reports 2015;5:13878.
• WangY, Xu HY, Gilbert ER, Peng X, Zhao XL, Liu YP, et al.,Detection of SNPs in the TBC1D1 gene and their association with carcass traits in chicken. Gene 2014;547:288-294.
• Wehling M, Cai B, Tidball JG. Modulation of myostatin expression during modified muscle use Faseb. Journal Official Publication of the Federation of American Societies for Experimental Biology 2000;14:103.
• Wigginton JE, Cutler DJ, Abecasis GR. A Note on exact tests of hardy-weinberg equilibrium. American Journal of Human Genetics 2005;76:887-893.
• Zandi S, Zamani P, Mardani K. Myostatin gene polymorphism and its association with production traits in western azerbaijan native chickens. Iranian Journal of Applied Animal Science 2013;3:611-615.
• Zhang GX, Zhao XH, Wang JY, Ding FX, Zhang L. Effect of an exon 1 mutation in the myostatin gene on the growth traits of the Bian chicken. Animal Genetics 2012;43:458-459.

Publication Dates

• Publication in this collection
  05 Dec 2019
• Date of issue
  2019

History

• Received
  08 Jan 2019
• Accepted
  19 May 2019