Val247Leu polymorphism of β2 glycoprotein 1 gene may justify the genesis of anti β2GP1 antibodies and Antiphospholipid Syndrome in Multibacillary Leprosy

Abstracts

FUNDAMENTOS - Anticorpos antifosfolípides (AAF), como antiβ2GP1 (β2-glicoproteína 1), são descritos na hanseníase multibacilar (MB) sem, contudo, caracterizar a síndrome do anticorpo antifosfolípide (SAF), constituída por fenômenos tromboembólicos (FTE). A mutação Val247Leu no V domínio da β2GP1 - substituição da leucina por valina - expõe epítopos crípticos com consequente formação de anticorpos antiβ2GP1. OBJETIVO: Avaliar a associação do polimorfismo Val247Leu do gene β2GP1 com títulos de anticorpos antiβ2GP1 na hanseníase. MÉTODO: O polimorfismo Val247Leu foi detectado por PCR-RFLP, e os títulos de anticorpos antiβ2GP1, por Elisa. RESULTADOS: O genótipo Val/Val estatisticamente predominou no grupo de hansênicos, em relação ao controle. Embora maiores títulos de anticorpos antiβ2GP1 IgM estivessem alocados no grupo MB com genótipos Val/Val e Val/Leu, não houve diferença estatística em relação ao genótipo Leu/Leu. Dos sete pacientes MB com FTE, quatro apresentaram heterozigose, e três Val/Val homozigose. CONCLUSÃO: A prevalência do genótipo Val/Val no grupo de hansênicos pode justificar parcialmente a presença de anticorpos antiβ2GP1 na forma MB. A heterozigose ou homozigose Val/Val nos sete pacientes com hanseníase MB e FTE corroboram a implicação de expressão fenotípica anômala da β2GPl e formação de anticorpos antiβ2GPl, com consequente FTE e SAF.

Anticorpos antifosfolípides; Beta2-glicoproteína I; Hanseníase; Polimorfismo genético

CLINICAL, EPIDEMIOLOGICAL, LABORATORY AND THERAPEUTIC INVESTIGATION

Val247Leu polymorphism of β₂ glycoprotein 1 gene may justify the genesis of anti β₂GP1 antibodies and Antiphospholipid Syndrome in Multibacillary Leprosy

Maria José Franco Brochado^I; Margarida Maria Passeri do Nascimento^II; Paulo Louzada Junior^III; José Fernando C. Figueiredo^IV; Ana Maria Roselino^V

^IBiomedical Specialist, Master in Medical Sciences and Ph.D. studies under course in Medical Sciences (supported by CAPES), Faculdade de Medicina de Ribeirão Preto (USP) - Sao Paulo (SP), Brazil

^IIBiomedical Specialist, Laboratory of Serology, Hospital das Clínicas, Faculdade de Medicina de Ribeirão Preto (USP) - Sao Paulo (SP), Brazil

^IIIPh.D., Professor, Division of Immunology, Department of Clinical Medicine, Faculdade de Medicina de Ribeirão Preto (USP) - Sao Paulo (SP), Brazil

^IVPh.D., Professor, Division of Infectious Disease, Department of Clinical Medicine, Faculdade de Medicina de Ribeirão Preto (USP) - Sao Paulo (SP), Brazil

^VAssociate Professor, Laboratory of Molecular Biology, Division of Dermatology, Department of Clinical Medicine, Faculdade de Medicina de Ribeirão Preto (USP) - Sao Paulo (SP), Brazil

^{Mailing Address}

ABSTRACT

BACKGROUND – Multibacillary (MB) leprosy may be manifested with antiphospholipid antibodies (aPL), among which anti-β₂GP1 (β₂-glycoprotein 1). High titers of aPL are associated with APS (Antiphospholipid Syndrome), characterized by thrombosis. The mutation Val247Leu in the domain V of β₂GP1 exposes hidden epitopes with consequent development of anti-β₂GP1 antibodies.

OBJECTIVE: To evaluate the Val247Leu polymorphism of β₂GP1 gene and its correlation with anti-β₂GP1 antibodies in leprosy patients.

METHODS: The Val247Leu polymorphism was performed by PCR-RFLP and anti-β₂GP1 antibodies were measured by ELISA.

RESULTS: The genotypic Val/Val was more prevalent in the leprosy group, compared to controls. Regarding the 7 MB patients with APS, four presented heterozygosis and three, Val/Val homozygosis. Although higher titrations of anti-β₂GP1 IgM antibodies were seen in MB leprosy group with Val/Leu and Val/Val genotypes, there was no statistical difference when compared to Leu/Leu genotype.

CONCLUSION: The prevalence of Val/Val homozygosis in leprosy group can partially justify the presence of anti-β₂GP1 IgM antibodies in MB leprosy. The description of heterozygosis and Val/Val homozygosis in 7 patients with MB leprosy and thrombosis corroborates the implication of anomalous phenotype expression of β₂GP1 and development of anti-β₂GP1 antibodies, with consequent thrombosis and APS.

Keywords: Antibodies, antiphospholipid; beta 2-glycoprotein I; Leprosy; Polymorphism, genetic

INTRODUCTION

Hansen's disease or leprosy, caused by bacillus Mycobacterium leprae, is endemic in many underdeveloped and developing countries ¹, and Brazil has the highest prevalence of the disease in the world ².

Clinical forms of leprosy are attributed to immune individual response of the host in face of bacillus M. leprae. These clinical forms, known as polar forms, are classified into: tuberculoid leprosy in immuneresistance Th1 pole, when it has few lesions or isolated neural affections, positive cell response to intradermoreaction of Mitsuda (IRM), and when there are bacilli in cutaneous lesions or nerves; and as Virchowian Hansen disease (WH) when it has many lesions, exacerbated humoral response, negative IRM and many bacilli in lesions and nerves, forming the non-responsive immune pole to the bacillus. In the interpolar form, or dimorphic Hansen's disease, subjects are poor reactor to IRM, with many lesions and asymmetrical neural impairment ³.

Leprosy, as a chronic infection, may occur together with the presence of antiphospholipid antibodies (APA), especially as multibacillary (MB) ⁴. APA represent the family of immunoglobulins IgG or IgM, and less frequently, IgA, which react against plasmatic proteins linked to phospholipids, or only against negatively charged phospholipids ⁵. APA are comprised of: anticardiolipin antibodies (ACA), inhibitor of lupin (IL) and anti-β₂GP1 antibodies (β₂-glucoprotein 1). High titers of APA are associated with the antiphospholipid antibody syndrome (APS), be it primary or secondary to autoimmune diseases, especially in systemic lupus erythematosus (SLE). APS is clinically characterized by thromboembolic phenomena and recurrent fetal losses ⁶. In Hansen's disease, even though APA is present, APS is not commonly described ⁷. However, in 1996, Bakos et al. wondered whether Lucio's phenomenon would represent a manifestation of APS.⁸

β₂GP1, also known as apolipoprotein H, is a simple chain glycoprotein, produced by the liver and the placenta, comprising a sequence of 326 amino acids, with molecular weight of 50 kDa ⁹. β₂GP1 binds to the surface of negative charges, including DNA, cell membranes, endothelial cells, macrophages and acid phospholipids. V domain of β₂GP1 has been suggested as the ligation site for phospholipids ¹⁰. This glycoprotein has anticoagulant and a pro-coagulant activity ¹¹.

Mutation in codon 247 of exon 7 of the gene that expresses β₂GP1 causes the modification of Leucine amino acid (Leu) into Valine (Val) in V domain of β₂GP112, resulting in modifications to the expression of spatial structure of the protein and when they are exposed to critical epitopes, there may be formation of anti-β₂GP1 antibodies in patients with APS ¹³. The interference of APA in the physiological interaction of β₂GPI with coagulation factors comprises the possible pathogenic mechanism for the occurrence of thrombosis in APS.¹¹

In recent years, seven patients were diagnosed with Hansen's disease of MB form with thromboembolic episodes, comprising APS.¹⁴

The objective of the present study was to assess the distribution of Val247Leu polymorphism of β₂GP1 gene and its correlation with anti- β₂GP1 antibodies in leprosy patients.

MATERIAL AND METHODS

Studied population

After approval by the Research Ethics Committee of Hospital das Clínicas da Faculdade de Medicina de Ribeirão Preto (HC-FMRP), University of Sao Paulo (USP) (Processes No. 9916/2005 3605/2006), and informed consent signed by the patients, 113 leprosy patients were selected: 85 classified as MB form (21 women [mean age of 46 years] and 64 men [mean age of 51 years]), with dimorphic clinical form (D), dimorphic-tuberculoid (DT), dimorphic-Virchowian (DV) and Virchowian (V), including in this group seven patients with thrombosis and APS, and 28 as paucibacillary (PB) (12 women [mean age of 44 years] and 16 men [mean age of 49 years]), with clinical forms tuberculoid (T) and DT.¹⁵ PB patients were those that had not presented bacilli at lymph bacilloscopy and skin or nerve biopsy, and DT form was considered based on number of lesions ≤ 5. The control group was formed by blood donors from Blood Bank Hemocentro - HC-FMRP-USP, from the same region, matched according to age, gender and race. Out of 113 patients and 113 controls, blood samples for extraction of DNA were collected, as well as 99 samples of serum samples of leprosy patients to quantify anti-β₂GP1 antibodies.

β₂GP1 gene polymorphism

The extraction of genomic DNA from peripheral blood was performed using Salting-out technique 16. Val247Leu polymorphism was detected by PCR-RFLP (polymerase chain reaction – restriction fragment length polymorphism). We used specific primers (sense: 5'GTGTAGGTGTACTCATCTACTGT3' and antisense: 5'CTCTCCTTGGTACACCACAGTGG3'), which amplified a fragment of 147 pb of region of exon 7 of β₂GP1 gene. PCR reactions were used according to Kamboh et al., 2004.¹⁷ To identify the mutational point, the amplified product of 147 pb was digested with an enzyme RsaI (New England Biolabs), at 37ºC, overnight.¹² Digested products were submitted to vertical electrophoresis in non-denaturing polyacrylamide gel 10% for 2 hours and 3 minutes at 200 V, and visualized after staining with silver nitrate ¹⁸.

ELISA for quantification of anti-_β2GP1 antibodies

Serum anti-β₂GP1 antibodies samples were processed by immunoenzymatic test ELISA, using commercial kits [QUANTA LiteTM β₂GPI IgM, and QUANTA LiteTM β₂GPI IgG (INOVA Diagnostics, USA)].¹⁹

Statistical Analysis

To distribute the genotypic prevalence of Val247Leu polymorphism between the groups, we used Fisher exact test or X2. To compare the titers of anti-β₂GP1 antibody according to genotypes in groups MB and PB, we used Kruskall-Wallis test followed by multiple Dunn's comparison.

RESULTS

Genetic polymorphism Val247Leu was checked in 85 MB patients, 28 PB patients and 113 healthy subjects. The distribution of genotypes was significant when comparing the group of patients with leprosy and the control subjects. The prevalence of homozygote – genotypes Val/Val and Leu/Leu – was higher in the group of leprosy, when compared to the control group. Even though there was greater predominance of heterozygote (Val/Leu) in the MB group, it was not significant when compared to the PB group (Table 1). Concerning the seven patients with MB and thrombosis, four were heterozygous and three were homozygous for the referred polymorphism. When we compared the genotype Val247Leu polymorphism with titers of anti-β₂GP1 antibodies IgG and IgM, there was no statistical difference in the studied samples (Graphs 1 and (Graph 2) even though patients with MB and PB with genotypes Leu/Val and Val/Val presented higher titers of anti-β₂GP1 antibody IgM when compared to genotype Leu/Leu. There was one patient with Lucio's phenomenon that presented as homozygote for Val/Val and high titers of anti-β₂GP1 IgM antibodies (255.4 MPL/mL).

DISCUSSION

β₂GP1 is the main antigenic target for APA present in the plasma of patients with APS²⁰. This glycoprotein is a member of the superfamily of proteins that control the complement system or SCR (short consensus repeat). It is characterized by five SCR, comprising 60 amino acids, also known as sushi domains.²¹ The first four domains (~ 60 amino acids) present two bridges of disulfide and are structurally related, whereas domain V (~84 amino acids) is more variable and has positively charged amino acids (282-287), four highly preserved hydrophobic amino acids and three bridges of disulfide ²². The exchange of amino acid Leu for Val (codon 247), in domain V of β₂GP1, may cause structural modification in the protein, causing the production of anti-β₂GP1 antibodies present in APS ²³, and the subjects that present homozygous Val247Val have higher risk of developing APS ^24,25.

The present study assessed genetic polymorphism, located in codon 247 of exon 7 of gene β₂GP1 in a sample of Brazilin population comprising both healthy and leprosy subjects. There was greater prevalence of genotype Val/Val in the leprosy group when compared to the control group. All MB patients with thrombosis were either homozygote or heterozygote (Val/Val), confirming the studies that have attributed thromboembolic phenomenon and APS to Val247Leu polymorphism.^13,24,25

Some studies have related the presence of this polymorphism with APA in patients with APS, but the results are controversial. Paloma et al. (2007) and Camilleri et al. (2003) reported that the presence of anti-β₂GP1 antibodies is not correlated with the polymorphism, whereas Yasuda et al. (2005) and Prieto et al. (2003) reported direct correlation ^24-27.

In MB leprosy, there is the description of APA, but the occurrence of the association with APS is rare ¹³. To present, there are no reports in the literature about the description of this polymorphism with APA in leprosy. In this study, we did not find any correlation between genotypes of Val247Leu polymorphism and APA titers, even though patients with MB and PB with genotypes Leu/Val and Val/Val presented higher titers of anti-β₂GP1 antibodies. Some data have attracted the attention of the authors in the present study: two patients with PB with high titers of anti-β₂GP1 antibodies were heterozygous and homozygous (Val/Val) for Val247Leu polymorphism. The review of the patient chart confirmed that it was tuberculoid form, with absence of bacilli at bacilloscopy and skin biopsy. Given that there is controversy about the cross reaction of protein β₂GP1 with the membrane phospholipid of bacillus M. leprae,⁴ these results have confirmed the specificity of anti-β₂GP1 antibodies, because these patients had high titers of anti-β₂GP1 antibodies, low titers of anti-PGL1 titers (data not shown), in the absence of the bacillus.

For the first time, the demonstration of higher prevalence of homozygous Val/Val in the leprosy population may partially justify the presence of APA in MB leprosy patients. The presence of heterozygous or homozygous Val/Val in seven patients with thrombosis and in one patient with Lucio's phenomenon confirms the implication of abnormal phenotypic expression of protein β₂GP1 and formation of anti-β₂GP1 antibodies with consequent thrombosis and APS.

CONCLUSION

In view of these results, it is suggested to provide prophylaxis of thromboembolic phenomena with anticoagulant agents to patients with MB leprosy that have high titers of APA.

REFERENCES

Conflict of interest: None

Financial funding: CNPq (proc. n. 400.930/05-6); APH (Associação Paulista contra a Hanseníase – proc. n. 092/2005)

Faepa-HC-FMRP-USP (Fundação de Auxílio ao Ensino, Pesquisa e Assistência)

How to cite this article: Brochado MJF, Nascimento MMP, Louzada Jr P, Figueiredo JFC, Roselino AM. Polimorfismo Val247Leu do gene β₂-glicoproteína 1 pode justificar a gênese de anticorpos anti-β₂GP1 e Síndrome do anticorpo antifosfolípide na hanseníase multibacilar. An Bras Dermatol. 2009;84(4)

• 1. Monot M, Honoré N, Garnier T, Araoz R, Coppée JY, Lacroix C, et al. On the origin of leprosy. Science. 2005;308:1040-2
• ²
  World Health Organization [homepage on the internet]. Prevalence of Leprosy, Geneva, Switzerland, 2007. [acesso em 01 Jul 2007] Disponível em: www.who.int/lep/situation/prevalence/en/index.html
• 3. Goulart IM, Goulart LR. Leprosy: diagnostic and control challenges for a worldwide disease. Arch Dermatol Res. 2008;300:269-90
• 4. de Larrañaga GF, Forastiero RR, Martinuzzo ME, Carreras LO, Tsariktsian G, Sturno MM, et al. High prevalence of antiphospholipid antibodies in leprosy: evaluation of antigen reactivity. Lupus. 2000;9:594-600
• 5. Galli M, Luciani D, Bertolini G, Barbui T. Anti-beta 2-glycoprotein I, antiprothrombin antibodies, and risk of thrombosis in the antiphospholipid syndrome. Blood. 2003;102:2717-23
• 6. Shoenfeld Y. Systemic antiphospholipid syndrome. Lupus. 2003;12:497-8
• 7. Arvieux J, Renaudineau Y, Mane I, Perraut R, Krilis Sa, Youinou P. Distinguishing features of anti-beta2 glycoprotein I antibodies between patients with leprosy and the antiphospholipid syndrome. Thromb Haemost. 2002;87:599-605
• 8. Bakos L, Correa CC, Bergman L, Bonamigo RR, Muller LF. Antiphospholipid antibodies thrombotic syndrome misdiagnosed as Lucio's phenomenon. Int J Lepr Other Mycobact Dis. 1996;64:320-3
• 9. Schwarzenbacher R, Zeth K, Diederishs K, Gries A, Kostner GM, Prassl R. Crystal structure of human beta2- glycoprotein I: implication for phospholipids binding and the antiphospholipid syndrome. Embo J. 1999; 18:6228-39
• 10. Medhi H, Naqvi A, Kamboh MI. A hydrophobic sequence at position 313-316 (Leu-Ala-Phe-Trp) in the fifth domain of apolipoprotein H (beta2-glycoprotein I) is crucial for cardiolipin binding. Eur J Biochem. 2000; 267:1770-6.
• 11. Myakis S, Giannakopoulos B, Krilis SA. Beta 2 glycoprotein I-function in health and disease. Thromb Res. 2004;114:335-46
• 12. Steinkasserer A, Dörner C, Würzner R, Sim RB. Human beta-2 glycoprotein I: molecular analysis of DNA and amino acid polymorphism. Hum Genet. 1993;91:401-2
• 13. Atsumi T, Tsutsumi A, Amengual O, Khamashta MA, Hughes GR, Miyoshi Y, et al. Correlation between beta 2-glycoprotein I valine/leucine247 polymorphism and anti-beta 2-glycoprotein I antibodies in patients with primary antiphospholipid syndrome. Rheumatology (Oxford). 1999;38:721-3
• 14. Roselino AM, Brochado MJF, Chociay MF, Sousa A, Louzada Jr. P, Zago MA. Thrombosis in patients with leprosy in treatment for reaction type 2 with thalidomide is not related to genetic factors of coagulation. In 21st World Congress of Dermatology, 2007; Buenos Aires, Argentina, Book of Abstracts; 2007. p.762
• 15. Ridley DS, Jopling WH. Classification of leprosy according to immunity. A five-group system. Int J Lepr Other 16. 1966;34:255-73.
• 16. Roselino AM. Biologia molecular aplicada às dermatoses tropicais. An Bras Dermatol. 2008;83:187-203
• 17. Kamboh MI, Sanghera DK, Medhi H, Nestlerode CS, Chen Q, Khalifa O, et al. Single nucleotide polymorphisms in the coding region of the apolipoprotein H (beta2-glycoprotein I) gene and their correlation with the protein polymorphism, anti-beta 2 glycoprotein I antibodies and cardiolipin binding: description of novel haplotypes and their evolution. Ann Hum Genet. 2004;68:285-99
• 18. Sanguinetti CJ, Dias Neto E, Simpson AJ. Rapid silver staining and recovery of PCR products separate on polyacrylamide gels. Biotechniques. 1994;17:914-21
• 19. Iverson GM, Victoria EJ, Cockerill KA, Linnik MD. Advances in understanding what we measure when detecting anticardiolipin autoantibodies. Clin Chim Acta. 2004;343:37-44.
• 20. de Laat B, Mertens K, de Groot PG. Mechanism of disease: antiphospholipid antibodies from clinical association to pathologic mechanism. Nat Clin Pract Rheumatol. 2008;4:192-9
• 21. Rand J. Molecular pathogenesis of the Antiphospholipid syndrome. Circ Res. 2002;90:29-37
• 22. Mehdi H, Naqvi A, Kamboh MI. A hydrophobic sequence at position 313-316 (Leu-Ala-Phe-Trp) in the fifth domain of apolipoprotein H (beta 2-glycoprotein I) is crucial for cardiolipin binding. Eur J Biochem 2000;267:1770-6.
• 23. Loizou S, Singh S, Wypkema E, Asherson RA. Anticardiolipin, anti-beta(2)-glycoprotein I and antiprothrombin antibodies in black South African patients with infectious disease. Ann Rheum Dis. 2003;62:1106-11
• 24. Yasuda S, Atsumi T, Matsuura E, Kaihara K, Yamamoto D, Ichikawa K, et al. Significance of valine/leucine247 polymorphism of beta2-glycoprotein I in antiphospholipid syndrome: increased reactivity of anti-beta2-glycoprotein I autoantibodies to the valine247 beta2-glycoprotein I variant. Arthritis Rheum. 2005;52:2128
• 25. Prieto GA, Cabral AR, Zapata-Zuñiga M, Simón AJ, Villa AR, Alarcón-Segovia D, et al. Valine/valine genotype at position 247 of the beta2 glycoprotein I gene in Mexican patients with primary antiphospholipid syndrome: association with anti-beta2 glycoprotein I antibodies. Arthritis Rheum. 2003;48:4714
• 26. Palomo I, Pereira J, Alarcón M, Vásquez M, Pinochet C, Poblete F, et al. Val/Leu247 and Trp/Ser316 polymorphisms in beta 2 glycoprotein I and their association with thrombosis in unselected Chilean patients. Clin Rheumatol. 2007;26:302-7
• 27. Camilleri RS, Mackie IJ, Humphries SE, Machin SJ, Cohen H. Lack of association of β₂ glycoprotein I polymorphisms Val247Leu and Trp316Ser with antiphospholipid antibodies in patients with thrombosis and pregnancy complications. Br J Haematol. 2003;120:1066-72

Publication Dates

• Publication in this collection
  19 Oct 2009
• Date of issue
  Aug 2009

History

• Received
  18 Aug 2008
• Accepted
  08 Dec 2008