Isolation of 27 polymorphic nuclear microsatellite markers for Roupala montana var. brasiliensis (Proteaceae)

Abstract

Microsatellite primers pairs were developed for the Neotropical tree Roupala montana var. brasiliensis for use in studies on genetic diversity, mating system, and gene flow. Forty-two primer pairs were developed, resulting in 27 polymorphic loci, with two to 27 alleles per locus. The primer pairs were validated against 34 R. montana var. brasiliensis adult trees from four populations. The observed (H _o) and expected (H _e)heterozygosities ranged among loci from 0.061 to 0.930 (mean of 0.544) and from 0.116 to 0.950 (mean of 0.700), respectively. Null alleles were observed for ten loci. No genotypic linkage disequilibrium was detected in any pair of loci. This set of loci is suitable for population genetic studies of the species.

Key words Brazilian lacewood; Brazilian oak; High-throughput sequencing; SSR markers

INTRODUCTION

Twenty-one species and variations of the Roupala (Proteaceae) genus have been reported in Brazil (Prance et al. 2007), including lacewood (Roupala montana var. brasiliensis (Klotzsch) K.S. Edwards). Although non-endemic, this species occurs from the south of Bahia State to Rio Grande do Sul State, mainly on wet slopes and in small depressions (Rego 2009, GBIF 2019). Classified as secondary species (Sawczuk et al. 2012) or light-demanding climax species (Seubert et al. 2017), lacewood presents hermaphrodite flowers that are pollinated by small insects, and seeds are dispersed by wind (Carvalho 2003, Boeger et al. 2006). The trees can reach heights of 20 to 30 m and diameters at the breast height (dbh) between 30 and 100 cm (Boeger et al. 2006).

Used for furniture, and civil and naval construction due to its high-quality wood (Carvalho 2003, Prance et al. 2007), lacewood replaced the wood of Cardwellia sublimis (Proteaceae) when it became scarce in Australia (World Timbers Inc 2019). Despite its importance as a wood species, there is a lack of knowledge about genetic diversity, reproductive system, gene flow and conservation status in their natural populations. Previous genetic studies have been conducted using molecular markers of chloroplast and ribosomal DNA and have focused on understanding the phylogeny and phylogeography of the Proteaceae family (Hoot & Douglas 1998, Hoot et al. 1999, Barker et al. 2007).

Microsatellite loci or Simple Sequence Repeats (SSR) are highly informative molecular markers because of the differences in the number of repeated units; they are also codominant, multiallelic, and abundant in the genome, which makes them useful for a wide range of applications such population genetic studies (Govindaraj et al. 2015, Vieira et al. 2016). Thus, the limiting factor in the use of microsatellites is obtaining primers to amplify the SSR loci. Here, we describe the isolation of 27 nuclear microsatellite markers for R. montana var. brasiliensis that provide the foundation for further research on genetic diversity, population structure, mating system, conservation genetics, and possibly assist breeding programs.

MaterialS and methods

We used two methods to develop SSR markers. Total genomic DNA was extracted from leaves of a single R. montana var. brasiliensis individual (Supplementary Material - Table SI, using the protocol based on Doyle & Doyle (1990) proposed by Faleiro et al. (2003), with modifications. A microsatellite-enriched genomic library was constructed following Billotte et al. (1999). The genomic DNA was digested using the RsaI enzyme (Invitrogen, Carlsbad, California, USA), enriched in microsatellite fragments using (CT)₈ and (GT)₈ motifs. The enriched fragments were cloned into pGEM-T Easy Vector (Promega Corporation, Madison, Wisconsin, USA); ligation products were used to transform Epicurian Coli XL1-Blue Escherichia coli-competent cells (Stratagene, Agilent Technologies, Santa Clara, California, USA) that were cultivated on plates with LB medium containing 100 μg/mL ampicillin, 100 μg/mL tetracycline, 2% X-galactosidase, and 20% of isopropyl β-D-1-thiogalactopyranoside (IPTG). Ninety-six recombinant colonies were sequenced using the adapters Rsa21 (5’-CTCTTGCTTACGCGTGGACTA-3’) and Rsa25

(5’-TAGTCCACGCGTAAGCAAGAGCACA-3’) in a 3730xl DNA Analyzer sequencer (Applied Biosystems, Foster City, California, USA) and the BigDye Terminator version 3.1 Cycle Sequencing Kit (Applied Biosystems). Vector segments from each sequence were removed by VecScreen (http://www.ncbi.nlm.nih.gov/VecScreen/VecScreen.html). Pairs of primers were designed using Primer3Plus (Untergasser et al. 2012) (parameters: primer size of 18–25 bp; annealing temperature (T_a) between 52–65 °C; GC content between 40–60%; amplified fragment size of 100-300 bp). A ThermoFisher Multiple Primer Analyzer (ThermoFisher Scientific) was used to verify primer pair quality.

The second method used was based on High-throughput Sequencing (MiSeq Sequencing System, Illumina), with a Nextera DNA Flex Library Prep kit (Illumina, Inc). Total genome DNA extracted from five individuals Table SI was used in a paired-end sequencing run performed in MiSeq Reagent Nano Kit, v2 (500 cycles), with a low coverage approach. We used the SSR_pipeline software (Miller et al. 2013) to verify sequence quality and contigs and identify the SSR loci (parameters: motifs of two to six nucleotides and 40 bp flanking regions). The primer pairs were designed using the BatchPrimer3 v1.0 software (You et al. 2008).

All primer pairs were synthesized with the M13 tail (5’-TGTAAAACGACGGCCAGT-3’) (Shuelke 2000). The temperature gradient test (52.0, 53.7, 56.1, 57.3, 59.9, 61.9 °C) was applied to choose the best T_a for each primer pair and those that did not work were discarded. The microsatellite loci were amplified by PCR in a final volume of 10 μL (5 μL GoTaq Colorless Master Mix (2×) (Promega Corporation), 0.6 μL of primer mix (F+R), 0.5 μL bovine serum albumin (Thermo Fisher Scientific), 0.3 μL fluorescent dyes (6-FAM, NED, VIC, PET), 2.6 μL Nuclease-Free Water, and 1.0 ng template DNA). The amplification program for all primers was: i) initial denaturing step at 94 °C for 5 min; ii) 35 amplification cycles (94 °C for 30 s, 1 min at the specific T _a, 72 °C for 1 min); iii) 12 cycles of M13 tail incorporation (94 °C for 30 s, 53 °C for 1 min 30 s, 72 °C for 1 min 30 s); iv) a final elongation step at 72 °C for 20 min. Amplifications were performed with a Mastercycler (Eppendorf, Hamburg, Germany). The amplification product (1 μL) of each reaction was separated on an ABI 3500 DNA analyzer (Applied Biosystems) and the GeneMapper v5 software (Applied Biosystems) was used to analyze the genotypic data.

For primer validation, we sampled a total of 34 R. montana var. brasiliensis adult trees from four South Brazilian populations Table SI. The number of alleles per locus (k), observed (H_o ) and expected (H_e ) heterozygosities, and the genotypic linkage disequilibrium (LD) were estimated using the FSTAT software (Goudet 2002). The statistical significance of LD was tested using 1000 Monte Carlo permutations (alleles among individuals) and a Bonferroni correction (95%, α= 0.05). We tested deviation from expected heterozygosity (α = 5%) based on the fixation index (F) for each locus for the largest population (FLONA-Irati, N=13), using the functions basicStats and divBasic in the diveRsity package (Keenan et al. 2013) implemented in the R software environment (R Core Team 2018). We also estimated null allele frequencies for each locus using a Maximum Likelihood approach (PIM) implemented in INEST 2.1 program (Chybicki & Burczyk 2009).

Results and discussion

After the initial test of primer pair amplification, we discarded those that did not successfully yield amplified fragments. From the first method to detect SSR, a total of 22 simple sequence repeat (SSR) markers were selected for primer synthesis, but only 16 markers (Rmb4 to Rmb20) were useful (Table I). Based on the second method of the 20 initially synthetized markers, only 11 were useful (Rmb23 to Rmb44). The number of alleles per locus (k) ranged among loci from 2 to 27 (total = 338; mean = 12.5). Observed heterozygosity (H_o )ranged from 0.062 to 0.930 (mean = 0.544) and expected heterozygosity (H_e ) ranged from 0.116 to 0.965 (mean = 0.700). No genotypic linkage disequilibrium was detected in any pair of loci (data not shown). The presence of null alleles was observed at ten of the 27 loci. Loci Rmb6 and Rmb19 showed the lowest polymorphism (k= 2).

Table I
Microsatellite primers developed for Roupala montana var. brasiliensis.

	Primer sequences (5’-3’)		Repeat motif	Size range (bp)	Ta (°C)	n	k	H o	H e	Accession no.
Locus	Forward	Reverse
Rmb4	GACAGCTAAATGTAGGTCTCTTTG	GCCTGCAATACTACAAGCAG	(AG)16	144 - 202	59.9	33	27	0.752	0.965*	MN961599
Rmb5	CATGTCAGTTGCCAAACAAC	CAGCACAGGATACCAGTGTTTA	(AG)12	143 - 197	57.4	34	21	0.737	0.930*	MN961600
Rmb6	GTTTGAGCATTTCCTTCACC	CTACAAAAACGAACCACCAT	(GT)6	139 - 141	57.4	34	2	0.170	0.163	MN961601
Rmb7	GTCACGGAAAGAAGGAAAAG	AGGGATAGGTGGGGATAGAG	(CT)8(CT)12	193 - 247	53.7	34	26	0.899	0.962	MN961602
Rmb8	GAACAGCTCAAAAGGAAAGG	CTCCTGTGTCCTGTGAGAGA	(GA)17	228 - 266	53.7	31	13	0.347	0.883*	MN961603
Rmb9	CGTCCTTAAGTTGGTCAAGC	GGAACAAAGGAGAAAAATGG	(GA)9	149 - 165	59.9	33	5	0.334	0.618*	MN961604
Rmb10	TAAAGGGGACAAGCTACCAG	ATGACACGAAGAATGCCATA	(GA)10(AG)13	302 - 358	53.7	33	21	0.818	0.950	MN961605
Rmb11	GTCAGGGAGAGAGAACAGGA	CTCCCAGTTTGTGGAAAGAC	(CT)21	166 - 204	57.4	34	14	0.906	0.887	MN961606
Rmb13	CCACCTCTTCCACTACCACT	GAAGAGGAGTGGATCTTAAATAGC	(AG)10	143 - 195	53.7	34	14	0.856	0.794	MN961607
Rmb14	GGTGAGACCTCAATTCCATC	CTGCGTCAATACCATCTGAG	(TG)6(TC)8	182 - 218	57.4	34	16	0.693	0.876	MN961608
Rmb15	GGCTCATGCGTAATGAAATAG	ATGACACTTGCTCAGGGAAC	(CT)9(CT)22	219 - 315	59.9	30	19	0.334	0.951*	MN961609
Rmb16	AATATTGAGGCATGGTTGCT	GGTATGTTTCAGGGCAAAAG	(GT)7	300 - 316	53.7	34	6	0.552	0.471	MN961610
Rmb17	ATCAAATCCCAACTCTCAAG	GGCCACCTACATAGTGATCC	(CT)10	123 - 227	57.4	34	17	0.378	0.925*	MN961611
Rmb18	GTTGTTGCCTGTCACAGATG	GGGGGATTTCATTCTAAGGT	(CT)8	247 - 253	53.7	34	5	0.372	0.431	MN961612
Rmb19	CAGACAATGCCTTCAAGCTA	GATTGATCCGTGGAATATGAG	(TC)8	256 - 258	53.7	33	2	0.077	0.116	MN961613
Rmb20	CCTTGCAAAGATGAAGCAAT	GGAATCGAAATCGAAACTACC	(CT)8	119 - 179	56.1	34	22	0.930	0.949	MN961614
Rmb23	TCCACAGCAATATCAAAATGT	TTTGAAAGATTTGTAACGTGTC	(GT)8	133 - 175	59.9	34	14	0.849	0.896	MT001925
Rmb24	GTAACCTCAAACAATGCAGAA	CCAACGCAACATATATTGTAA	(AT)8	098 - 158	59.9	33	11	0.642	0.787	MT001926
Rmb28	ACTCAACTTCAAGAACCCATT	AGGTCTGAATTTTCAGGAGAC	(ATC)6	106 - 124	53.7	34	5	0.271	0.340	MT001927
Rmb29	AAGATGGCCAAGATTAATGA	CCCATTAACTGATAATTGAGTC	(ATT)7	123 - 155	57.4	32	13	0.609	0.843*	MT001928
Rmb33	TGTAAATAAACTTGGGTTGGT	AAAGACAGCTCCTACCCATAA	(TTG)6	116 - 130	56.1	33	5	0.577	0.510	MT001929
Rmb34	ACAAAAACTACCGAGGCTAGA	AAAGCTCATAAACTGCTGAAA	(TA)7	100 - 174	52.0	28	4	0.256	0.257	MT001930
Rmb35	CACTGCCAAATCAAAACTTAG	GAATTGTTGATGGCTTCTTTT	(CT)8	116 - 120	59.9	32	3	0.519	0.556	MT001931
Rmb36	CAAGACTTCTTTGAGCTTTGT	TTGTTTTGGCTAGTGAAATTG	(TC)9	115 - 167	59.9	27	4	0.061	0.212	MT001932
Rmb40	CTTCACTGATATCGTCTCTGG	TTCTTTGATCTGAAATCTGGA	(TC)21	101 - 155	53.7	32	19	0.628	0.940*	MT001933
Rmb43	ACATACAACACACCACATGC	CAGAAGGAATGAAAATGAAGA	(TC)8	099 - 195	53.7	34	13	0.515	0.753*	MT001934
Rmb44	CAGCAAGAATAACAAAGGATG	TAGCTTAGCTTGTTTCATGGT	(AG)16	082 - 114	53.7	33	17	0.603	0.929*	MT001935
Overall							12.5	0.544	0.700

• Note: T _a is the annealing temperature when run individually; is the sample size; is the number of alleles per locus; is the observed heterozygosity; is the expected heterozygosity. Bold values indicate significant departure from Hardy-Weinberg Equilibrium (α = 95%) based on the “FLONA-Irati” population. * indicates loci with significant frequenci of null alleles.

Polymorphic markers are fundamental tools to obtain accurate estimates of genetic diversity parameters and the structure of populations (Rossini et al. 2018). The 27 loci are suitable for use in further studies of R. montana var. brasiliensis, including genetic diversity, genetic structure, mating system, gene flow, and parentage analysis. Furthermore, considering that many species are located in fragmented ecosystems that are rapidly and constantly being diminished due to human activities, including logging or urban and agricultural expansion, and that these species can be studied in a comparative way (Barbará et al. 2007), the potential for cross-species microsatellite transferability is key to facilitating studies and reducing costs (Hoebee 2011, Forti et al. 2014). A large number of suitable loci increases the probability of success of cross-species transferability. Thus, the SSR primer pairs developed herein may be useful in determining the conservation status of the studied species and inform research about other Roupala species, particularly those that are endangered, which in turn contributes to a greater understanding of the Proteaceae family and forest conservation genetics.

ACKNOWLEDGMENTS

We thank Dr. Evelyn R. Nimmo for editing the English of the manuscript. The authors are grateful to Conselho Nacional de Desenvolvimento Científico e Tecnológico - CNPq (Universal 402420/2016-0) for financial support for this research. The study was financed in part by the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior – Brasil (CAPES) – Finance Code 001. Alexandre M. Sebbenn and Evandro V. Tambarussi are supported by CNPq research fellowships.

REFERENCES

• BARBARÁ T, PALMA-SILVA C, PAGGI GM, BERED F, FAY MF & LEXER C. 2007. Cross-species transfer of nuclear microsatellite markers: potential and limitations. Mol Ecol 16: 3759-3767.
• BARKER NP, WESTON PH, RUTSCHMANN F & SAUQUET H. 2007. Molecular dating of the ‘Gondwanan’ plant family Proteaceae is only partially congruent with the timing of the break-up of Gondwana. J Biogeogr 34(12): 2012-2027.
• BILLOTTE N, LAGODA PJL, RISTERUCCI AM & BAURENS FC. 1999. Microsatellite-enriched libraries: applied methodology for the development of SSR markers in tropical crops. Fruits 54: 277-288.
• BOEGER MRT, KAEHLER M, MELO JÚNIOR JCF, GOMES MZ, CHAVES CRM & SCHOLTTZ ES. 2006. Estrutura foliar de seis espécies de sub-bosque de um remanescente de Floresta Ombrófila Mista. Hoehnea 33: 521-531.
• CARVALHO PER. 2003. Espécies Arbóreas Brasileiras. Coleção Espécies Arbóreas Brasileira. Brasília: Embrapa Informações Tecnológica; Colombo, PR: Embrapa Florestas, 1039 p.
• CHYBICKI IJ & BURCZYK J. 2009. Simultaneous estimation of null alleles and inbreeding coefficients. J Hered 100(1): 106-113.
• DOYLE JJ & DOYLE JL. 1990. Isolation of plant DNA from fresh tissue. Focus 12: 13-15.
• FALEIRO FG, FALEIRO ASG, CORDEIRO MCR & KARIA CT. 2003. Metodologia para operacionalizar a extração de DNA de espécies nativas do cerrado. Planaltina: Embrapa Cerrados, 5 p.
• FORTI G, TAMBARUSSI EV, KAGEYAMA PY, MORENO MA, FERRAZ EM, IBAÑES B, MORI GM, VENCOVSKY R & SEBBENN AM. 2014. Low genetic diversity and intrapopulation spatial genetic structure of the Atlantic Forest tree, Esenbeckia leiocarpa Engl. (Rutaceae). Ann For Res 57(2): 165-174.
• GBIF SECRETARIAT. 2019. GBIF Backbone Taxonomy. Roupala brasiliensis Klotzsch. Available in <https://www.gbif.org/species/7286963> Accessed on 20 December 2019.
  » https://www.gbif.org/species/7286963
• GOUDET J. 2002. FSTAT version 2.9.3.2, a program to estimate and test gene diversities and fixation indices. Institute of Ecology, Lausanne, Switzerland. Available in <http://www2.unil.ch/popgen/softwares/fstat.htm> Accessed on 20 August 2017.
  » http://www2.unil.ch/popgen/softwares/fstat.htm
• GOVINDARAJ M, VETRIVENTHAN M & SRINIVASAN M. 2015. Importance of genetic diversity assessment in crop plants and its recent advances: an overview of its analytical perspectives. Genet Res Int: Article ID 431487.
• HOEBEE SE. 2011. Development and cross-species amplification of microsatellite markers from the endangered Wee Jasper Grevillea (Grevillea iaspicula, Proteaceae). Muelleria 29(1): 93-96.
• HOOT SB & DOUGLAS AW. 1998. Phylogeny of the Proteaceae based on atpB and atpB-rbcL intergenic spacer region sequences. Aust Syst Bot 11: 301-320.
• HOOT SB, MAGALLON S & CRANE P. 1999. Phylogeny of basal Eudicots based on three molecular data sets: AtpB, rbcL, and 18s nuclear ribosomal DNA sequences. Ann Missouri Bot Gard 86(1): 1-32.
• KEENAN K, MCGINNITY P, CROSS TF, CROZIER WW & PRODÖHL PA. 2013. diveRsity: An R package for the estimation and exploration of population genetics parameters and their associated errors. Methods Ecol Evol 4: 782-788.
• MILLER MP, KNAUS BJ, MULLINS TD & HAIG SM. 2013. SSR_pipeline: A bioinformatic infrastructure for identifying microsatellites from paired-end Illumina high-throughput DNA sequencing data. J Hered 104(6): 881-885.
• PRANCE G, PLANA V, EDWARDS KS & PENNINGTON R. 2007. Proteaceae. Flora Neotrop 100: 211-218.
• R CORE TEAM. 2018. R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. Available in <https://www.R-project.org/> Accessed on 06 March 2019.
  » https://www.R-project.org/
• REGO GM. 2009. Monitoramento da fenologia de espécies arbóreas das florestas brasileiras. Colombo: Embrapa Florestas, 2 p.
• ROSSINI BC ET AL. 2018. A new set of microsatellite loci for Cattleya walkeriana Gardner, an endangered tropical orchid species and its transferability to Cattleya loddigesii Lindl. and Cattleya nobilior Reichenbach. Plant Genet Resour-C 16(3): 284-287.
• SAWCZUK AR, FIGUEIREDO-FILHO A, DIAS NA, WATZLAWICK LF & STEPKA TF. 2012. Alterações na estrutura e na diversidade florística no período 2002-2008 de uma Floresta Ombrófila Mista Montana do Centro-sul do Paraná, Brasil. Floresta 42(1): 1-10.
• SEUBERT RC, MAÇANEIRO JP, SCHORN LA & SEBOLD DC. 2017. Regeneração natural em diferentes períodos de abandono de áreas Após extração de Eucalyptus grandis Hill ex Maiden, em Argissolo Vermelho-amarelo álico, em Brusque, Santa Catarina. Cienc Florest 27(1): 1-19.
• UNTERGASSER A, CUTCUTACHE I, KORESSAAR T, YE J, FAIRCLOTH BC, REMM M & ROZEN SG. 2012. Primer3 - new capabilities and interfaces. Nucleic Acids Res 40: e115.
• VIEIRA MLC, SANTINI L, DINIZ AL & MUNHOZ CF. 2016. Microsatellite markers: what mean and why they are so useful. Genet Mol Biol 39: 312-328.
• WORLD TIMBERS INC. 2019. Wood database and searchable library: Roupala brasiliensis. Available in < https://www.woodworkerssource.com/online_show_wood.php?wood=Roupala%20brasiliensis>.
  » https://www.woodworkerssource.com/online_show_wood.php?wood=Roupala%20brasiliensis
• YOU FM, HUO NX, GU YQ, LUO MC, MA YQ, HANE D, LAZO GR, DVORAK J & ANDERSON OD. 2008. BatchPrimer3: a high throughput web application for PCR and sequencing primer design. BMC Bioinform 9: 253.

SUPPLEMENTARY MATERIAL

Table SI.

Publication Dates

• Publication in this collection
  31 May 2021
• Date of issue
  2021

History

• Received
  6 Apr 2020
• Accepted
  24 Aug 2020