Phylogeny of Dorstenia (Moraceae) reveals the polyphyletic nature of its neotropical sections

Abstract

Dorstenia, the second largest genus of Moraceae, comprises nine sections that are mainly found in Africa and America. Two of them are woody macrospermous, and the other seven are herbaceous microspermous. There are three sections in the Neotropics, all of which are herbaceous and taxonomically complex owing to their great morphological similarity. The most recent molecular phylogenetic studies of Dorstenia suggested that the neotropical sections are polyphyletic. These studies also showed that the neotropical species represent a sister group to an African woody macrospermous grade rather than African herbaceous microspermous plants. We have now expanded the number of taxa sampled and included other molecular markers to determine whether the previous phylogeny are to be corroborated or whether new taxonomic interpretations are to be followed. This study inferred the phylogeny of the group based on ITS, ETS, and trnL-F regions from 40 of the 58 neotropical species and added a new African taxon, thus including 17 of the 60 known species. Our results reaffirmed the polyphyletic nature of the neotropical sections. Dorstenia sect. Acauloma emerged within the main clade of D. sect. Kosaria (both African species), a result that confirms the affinity of these taxa already observed in previous morphological studies. We suggest Dorstenia sect. Dorstenia as the only neotropical section.

Key words
molecular markers; neotropics; phylogeny; plant evolution; rosids

Resumo

Dorstenia, o segundo maior gênero de Moraceae, compreende nove seções encontradas principalmente na África e na América. Duas delas são macrospermas lenhosas e os outros sete são microspermas herbáceas. Existem três seções na região Neotropical, todas herbáceas e taxonomicamente complexas devido à sua grande semelhança morfológica. Os estudos filogenéticos moleculares mais recentes sugerem que as seções neotropicais são polifiléticas. Esses estudos também mostraram que as espécies neotropicais representam um grupo irmão de um grado de macrospermas lenhosos africanos, em vez de microspermas herbáceos. No presente trabalho, expandimos o número de taxa amostrados e incluímos outros marcadores moleculares para determinar se a filogenia anterior deve ser corroborada e se novas interpretações taxonômicas devem ser seguidas. Este estudo inferiu a filogenia do grupo com base nas regiões ITS, ETS e trnL-F de 40 das 58 espécies neotropicais e adicionou um novo táxon africano, incluindo 17 das 60 espécies conhecidas. Nossos resultados reafirmaram a natureza polifilética das seções neotropicais. Dorstenia sect. Acauloma surgiu dentro do clado principal de D. sect. Kosaria (ambas espécies africanas), resultado que confirma a afinidade desses táxons já observada em estudos morfológicos anteriores. Nós sugerimos Dorstenia sect. Dorstenia com a única seção neotropical, porém maiores estudos moleculares são necessários.

Palavras-chave
marcadores moleculares; Neotrópico; filogenia; evolução das plantas; Rosídeas

Introduction

The mulberry family, Moraceae, contains 39 genera and approximately 1,100 species that are globally distributed throughout tropical and temperate regions (Berg 2001; Zerega & Gardner 2019). Dorstenia L. is the second largest genus of Moraceae, with approximately 115 species (Berg & Hijman 1999; Vianna-Filho et al. 2016). Clement & Weiblen (2009), Gardner et al. (2017), and Zerega & Gardner (2019) suggested that this genus together with Brosimum, Trymatococcus, Helianthostylis and others comprise the tribe Dorstenieae. The species are distributed in tropical America (ca. 45 species), Africa (ca. 60 species), India, and Sri Lanka (1 species; Carauta 1978; Berg & Hijman 1999; Berg 2001) where they inhabit the undergrowth of lowland rainforests, slopes near streams, and rocky areas (Carauta 1978; Berg 2001).

The genus Dorstenia is morphologically characterized by its herbaceous habit, but there are a few succulent and woody species (Fig. 1). Their inflorescences are primarily monoecious, with a flattened, expanded receptacle (the coenanthium) with minute both staminate and pistillate flowers that are often tightly packed together; drupaceous fruits with an explosive dehiscence; and seeds that are either macrospermous or microspermous (Berg 2001; De Granville 1971; Misiewicz & Zerega 2012; Vianna-Filho et al. 2016).

Figure 1
a-e. Examples of Dorstenia’s diversity – a-d. Neotropical species – a. D. elata, a well-known D. sect. Lecania with long stems; b. D. cayapia, a geophyte species within D. sect. Emygdioa; c-d. D. arifolia and D. ramosa, respectively, two closely related species within D. sect. Dorstenia, which differ in their inflorescence; e. D. foetida, a Paleotropical succulent species of D. sect. Kosaria.

Berg & Hijman (1999) and Berg (2001) subdivided the genus into nine sections: Dorstenia sect. Nothodorstenia Engl. (five woody species in Africa), D. sect. Xylodorstenia Hijman (six woody species in Africa), D. sect. Lecania Carauta (ca. 25 herbaceous species in the Neotropics and two in Africa), D. sect. Lomatophora Hijman (26 herbaceous species in Africa), D. sect. Dorstenia (12 herbaceous species in the Neotropics, sensu Carauta 1978), D. sect. Kosaria (Forssk.) Fisch. & C.A. Mey. (ca. 20 caulescent species in Africa and Asia), D. sect. Bazzemia Hijman (one acaulescent species in Mozambique), D. sect. Emygdioa Carauta (ca. 20 acaulescent species in the Neotropics), and D. sect. Acauloma Hijman (three succulent acaulescent tubiferous species in Africa). Carauta (1978), Berg (2001), Vianna-Filho (2012), and Santos et al. (2016) pointed out that the circumscription of the three neotropical sections is problematic (D. sect. Dorstenia, D. sect. Emygdioa, and D. sect. Lecania) because there are no clear morphological character states to segregate them.

Although the last taxonomic revisions (Berg & Hijman 1999; Berg 2001) have proposed a sectional classification and discussed the closest phylogenetic relationships between these groups and species, there are few studies based on the molecular phylogeny of Dorstenia. The two best-sampled phylogenetic analyses of Dorstenia (Misiewicz & Zerega 2012; Zhang et al. 2019) considered the genus to be monophyletic and suggested that the previous taxonomical sections were polyphyletic. An interesting finding was the position of D. elliptica Bureau, a woody macrospermous plant, as a sister of all neotropical species (Misiewicz & Zerega 2012; Zhang et al. 2019).

New possibilities have emerged after fundamental analyses by two molecular studies on Dorstenia, which mainly focused on biogeography and character evolution (Misiewicz & Zerega 2012; Zhang et al. 2019). In the Neotropics, for example, it was necessary to sample a larger number of taxa in order to determine the degree of monophyletic or polyphyletic sections/species evidenced by the first phylogenies. Misiewicz & Zerega (2012) analyzed 15 neotropical (27% of the total) and 18 African (30% of the total) species, and Zhang et al. (2019) analyzed 25 neotropical (55% of the total), 29 African (48% of the total), and one Asian (100% of the total) species. By increasing the set of neotropical taxa analyzed and using three molecular markers for the analysis, we can improve our understanding on the neotropical evolutionary history and make better decisions about the taxonomic subdivisions (sections).

Our objectives were to determine whether the genus Dorstenia is monophyletic and if the sections remain polyphyletic after with the increase of taxa sampled in the phylogeny. We also discuss the phylogenetic groupings based on morphological data, and propose further taxonomic changes.

Material & Methods

Taxon sampling

Our sampling included 57 species of ca. 115 Dorstenia species currently recognized (e.g., Carauta 1978; Berg & Hijman 1999; Berg 2001; Castro & Rappini 2010; McCoy & Massara 2008; Santos & Romaniuc 2012; Santos et al. 2013; Machado & Vianna-Filho 2012; Chase et al. 2013; Leal 2014; Machado et al. 2014; Rzepecky 2016), encompassing 72% of the neotropical species (40 species out of ca. 55) and 28% (17 species out of ca. 60) of the African species. In some cases, two or more individuals per species were analyzed, a total of 92 terminals (88 Dorstenia plus four outgroup terminals; see Table 1 for a list of sequences and their provenance). The phylogeny was rooted in Helianthostylis sprucei Baill., Brosimum guianense (Aubl.) Huber, B. alicastrum Sw., and Trymatococcus amazonicus Poepp. & Endl.

Table 1
Voucher information and Genbank accession numbers of the plant material included in this study. GenBank codes in bold are the new molecular sequences generated by this article. The number next to the species name is the laboratory number.

Name	Voucher	Origin	ETS	ITS	trnL-F
Brosimum alicastrum 70	Moreira (RB 422381)	Brazil, Amazonas	MT726149	MT726054	MT726106
Brosimum guianense 69	Rodarte A.T.A. 163 (R)	Brazil, Rio de Janeiro	MT726150	MT726055	MT726107
Dorstenia acangatara 73	Machado 875 et al. (HUEFS)	Brazil, Espírito Santo	MT726151	MT726056	MT726108
Dorstenia africana	Carvalho 5308			HQ214078
Dorstenia africana	van der Burgt et al. 527			HQ214077
Dorstenia albertorum 43	Vianna-Filho 2003 (RB)	Brazil, Espírito Santo	MT726152	MT726057	MT726109
Dorstenia albertorum 52	Vianna-Filho 2004 (RB)	Brazil, Espírito Santo	MT726153	MT726058	MT726110
Dorstenia alta	Ntemi Sallu 638			HQ214081
Dorstenia alta	Ndangalasi & Rajabu			HQ214082
Dorstenia arifolia	Carvalho 7169			HQ214101
Dorstenia arifolia 22	Pederneiras & Vianna-Filho 472 (R)	Brazil, Rio de Janeiro	MT726154	MT726059	MT726111
Dorstenia asaroides 35	Carvalho (RB 488301)	Brazil, Minas Gerais	MT726155	MT726060	MT726112
Dorstenia asaroides	Nee 42307			HQ214107
Dorstenia bahiensis 5	Vianna-Filho 2510 (RB)	Brazil, Bahia	MT726156	MT726062	MT726113
Dorstenia bahiensis 41	Vianna-Filho 2501 (RB)	Brazil, Bahia		MT726061
Dorstenia barnimiana 29	Vianna-Filho 2511 (RB)	Ethiopia, cultivated		MT726063	MT726114
Dorstenia benguellensis	Mkeya et al. 1109			HQ214102
Dorstenia bonijesu 21	Machado (RB 488318)	Brazil, Espírito Santo	MT726157	MT726064	MT726115
Dorstenia bonijesu 30	Fraga 2504 (RB)	Brazil, Espírito Santo		MT726065
Dorstenia bowmaniana 50	Vianna-Filho 2024 (RB)	Brazil, São Paulo	MT726158	MT726066	MT726116
Dorstenia brasiliensis 38	Hatschbach 11356 (RB)	Brazil, Paraná	MT726159	MT726067	MT726117
Dorstenia brasiliensis	Heringer et al. 735			HQ214110
Dorstenia brasiliensis	Jansen-Jacobs et al. 4436			HQ214111
Dorstenia brownii	Mwangoka et al. 3606			HQ214094
Dorstenia caatingae 65	Melo 8433 (HUEFS)	Brazil, Bahia	MT726160	MT726068	MT726118
Dorstenia caatingae 66	Melo 5921 (HUEFS)	Brazil, Bahia		MT726069
Dorstenia capricorniana 45	Monteiro et al. 500 (CESJ)	Brazil, Minas Gerais	MT726161	MT726070	MT726119
Dorstenia carautae 10	Silva 1953 (RB)	Brazil, Paraná	MT726162	MT726071	MT726120
Dorstenia cayapia 3	Vianna-Filho (RB 488317)	Brazil, Rio de Janeiro	MT726163	MT726072	MT726121
Dorstenia cayapia	Prance et al. 19219			HQ214109
Dorstenia choconiana	R. Aguilar 11753 (NY1096054)			FJ916995
Dorstenia choconiana	G.Weiblen 1417 (MIN)			HQ214085
Dorstenia conceptionis 19	Carvalho (RB 58223)	Brazil, Minas Gerais	MT726164	MT726073	MT726122
Dorstenia contrajerva 6	Vianna-Filho 2502 (RB)	Without provenance, cult.	MT726165	MT726074	MT726123
Dorstenia contrajerva	Martinez et al. 28913			HQ214100
Dorstenia contrajerva	Chavarria 809			HQ214099
Dorstenia djettii	Amponsah et al. 1413			HQ214076
Dorstenia dolichocaula 47	Vianna-Filho 2020 (RB)	Brazil, Rio de Janeiro	MT726166	MT726075	MT726124
Dorstenia drakena	Koch et al. 87195			HQ214097
Dorstenia drakena	Salas et al. 2105			HQ214098
Dorstenia elata 42	Carrijo 936 et al. (R)	Brazil, Rio de Janeiro	MT726167	MT726076	MT726125
Dorstenia elata	Mello-Silva et al. 1563			HQ214087
Dorstenia elliptica	Nning 20			HQ214075
Dorstenia elliptica	Thomas et al. 6990			HQ214074
Dorstenia excentrica	Nee 22374			HQ214113
Dorstenia excentrica	Misiewicz & Zerega, unvouchered			HQ214112
Dorstenia fawcettii	Crosby et al. 770			HQ214114
Dorstenia fischerii 20	Hottz (RB 488302)	Brazil, Rio de Janeiro	MT726168	MT726077	MT726126
Dorstenia foetida 34	Vianna-Filho (RB 488307)	Ethiopia, cultivated		MT726078	MT726127
Dorstenia foetida	Zerega 312			HQ214104
Dorstenia gracilis 23	Vianna-Filho (R 216119)	Brazil, Espírito Santo	MT726169	MT726079	MT726128
Dorstenia grazielae 17	Vianna-Filho 2019 (RB)	Brazil, Rio de Janeiro	MT726170	MT726080	MT726129
Dorstenia hildebrandtii 26	Vianna-Filho (RB488304)	Without provenance, cult.	MT726171	MT726081	MT726130
Dorstenia hildebrandtii	Zerega 311			HQ214103
Dorstenia hildegardis 44	Vianna-Filho 2004 (RB)	Brazil, Espírito Santo	MT726172	MT726082	MT726131
Dorstenia hirta 11	Vianna-Filho 2015 (RB)	Brazil, Rio de Janeiro	MT726173	MT726083	MT726132
Dorstenia hirta	Souza et al. 21			HQ214088
Dorstenia holstii	Ntemi Sallu 645			HQ214091
Dorstenia kameruniana	Kibure & Bofu 1045			HQ214079
Dorstenia lindeniana 55	Gerrit 36958 (MO)	Belize, Toledo		MT726084	MT726133
Dorstenia lindeniana	Alvarez 2721			HQ214083
Dorstenia mannii 56	Walthers 612 (MO)			MT726085
Dorstenia mannii	Gereau 5593			HQ214095
Dorstenia mariae 31	Fraga 2474 (RB)	Brazil, Espírito Santo	MT726174	MT726086	MT726134
Dorstenia maris 53	Vianna-Filho 2014 (RB)	Brazil, São Paulo	MT726176	MT726088	MT726136
Dorstenia maris 16	Vianna-Filho 2011 (RB)	Brazil, Mangaratiba	MT726175	MT726087	MT726135
Dorstenia milaneziana 46	Machado (R 691404)	Brazil, Espírito Santo	MT726177	MT726089	MT726137
Dorstenia milaneziana	Thomas et al. 11078			HQ214086
Dorstenia nummularia	Acevedo-Rodriguez et al. 6439			HQ214115
Dorstenia paraguariensis	Ortiz 218			HQ214108
Dorstenia peruviana 54	Fuentes 4353 (MO)	Bolivia, without locality		MT726090	MT726138
Dorstenia peruviana	Plowman 5904			HQ214084
Dorstenia picta	Gereau et al. 5189			HQ214089
Dorstenia psilurus	W.R.Q.Luke 10351Z (MO)	Congo, Lokutu
Dorstenia ramosa 12	Vianna-Filho (RB 482511)	Brazil, Rio de Janeiro	MT726178	MT726091	MT726139
Dorstenia roigii	E.L. Eckman 17973 (F)			HQ214116
Dorstenia romaniucii 67	Machado 893 et al. (HUEFS)	Brazil, Espírito Santo		MT726092
Dorstenia romaniucii 68	Machado 900 et al. (HUEFS)	Brazil, Espírito Santo	MT726179	MT726093	MT726140
Dorstenia sucrei 51	Carrijo 1359 (R)	Brazil, Espírito Santo	MT726180	MT726094
Dorstenia tenuis 33	Vianna-Filho (RB 488315)	Brazil, Paraná	MT726181	MT726095	MT726141
Dorstenia tenuis 39	Vianna-Filho 2515 (RB)	Brazil, Paraná		MT726096
Dorstenia turbinata	Cheek 11086			HQ214080
Dorstenia turnerifolia 27	Carauta 1687 (RB)	Brazil, Rio de Janeiro	MT726182	MT726097	MT726142
Dorstenia urceolata 8	Andrade (RB 450982)	Brazil, Rio de Janeiro	MT726183	MT726098	MT726143
Dorstenia urceolata 28	Lima 6418 (RB)	Brazil, Rio de Janeiro		MT726099
Dorstenia vitifolia 18	Carvalho (RB 488319)	Brazil, Minas Gerais		MT726100
Dorstenia vitifolia	Vieira et al. 554			HQ214106
Dorstenia vitifolia 2	Vianna-Filho (RB 488316)	Brazil, Minas Gerais	MT726184	MT726101	MT726144
Dorstenia warneckei 37	Vianna-Filho (RB 488308)	Without provenance, cult.		MT726102	MT726145
Dorstenia zanzibarica 59	Vianna-Filho (RB 488303)	Without provenance, cult.		MT726103	MT726146
Helianthostylis sprucei 61	Ribeiro 1531 (INPA)	Brazil, Amazonas	MT726185	MT726104	MT726147
Trymatococcus amazonicum 72	Ribeiro 1931 (INPA)	Brazil, Reserva Florestal Adolpho Ducke, Manaus	MT726186	MT726105	MT726148

The relationships among neotropical Dorstenia species were analyzed by sampling taxa from different sections, including samples from the type localities. Dorstenia sect. Dorstenia was represented by 14 species (including the type species), D. sect. Lecania was represented by 14 species out of ca. 25 species (including the type species), and D. sect. sect. Emygdioa was represented by 12 out of 20 species (including the type species).

We did not use the HQ214090, HQ214096, and HQ214105 samples, which represent, according to Misiewicz & Zerega (2012), the African taxa Dorstenia variifolia Engl., D. tayloriana Rend., and D. cuspidata Hochst. ex A. Rich., respectively, despite the fact that they seem to have emerged from within the neotropical clade. However, this was a very doubtful result due to the strong morphological dissimilarity between the African and neotropical species. The study by Zhang et al. (2019) confirmed that these taxa were not part of the neotropical clade and, therefore, we have not included them in our data matrix.

DNA extraction and sequencing

Genomic DNA was extracted from leaf material that had been dried in silica gel according to the CTAB protocol of Doyle & Doyle (1987). The plant material was ground in Eppendorf tubes containing metal beads, and the DNA samples were stored in the Brazilian Flora DNA Bank of the Rio de Janeiro Botanical Garden.

The phylogenetic relationships among the neotropical species were inferred using three molecular markers: ITS4/ITS5 for the internal transcribed spacer region (ITS; White et al. 1990) of nuclear ribosomal DNA, the trnL-F region (including the trnL intron and the trnL-F spacer; Taberlet et al. 1991), and the external transcribed spacer regions (ETS-Hel-1/18S-ETS; Baldwin & Markos 1998) (Tab. 2). These regions can be used to resolve relationships among and/or within the Moraceae genera (e.g., Weiblen 2000; Datwyler & Weiblen 2004; Weiguo et al. 2005; Rønsted et al. 2008; Clement & Weiblen 2009; Pederneiras et al. 2015).

Table 2
Primers and DNA regions analyzed in the present study.

Primers	Sequence (5’ →3’)	Region	Reference
ETS-Hel-1	GCTCTTTGCTTGCGCAACAACT	ETS	Baldwin & Markos 1998
18SETS	ACTTACACATGCATGGCTTAATCT
ITS4	CATCGATGAAGAACGTAGC	ITS/5.8S	Baldwin 1992
ITS5	GGAAGGAGAAGTCGTAACAAGG
C	GGTTCAAGTCCCTCTATCCC	trnL-F	Taberlet et al. 1991
F	ATTTGAACTGGTGACACGAG

The polymerase chain reaction (PCR) preparations contained 25 ng of DNA template, 1 × reaction buffer (10 × 10 mM Tris-HCl, pH 8.5, 50 mM KCl, 1.5 mM MgCl₂, 0.01% gelatin), 0.2 mM dNTPs, 10 pmol of each primer, and 2.5 units of Taq DNA polymerase, which resulted in a final volume of 50 µL. The ITS and ETS primers made up 4% of the DMSO total reaction volume. The BSA was added to a final concentration of 0.5 µg/µL. The following PCR profiles were used: trnL-F: 94 °C for 2 min, 35 cycles: 94 °C for 1 min, 48 °C for 1 min, 72 °C for 1 min, and 72 °C for 7 min; ITS: 94 °C for 5 min, 30 cycles: 94 °C for 1 min, 50 °C for 1 min, 72 °C for 1 min, and 72 °C for 7 min; ETS: 94 °C for 1 min, 40 cycles: 94 °C for 30 sec, 55 °C for 30 sec, 72 °C for 30 min, and 72 °C for 5 min.

The PCR products were purified and sequenced at Macrogen Inc., Seoul, South Korea. The sequencing was conducted under the BigDye^TM Terminator v3.1 cycling conditions. Then, the PCR products were purified using ethanol precipitation and run using an ABI3730XL automatic sequencer. All sequences generated for this study were deposited in GenBank (Tab. 1).

The sequences were assembled and edited with Geneious Pro 5.0.4 software (Biomatters Ltd.). Prior to assembly, the sequences were trimmed based on the quality values of the traces using the Modified-Mott algorithm, which is part of the software. The contig quality was assessed using the confidence mean value, which is the mean of the confidence scores for the contig base calls. Sequence alignments were conducted by Muscle 3.7 (Edgar 2004) using the default parameters, and subsequently checked by visual inspection.

Phylogenetic analyses

Our study included two phylogenetic approaches (maximum likelihood [ML] and Bayesian inference [BI]) for each of the four datasets (ETS, ITS, trnL-F, and all together), and there was total of eight phylogenetic trees (strict consensus tree in ML; 50% majority consensus in BI). The best-fit model was estimated for nucleotide substitution by AIC, which is part of the jModeltest (version 0.0.1) package, and the model selected was GTR+G. In the ML analysis, RAxML 8.2.12 (Stamatakis 2014) was used for phylogeny estimation with the default settings, and the data partitioned by the alignment region. The BI analysis was performed using MrBayes 3.2.7 (Ronquist et al. 2012). Two separate runs of four concurrent runs (one cold and three heated) over 30,000,000 generations were employed with sampling at every 3,000 generations. The sampled trees were summarized and those saved prior to the stationarity of the likelihood (burn-in) were excluded. CIPRES Science Gateway (Miller et al. 2010) was used for the ML and BI analyses. The ASTRAL (Mirarab et al. 2014) package was used to perform an ML analysis of the three independent molecular markers and to analyze the disagreement between the regions.

Results

This study generated 133 new DNA sequences: 52 from ITS, 43 from trnL-F, and 38 from ETS. The analysis with the ITS marker produced the same groups as the ETS and trnL-F analyses, but there was a larger set of species (92 terminals). The combined analysis of the markers (ETS, ITS, and trnL-F) produced a tree that was similar to that obtained using the ITS marker alone, but with better resolution in some terminal branches (e.g., Dorstenia carautae C.C. Berg and D. milaneziana Carauta, C. Valente & Sucre). The proportion of input quartet trees satisfied by the final ASTRAL species tree was 0.98. According to Mirarab et al. (2014), the higher this value, the less disagreement the gene trees have. On this basis, we opted to discuss the phylogenetic hypothesis based on the combined analysis of the markers. We chose to use ML out of the two analyses (ML and BI) because there were no polytomic branches (Fig. 2 and Appendix S1, available on supplementary material <https://doi.org/10.6084/m9.figshare.16569552.v1>).

Figure 2
Maximum Likelihood tree for combined molecular data (ETS + ITS + trnL-F) of 57 Dorstenia species (+ four outgroup species), representing eight sections. The length of the branches represents the genetic distance of each taxon. Pa = Paleotropical species; Ne = Neotropical species; SA = South American species; CA = Central American species. Branches in red indicate posterior probability < 0.9 or bootstrap < 90% (from the Bayesian Inference analysis, appendix). ** = a single woody macrospermous plant within the clade of herbaceous microspermous plants.

Among the paleotropical taxa, the Dorstenia sect. Xylodorstenia (BS 100%, PP 1.0) formed a monophyletic group and D. sect. Nothodorstenia formed a polyphyletic group with a solitary branch (D. elliptica) sister to all neotropical species, but this was inconclusive because of low support (BS 50%, PP < 0.5). Dorstenia sect. Kosaria formed a paraphyletic group because it included D. barnimiana Schweinf. (D. sect. Acauloma; BS 100%, PP 1.0). Dorstenia sect. Lomatophora formed a monophyletic group sister to D. sect. Kosaria and D. sect. Acauloma with moderate to high support (BS 79%; PP 1.0).

The three groups among the predominantly neotropical sections (Dorstenia sect. Dorstenia, D. sect. Lecania, and D. sect. Emygdioa) were polyphyletic with high support (BS = 100%, PP = 1.0) in most of the deep branches. Only D. picta Bureau (one of the two African species of D. sect. Lecania) emerged, along with the paleotropical species, next to the main clade of D. sect. Kosaria and D. sect. Acauloma, but had low support (BS 27%; PP 0.56). Within the predominantly neotropical clade, two branches emerged from the deepest node of the tree. One contained the South American species (BS 44%, PP 0.93) and the other contained the Central American species (BS 98%, PP 1.0).

Discussion

The analysis undertaken in this study suggested that Dorstenia forms a monophyletic group with both bootstrap and posterior probability values higher than 90% for the first and 0.9 for the second one. According to studies by Carauta (1978) and Berg & Hijman (1999), Dorstenia differs from other genera of Moraceae because it mainly consists of herbaceous plants (except for 11 African species), with bisexual inflorescences (except Dorstenia cayapia Vell.) that are discoid (saucer-shaped to cup-shaped), with pistillate flowers immersed in the receptacle, and bracts on the outer surface. All these synapomorphies are key evolutionary traits in the evolution of the group (Misiewicz & Zerega 2012) that support and identify the species within this clade.

Almost all paleotropical woody macrospermous plants emerged on the deepest nodes of the Dorstenia phylogenetic tree. Dorstenia sect. Xylodorstenia formed a monophyletic group, and D. sect. Nothodorstenia was a polyphyletic group. This early divergent position was expected because almost 90% of the Moraceae species are woody plants (only Dorstenia and Fatoua Gaudich. contain herbaceous species). The polyphyly of D. sect. Nothodorstenia section is an intriguing result. This section, together with D. sect. Xylodorstenia, only contains woody macrospermous plants. However, according to our results, D. elliptica emerges within the set of herbaceous microspermous plants.

The results suggested the validity of the hypothesis that Dorstenia sect. Nothodorstenia is phylogenetically closer to the neotropical clade (D. sect. Dorstenia, D. sect. Emygdioa, and D. sect. Lecania) rather than to the paleotropical sections. Berg & Hijman (1999) mentioned that retainment of bracts (Dorstenia sect. Nothodorstenia, D. sect. Dorstenia, D. sect. Emygdioa, and D. sect. Lecania) indicated the existence of a more recent common ancestor for these two groups compared to any other group, including D. sect. Xylodorstenia. The results indicated that this theory appears to be at least partially correct since D. elliptica (D. sect. Nothodorstenia) may be sister to all neotropical plants (Fig. 2).

Dorstenia sect. Lomatophora and D. sect. Kosaria form a monophyletic group along with the only species of D. sect. Acauloma sampled (D. barnimiana Schweinf.) and the only African D. sect. Lecania sampled (D. picta). All these taxa are herbaceous or succulent microspermous plants, paleotropical, and usually have seven or more pistillate flowers per receptacle. According to Berg & Hijman (1999), D. sect. Lomatophora and D. sect. Kosaria are close for being caulescent plants with scattered leaves and a mostly supraterraneous stem.

Dorstenia barnimiana, the only species sampled from D. sect. Acauloma (out of three) emerged among the species of D. sect. Kosaria, exactly as Berg & Hijman (1999: 120) inferred from morphological data. These groups are composed of succulent plants and, on the basis of the molecular data presented here, we infer that they should be treated within a single section. This should be better elucidated when the three species of D. sect. Acauloma and other species of D. sect. Kosaria are sampled.

Dorstenia picta, one of the two species of D. sect. Lecania in Africa, emerged from a deep node of the clade D. sect. Lomatophora + D. sect. Kosaria + D. sect. Acauloma and has a very long branch showing high evolutionary divergence. This raises the hypothesis that the African species of D. sect. Lecania can be considered a lineage that is parallel to neotropical D. sect. Lecania. Previous molecular studies also reported the same results (Misiewicz & Zerega 2012; Zhang et al. 2019). Thus, we conclude that these two species (D. picta and D. Subdentata Hijman & C.C.Berg) should be included in another section. Taxonomic studies that focus on African taxa are needed to confirm this.

According to the phylogenetic hypothesis presented in this study, the neotropical species (herbaceous microspermous plants) form a clade nested within the paleotropical species and are sisters, in part, to D. sect. Nothodorstenia (D. elliptica). According to Berg & Hijman (1999), the neotropical species diverged from paleotropical herbaceous plants, event makes by the presence of a bracteate receptacle, being closer to the African D. sect. Nothodorstenia (woody macrospermous plants) than to the other herbaceous sections (paleotropical). Therefore, reproductive traits, such as the presence and absence of bracts in the inflorescence, may play a key role in the evolution of the group, and morphological and anatomical studies focusing on this aspect may help to elucidate the systematics of the group.

Within the neotropical sections (Dorstenia sect. Dorstenia, D. sect. Emygdioa, and D. sect. Lecania), the present analysis indicated that the three sections are polyphyletic and that the neotropical clade can be subdivided into a Central American group and a South American group. Berg (2001) stated that it was very difficult to precisely delineate the three neotropical sections. Carauta (1978) used habit, leaf, stipules, and inflorescence shape to subdivide the sections, but molecular biology is questioning whether these characters clearly unify the neotropical monophyletic groups. Thus, in view of the lack of a reliable morphological distinction and the polyphyletic relationships among the species of D. sect. Dorstenia, D. sect. Emygdioa, and D. sect. Lecania, we propose the later two as synonymous of D. sect. Dorstenia.

Taxonomic treatment

Dorstenia sect. Dorstenia L., Sp. Pl. 121. 1753. Type species. Dorstenia contrajerva L. = Sychinium Desv., Mém Soc. Linn. Paris 4: 216. 1826. Dorstenia sect. Sychinia (Desv.) Carauta, Bradea 2(21): 151. 1976. Type species. Sychinium ramosum Desvaux, syn. nov.

= Dorstenia sect. Lecania Carauta, Bradea 2(21): 151. 1976. Type species. Dorstenia turnerifolia Fisch. & C.A. Mey., syn. nov.

= Dorstenia sect. Emygdioa Carauta, Bradea 2(21): 151. 1976. Carauta, Rodriguésia 29(44): 105. 1978. Type species. Dorstenia brasiliensis Lam., syn. nov.

Herbs to subshrubs, monoecious; non cactiform; stems supraterranean to entirely subterranean; internodes elongate or short. Leaves spirally alternate, stipules present, subfoliaceous to subulate. Inflorescences usually bisexual and axillary, mostly bracteate, fringe present; flowers connate; interfloral bracts lacking (occasionally rudimentary); staminate flowers among pistillate ones or at the periphery of the flowering face; pedicellate; tepals 2–3(–4), stamens 2–3, inflexed in the bud, pistillode occasionally present; pistillate flowers sessile, perianth tubular, free or sessile, stigma 2, usually unequal. Fruit dehiscent drupelet, exocarp white and fleshy, turgid, ejecting the endocarp when mature (dry); seed small, endosperm present.

The species are distributed in North America (Mexico) to South America (Argentina), with fewer species in the Amazon basin. Fifty six species are listed in D. sect. Dorstenia. Included species: D. albertorum Carauta, D. appendiculata Miq., D. arifolia Lam., D. aristeguietae Cuatrec., D. asaroides Gardner, D. bahiensis Klotzsch ex Fisch. & C.A.Mey., D. belizensis C.C.Berg, D. bonijesu Carauta & C.Valente, D. bowmaniana Baker, D. brasiliensis, D. brevipetiolata C.C.Berg, D. caimitensis Urb., D. carautae, D. cayapia, D. choconiana S.Watson, D. colombiana Cuatrec., D. conceptionis Cuatrec., D. contensis Carauta & C.C.Berg, D. contrajerva, D. crenulata C.Wright ex Griseb., D. dolichocaula Pilg., D. drakena L., D. elata Gardner, D. erythandra C.Wright ex Griseb., D. excentrica Moric., D. fawcetii Urb., D. fischeri Bureau, D. flagellifera Urb. & Ekman, D. gracilis Carauta, C.Valente & D.S.D.Araujo, D. grazielae Carauta, C.Valente & Sucre, D. hildegardis Carauta, C.Valente & O.M.Barth, D. hirta Desv., D. jamaicensis Britton, D. lindeniana Bureau, D. maris C.Valente & Carauta, D. milaneziana, D. nummularia Urb. & Ekman, D. panamensis C.C.Berg, D. peltata Engl., D. peruviana C.C.Berg, D. petraea C.Wright ex Griseb., D. ramosa (Desv.) Carauta, C.Valente & Sucre, D. rocana Britton, D. roigii Britton, D. romaniucii A.F.P.Machado & M.D.M.Vianna, D. setosa Moric., D. stellaris Al. Santos & Romaniuc, D. strangii Carauta, D. tentaculata Fisch. & C.A.Mey., D. tenuis Bonpl. ex Bureau, D. tuberosa C.Wright ex Griseb., D. turnerifolia, D. umbricola A.C.Sm., D. urceolata Schott, D. uxpanapana C.C.Berg & T.Wendt, D. vitifolia Gardner.

Excluded taxa: Dorstenia picta and D. subdentata.

Dorstenia picta (African species) was excluded from the D. sect. Dorstenia (neotropical taxon) because it does not share the most recent common ancestor with the taxa included in this section. This species emerged from within the clade D. sect. Lomatophora + D. sect. Kosaria + D. sect. Acauloma according to our results. Based on the morphological analysis, we concluded that it is a member of the section D. sect. Lomatophora, mainly because it has an herbaceous habit with creeping to ascending leafy stems and a partly subterraneous stem, which is very similar to D. psilurus Welw. Dorstenia subdentata was not sampled in the phylogenetic analysis, but after undertaking a morphological study of the species, because it is an ebracteate species, we predicted that it should also be treated as a member of the D. sect. Lomatophora.

Acknowledgements

We are grateful to Paulo Ferreira (Universidade Federal do Rio de Janeiro, in memorian) and Luciana Franco (Instituto de Pesquisas Jardim Botânico do Rio de Janeiro), for providing laboratory facilities; and to Claudio Nicoletti, Deborah Hottz (Instituto de Pesquisas Jardim Botânico do Rio de Janeiro), Jim Solomon (Missouri Botanical Garden), Anderson Machado (Universidade Estadual de Feira de Santana), and Welma Souza (Universidade Federal do Amazonas, Brazil), for providing samples of Dorstenieae. We also thank Marcelo Vianna Senior, for helping us format the images. This study was financed in part by Coordenação de Aperfeiçoamento de Pessoal de Nível Superior - Brasil (CAPES - Finance Code 001). MDMVF was the recipient of grants from CAPES and CNPq (Conselho Nacional de Desenvolvimento Científico e Tecnológico). AFC and VFM were the recipients of grants from CNPq and from Fundação de Amparo à Pesquisa do Estado do Rio de Janeiro (FAPERJ E_02/2017E_02/2017), and LCP received a grant from Fundação de Amparo à Pesquisa do Estado do Rio de Janeiro (FAPERJ, E-26/202.277/2019 and nº E-26/202.278/2019). The authors are grateful to the handling editor and the reviewers of this manuscript.

References

• Baldwin BG (1992) Phylogenetic utility of the internal transcribed spacers of nuclear ribosomal DNA in plants: an example from the compositae. Molecular Phylogenetics and Evolution 1: 3-16.
• Baldwin BG & Markos S (1998) Phylogenetic utility of the external transcribed spacer (ETS) of 18S-26S rDNA: congruence of ETS and ITS trees of Calycadenia (Compositae). Molecular Phylogenetics and Evolution 10: 449-463.
• Berg CC & Hijman MEE (1999) The genus Dorstenia (Moraceae). Ilicifolia 2: 1-211.
• Berg CC (2001) Moreae, Artocarpeae and Dorstenia (Moraceae): with introductions to the family and Ficus and with additions and corrections to Flora Neotropica 7. Flora Neotropica vol. 83. New York Botanical Garden, New York. 346p.
• Carauta JPP (1978) Dorstenia L. (Moraceae) do Brasil e países limítrofes. Rodriguésia 29: 71-73.
• Castro RM & Rappini A (2010) Flora da Bahia - Moraceae. Sitientibus ser. Ciências Biológicas 10: 97-137.
• Chase MW, Thijs KW, Kamau P & Fay MF (2013) Dorstenia christenhuszii (Moraceae), a new species from the Taita Hills, Kenya. Phytotaxa 81: 45-48.
• Clement WL & Weiblen GD (2009) Morphological evolution in the mulberry family (Moraceae). Systematic Botany 34: 530-552.
• Datwyler SL & Weiblen GD (2004) On the origin of the fig: phylogenetic relationships of Moraceae from ndhF sequences. American Journal of Botany 91: 767-77.
• De Granville JJ (1971) Notes sur la biologie florale de quelques espèces du genre Dorstenia (Moracées). Cahiers ORSTOM, Série Biologie 15: 61-97.
• Doyle JJ & Doyle JL (1987) A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemistry 19: 11-15.
• Edgar RC (2004) MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research 32: 1792-1797.
• Gardner EM, Sarraf P, Williams EW & Zerega NJC (2017) Phylogeny and biogeography of Maclura (Moraceae) and the origin of an anachronistic fruit. Molecular Phylogenetics and Evolution 117: 49-59.
• Leal ME (2014) Dorstenia luamensis (Moraceae), a new species from eastern Democratic Republic of Congo. PhytoKeys 42: 49-55.
• Machado AFP, Pereira JF & Carauta JPP (2014). Dorstenia triseriata (Moraceae) a new and endangered species from Brazil. PhytoKeys 38: 31-35.
• Machado AFP & Vianna-Filho MDM (2012) Dorstenia romaniucii (Moraceae), a new species from the Brazilian Atlantic Rain Forest. Systematic Botany 37: 451-455.
• McCoy TA & Massara M (2008) Dorstenia lavrani McCoy & Massara (family Moraceae). Cactus and Succulent Journal 80: 79.
• Mirarab S, Reaz R, Bayzid MS, Zimmermann T, Swenson MS & Warnow T (2014) ASTRAL: genome-scale coalescent-based species tree estimation. Bioinformatics 30: i541-i548.
• Misiewicz T & Zerega NJC (2012) Phylogeny, biogeography and character evolution of Dorstenia (Moraceae). Edinburgh Journal of Botany 69: 413-440.
• Pederneiras LC, Romaniuc-Neto S & Mansano VF (2015) Molecular phylogenetics of Ficus sect. Pharmacosycea and the description of Ficus subsect. Carautaea (Moraceae). Systematic Botany 40: 504-509.
• Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard MA & Huelsenbeck JP (2012) MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61: 539-542.
• Rzepecky A (2016) Dorstenia horwoodii Rzepecky sp. nov. from Nudum to Novum, a Fortyish Year Hiatus. Cactus and Succulent Journal 88: 66-74.
• Santos A, José PAS, Vianna Filho MDM & Romaniu-Neto S (2016) Dorstenia (Moraceae) da região da Serra da Mantiqueira, Brasil. Rodriguésia 67: 237-250.
• Santos A & Romaniuc-Neto S (2012) A new species of Dorstenia (Moraceae) from southeastern Brazil. Phytokeys 12: 47-51.
• Stamatakis A (2014) RAxML Version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 30: 1312-1313.
• Taberlet P, Gielly L, Pautou G & Bouvet J (1991) Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Molecular Biology 17: 1105-1109.
• Vianna-Filho MDM (2012) Filogenia de Dorstenia sect. Dorstenia e revisão taxonômica do clado arifolia. Tese de doutorado, Museu Nacional/Universidade Federal do Rio de Janeiro, Rio de Janeiro. 186p.
• Vianna-Filho MDM, Maia VH, Mansano VF & Costa AF (2016) Hijmania, a replacement name for Maria (Moraceae). Phytotaxa 247: 97-98.
• Weiblen GD (2000) Phylogenetic relationships of functionally dioecious Ficus (Moraceae) based on ribosomal DNA sequences and morphology. American Journal of Botany 87: 1342-1357.
• Weiguo Z, Yile P, Shihai ZZJ, Xuexia M & Yongping H (2005) Phylogeny of the genus Morus (Urticales: Moraceae) inferred from ITS and trnL-F sequences. African Journal of Biotechnology 4: 563-569.
• White TJ, Bruns T, Lee S & Taylor J (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ & White TJ (eds.) PCR Protocols: a guide to methods and applications. Academic Press, New York. Pp. 315-322.
• Zerega NJC & Gardner EM (2019) Delimitation of the new tribe Parartocarpeae (Moraceae) is supported by a 333-gene phylogeny and resolves tribal level Moraceae taxonomy. Phytotaxa 388: 253-265.
• Zhang Q, Gardner E, Zerega N & Sauquet H (2019) Long-distance dispersal shaped the diversity of tribe Dorstenieae (Moraceae). BioRxiv 531855. doi: <http://dx.doi.org/10.1101/531855>

Supplementary Material

See supplementary material at <https://doi.org/10.6084/m9.figshare.16569552.v1>

Edited by

Area Editor: Dr. Marcelo Trovó

Publication Dates

• Publication in this collection
  27 Sept 2021
• Date of issue
  2021

History

• Received
  28 Mar 2020
• Accepted
  27 July 2020