Open-access Identificação molecular de Ehrlichia sp em um bovino do Cerrado brasileiro - relato de caso

abmvz Arquivo Brasileiro de Medicina Veterinária e Zootecnia Arq. Bras. Med. Vet. Zootec. 0102-0935 1678-4162 Universidade Federal de Minas Gerais, Escola de Veterinária RESUMO Infecções por Ehrlichia em bovinos são frequentes na África, mas também foram relatadas no Brasil e na América do Norte. Este artigo relata uma infecção natural por Ehrlichia sp. associado a Babesia bigemina e Anaplasma marginale em um bezerro, no município de Campo Grande, Mato Grosso do Sul, Brasil, o qual apresentava polioencefalomalácia. A evidência molecular, baseada em um fragmento do gene dsb, indica uma espécie de Ehrlichia geneticamente relacionada a Ehrlichia canis e outras espécies do gênero encontradas no carrapato Rhipicephalus (Boophilus) microplus e em um bezerro do Brasil (99 a 100% de identidade). Não foi possível associar os sinais clínicos à infecção por Ehrlichia devido a coinfecções e evidências histológicas de outra doença. No entanto, a circulação da bactéria em bovinos no Cerrado brasileiro foi confirmada, e mais atenção deve ser dada à suspeita clínica de patógenos transmitidos por carrapatos em bovinos para esclarecer o potencial patogênico de Ehrlichia sp. INTRODUCTION Anaplasmataceae (Ehrlichia/Anaplasma) infections in cattle are frequently associated with Ehrlichia ruminantum, Anaplasma marginale, Anaplasma bovis (formerly Ehrlichia bovis), and Anaplasma phagocytophilum (Aktas and Özübek, 2015; Lorusso et al., 2016). In recent years, however, a novel genotype of Ehrlichia (proposed name: Ehrlichia minasensis) (Cruz et al., 2016) closely related to E. canis has been detected in cattle from North America (Gajadhar et al., 2010) and Brazil (Aguiar et al., 2014) as well as the cattle tick Rhipicephalus (Boophilus) microplus (Cruz et al., 2012). The geographical distribution and clinical significance of Ehrlichia/Anaplasma infections in cattle are well documented for some species (E. ruminantum, A. marginale, and A. phagocytophilum) (Brito et al., 2010; Aktas and Özübek, 2015). However, little information is available on other species (e.g., E. minasensis). In Brazil, only A. marginale (Brito et al., 2010) and recently Ehrlichia sp. infections have been reported in cattle (Aguiar et al., 2014). The clinical and epidemiological importance of these species of Ehrlichia to cattle remains unknown, although clinical and hematological abnormalities consistent with ehrlichiosis have been observed in experimentally infected calves (Aguiar et al., 2014). In the present study, we report the natural infection of Ehrlichia sp. in a calf from the state of Mato Grosso do Sul, Brazil. CASUISTRY A 10-month-old Nelore female with a three-day history of apathy, anorexia, and lateral decubitus was sent for clinical care at the Veterinary Hospital of the Universidade Federal de Mato Grosso do Sul (UFMS), Campo Grande, Brazil, in September 2015. The calf belonged to a lot of 130 calves of the same age group allocated to 130 hectares of pasture (Brachiaria sp.) and supplemented with protein and mineral salt. The farm was located in the municipality of Campo Grande (20°26’34” S, 54°38’47” W). According to information from the owner, no other sick animals were found in the herd. Blood was collected for the hematological and molecular analyses in EDTA tubes (BD Vacutainer®, USA). DNA extraction was performed with a blood sample of 350ul using the method in house. The integrity and quantity of the DNA sample was verified by electrophoresis in agarose gel (0.8%) and spectrophotometry (A260/A280nm) in a BioPhotometer Plus (Eppendorf®,USA), respectively. PCR reactions were performed according to Buling et al. (2007) for Babesia bovis and B. bigemina, Silva et al. (2006) for Anaplasma marginale, and Doyle et al. (2005) for Ehrlichia sp. The primers used are shown in Table 1. Table 1 List of primers used in this study Primer name Sequence (5’-3’) Target Amplicon size bp Cybi GTTCCAGGAGATGTTGATTC cytochrome b gene of Babesia bigemina 263 Cbbr CTCCCCARTAACTCATTTGT Cybo GTTCCTGGAAGCGTTGATTC cytochrome b gene of Babesia bovis 263 Cbbr CTCCCCARTAACTCATTTGT msp5-F ATGAGAATTTTCAAGATTGTGTCTAACCTT msp5 gene of Anaplasma marginale 714 msp5-R AGGAAAGCCCCCAAAGCCCCATACTT dsb-321 TTGCAAAATGATGTCTGAAGATATGAAACA dsb gene of Ehrlichia spp. 378 dsb-671 GCTGCTCCACCAATAAATGTATCYCCTA b1 CAA CCG AGA CGG AAA GCT CC glycoprotein C gene of bovine herpesvirus 1 and 5 354 (BoHV-1) 159 (BoHV-5) b5 CGG ACG AGACGC CCT TGG Bcon AGT GCA CGT ACA GCG GCT CG To identify the Ehrlichia species involved, the amplicon obtained from the PCR reaction to Ehrlichia sp. was purified using the QIAEX II kit (Qiagen ®, Germany) and sequenced in both directions using ABI 3130 automated capillary DNA sequencing. The chromatograms were analyzed, and a consensus sequence was obtained using the BioEdit program. Phylogenetic analysis was performed, and a tree was constructed based on the neighbor joining method using the MEGA 6 program with a nonparametric bootstrap robustness of 1000 pseudo replicates. After euthanasia of the animal, necroscopic and histopathological analyses were performed. Due to the appearance of clinical neurological signs, a multiplex PCR for bovine herpesvirus 1 and 5 was performed according to Claus et al. (2005) (primers displayed in Table 1) from brain fragments. The results of all PCR reactions were visualized in a UV transilluminator (BioRad®, USA) after electrophoresis in agarose gel 3% stained with GelRed (Biotium®, USA) following the manufacturer’s instructions. For each PCR reaction, the respective positive control from the DNA bank of the Laboratório de Biologia Molecular - FAMEZ/UFMS was used. Nuclease-free water was used as the negative control. DISCUSSION AND CONCLUSIONS The physical examination revealed depression, cachexia, ticks, pale mucous membranes, severe dehydration, heart rate of 90bpm, normophonetic heart sounds, rectal temperature of 39.3°C, one low-intensity rumen movement every three minutes, and yellow-green pasty diarrhea. Normochromic microcytic anemia, hypoproteinemia, and hyperfibrinogenemia were identified during the hematological analysis, along with inclusions similar to Babesia sp. and Anaplasma sp. in erythrocytes and Erhlichia sp. morulae in mononuclear cells. Positive PCR results were found for B. bigemina, A. marginale, and Ehrlichia sp. After DNA sequencing, the amplicon obtained in the Ehrlichia PCR reaction demonstrated 99 to 100% identity with DNA sequences of Ehrlichia sp. found in the hemolymph of R. (Boophilus) microplus in the state of Minas Gerais and Ehrlichia sp. isolated from a calf in the state of Mato Grosso, Brazil, respectively (GenBank accession numbers JX629808 and KF621012, respectively). The phylogenetic analysis showed a cluster among the DNA sequences of Ehrlichia sp. identified in the present study as well as isolates from cattle and ticks from Brazil. Moreover, common ancestry was observed with Ehrlichia canis isolates, supported by a high bootstrap value (100%) (Figure 1). The DNA sequence obtained in the present study was deposited in the Genbank under access number KX595269. Figure 1 Phylogenetic tree based on a 317bp fragment of the dsb gene showing the relationship among cattle Ehrlichia sp. (arrow indicates Ehrlichia sp. found in the present study), E. canis, and other Ehrlichia species. After the physical and hematological examinations, the calf was treated intramuscularly with diminazene diaceturate (4mg/kg) and oxytetracycline (20mg/kg). Intravenous fluid therapy with Ringer's lactate was also performed. However, neurological signs, such as blindness and opisthotonos, were identified two days after the onset of the treatment protocol. Due to the deterioration of the clinical state, the animal was euthanized in accordance with current legislation and the body was submitted to necropsy and histopathological analysis. No macroscopic abnormalities were observed. In the microscopic analysis, laminar neuronal necrosis was found, with polioencephalomalacia in the parietal and occipital cortex. Multiplex PCR for bovine herpesvirus 1 and 5 presented negative results. It was not possible to associate the clinical signs presented by the animal with Ehrlichia sp. infection due the presence of co-infection with B. bigemina and A. marginale. The lesions and clinical signs were consistent with polioencephalomalacia. According to a study by Sant’Ana et al. (2009), polioencephalomalacia is associated with several conditions, such as thiamine deficiency, poisoning by sulfur, salt poisoning, and bovine herpes virus. In the present report, based on the epidemiological characteristics (young animal feeding on sprouting pasture, isolated case, absence of bovine herpes lesions, and negative PCR results in brain tissue for Ehrlichia sp. and herpesvirus), polioencephalomalacia was most likely caused by thiamine deficiency. This is the first report of Ehrlichia sp. in a bovine from the state of Mato Grosso do Sul, Brazil and in Cerrado biome. Although the importance of Ehrlichia sp. as causal agent of disease in cattle remains unclear, attention should be given to tick-borne diseases with the aim of accumulating evidence and achieving greater precision in the definition of the importance of this agent to the health and productivity of cattle herds. ACKNOWLEDGEMENTS This study was financed in part by the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) - Finance Code 001 and by the Fundação de Apoio ao Desenvolvimento do Ensino, Ciência e Tecnologia do Estado de Mato Grosso de Sul- Brasil (FUNDECT) - Finace Code FUNDECT/CNPq 14/2014. REFERENCES AGUIAR, D.M.; ZILIANI, T.F.; ZHANG, X. et al. A novel Ehrlichia genotype strain distinguished by the TRP36 gene naturally infects cattle in Brazil and causes clinical manifestations associated with ehrlichiosis. Ticks Tick Borne Dis., v.5, p.537-544, 2014. AGUIAR D.M. ZILIANI T.F. ZHANG X. A novel Ehrlichia genotype strain distinguished by the TRP36 gene naturally infects cattle in Brazil and causes clinical manifestations associated with ehrlichiosis Ticks Tick Borne Dis. 5 537 544 2014 AKTAS, M.; ÖZÜBEK, S. Bovine anaplasmosis in Turkey: First laboratory confirmed clinical cases caused by Anaplasma phagocytophilum. Vet. Microbiol., v.178, p.246-251, 2015. AKTAS M. ÖZÜBEK S Bovine anaplasmosis in Turkey: First laboratory confirmed clinical cases caused by Anaplasma phagocytophilum Vet. Microbiol. 178 246 251 2015 BRITO, L.G.; OLIVEIRA, M.C.S.; ROCHA, R.B. et al. Anaplasma marginale infection in cattle from southwestern Amazonia. Pesqui. Vet. Bras., v.30, p.249-254, 2010. BRITO L.G. OLIVEIRA M.C.S. ROCHA R.B. Anaplasma marginale infection in cattle from southwestern Amazonia Pesqui. Vet. Bras. 30 249 254 2010 BULING, A.; CRIADO-FORNELIO, A.; ASENZO, G. et al. A quantitative PCR assay for the detection and quantification of Babesia bovis and B. bigmina. Vet. Parasitol., v.147, p.16-25. 2007. BULING A. CRIADO-FORNELIO A. ASENZO G. A quantitative PCR assay for the detection and quantification of Babesia bovis and B bigmina. Vet. Parasitol. 147 16 25 2007 CLAUS, M.P.; ALFIERI, A.F.; FOLGUERAS-FLATSCHART, A.V. et al. Rapid detection and differentiation of bovine herpesvirus 1 and 5 glycoprotein C gene in clinical specimens by multiplex-PCR. J. Virol. Methods, v.128, p.183-188, 2005. CLAUS M.P. ALFIERI A.F. FOLGUERAS-FLATSCHART A.V. Rapid detection and differentiation of bovine herpesvirus 1 and 5 glycoprotein C gene in clinical specimens by multiplex-PCR J. Virol. Methods 128 183 188 2005 CRUZ, A.C.; ZWEYGARTH, E.; RIBEIRO, M.F.B. et al. New species of Ehrlichia isolated from Rhipicephalus (Boophilus) microplus shows naortholog of the E. canis major immunogenic glycoprotein gp36 with a new sequence of tandem repeats. Parasit. Vectors, 2012. Availalble in: <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3533933/pdf/1756-3305-5-291.pdf>. Accessed in: 26 Sep. 2018. CRUZ A.C. ZWEYGARTH E. RIBEIRO M.F.B. New species of Ehrlichia isolated from Rhipicephalus (Boophilus) microplus shows naortholog of the E. canis major immunogenic glycoprotein gp36 with a new sequence of tandem repeats Parasit. Vectors 2012 https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3533933/pdf/1756-3305-5-291.pdf CRUZ, A.C.; ZWEYGARTH, E.; VANCOVA, M. et al. Ehrlichia minasensis sp. nov., isolated from the tick Rhipicephalus microplus. Int. J. Syst. Microbiol., v.66, p.1426-1430, 2016. CRUZ A.C. ZWEYGARTH E. VANCOVA M. Ehrlichia minasensis sp. nov., isolated from the tick Rhipicephalus microplus Int. J. Syst. Microbiol. 66 1426 1430 2016 DOYLE, C.K.; LABRUNA, M.B.; BREITSCHWERDT, E.B. et al. Detection of medically important Ehrlichia by quantitative multicolor Taqman Real-time polymerase chain reaction of the dsb gene. J. Mol. Diag., v.7, p.504-510, 2005. DOYLE C.K. LABRUNA M.B. BREITSCHWERDT E.B. Detection of medically important Ehrlichia by quantitative multicolor Taqman Real-time polymerase chain reaction of the dsb gene J. Mol. Diag. 7 504 510 2005 GAJADHAR, A.; LOBANOV, V.; SCANDETT, W.B. et al. A novel Ehrlichia genotype detected in naturally infected cattle in North America. Vet. Parasitol., v.173, p.324-329, 2010. GAJADHAR A. LOBANOV V. SCANDETT W.B. A novel Ehrlichia genotype detected in naturally infected cattle in North America Vet. Parasitol. 173 324 329 2010 LORUSSO, V.; WIJNVELD, M.; MAJEKODUNMI, A.O. et al. Tick-borne pathogens of zoonotic and veterinary importance in Nigerian cattle. Parasit. Vectors, 2016. Available in: <https://parasitesandvectors.biomedcentral.com/track/pdf/10.1186/s13071-016-1504-7>. Accessed in: 27 Sep. 2018. LORUSSO V. WIJNVELD M. MAJEKODUNMI A.O. Tick-borne pathogens of zoonotic and veterinary importance in Nigerian cattle Parasit. Vectors 2016 https://parasitesandvectors.biomedcentral.com/track/pdf/10.1186/s13071-016-1504-7 SANT’ANA, F.J.F.; LEMOS, R.A.A.; NOGUEIRA, A.P.A. et al. Poliencefalomacia em ruminantes. Pesqui. Vet. Bras., v.29, p.81-694, 2009. SANT’ANA F.J.F. LEMOS R.A.A. NOGUEIRA A.P.A. Poliencefalomacia em ruminantes Pesqui. Vet. Bras. 29 81 694 2009 SILVA, V.M.G.; ARAÚJO, F.R.; MADRUGA, C.R. et al. Comparison between indirect enzyme-linked immune sorbent assays for Anaplasma marginale antibodies with recombinant major surface protein 5 and initial body antigens. Mem. Inst. Oswaldo Cruz, v.101, p.511-516, 2006. SILVA V.M.G. ARAÚJO F.R. MADRUGA C.R. Comparison between indirect enzyme-linked immune sorbent assays for Anaplasma marginale antibodies with recombinant major surface protein 5 and initial body antigens Mem. Inst. Oswaldo Cruz 101 511 516 2006
location_on
Universidade Federal de Minas Gerais, Escola de Veterinária Caixa Postal 567, 30123-970 Belo Horizonte MG - Brazil, Tel.: (55 31) 3409-2041, Tel.: (55 31) 3409-2042 - Belo Horizonte - MG - Brazil
E-mail: abmvz.artigo@gmail.com
rss_feed Acompanhe os números deste periódico no seu leitor de RSS
Acessibilidade / Reportar erro