Open-access Gene de virulência cagA de Helicobacter pylori e doenças esogastroduodenais severas: existe uma associação?

Arq Gastroenterol ag Arquivos de Gastroenterologia Arq. Gastroenterol. 0004-2803 1678-4219 Instituto Brasileiro de Estudos e Pesquisas de Gastroenterologia e Outras Especialidades - IBEPEGE. RESUMO CONTEXTO: Helicobacter pylori coloniza aproximadamente metade da população humana mundial. A presença do microrganismo na mucosa gástrica está associada a um risco aumentado de adenocarcinoma gástrico, linfoma gástrico e úlcera péptica. No Brasil, a alta prevalência de infecção por H. pylori é um grave problema de saúde. Os fatores de virulência de H. pylori estão associados a risco aumentado de distúrbios gastrointestinais severos. O gene cagA codifica um antígeno associado à citotoxina A (CagA) que está envolvido na patogenicidade bacteriana. As cepas de H. pylori portadoras da ilha de patogenicidade cag (cag-PAI) estão significativamente associadas a desfechos clínicos severos e alterações histopatológicas. OBJETIVO: O presente estudo tem como objetivo investigar a prevalência do gene cagA entre isolados de H. pylori de pacientes com diferentes desordens gástricas, bem como verificar sua associação com desfechos clínicos. Além disso, a análise filogenética foi realizada em cepas de H. pylori cagA-positivas de pacientes com doenças severas e não severas. MÉTODOS: Amostras gástricas foram coletadas por meio de biópsia gástrica de 117 pacientes com diferentes doenças esogastroduodenais. O DNA foi extraído das amostras e utilizado para amplificar os fragmentos gênicos correspondentes aos genes RNA ribossomal 16S e cagA, através da reação em cadeia da polimerase. Os produtos da reação em cadeia da polimerase de amostras selecionadas positivas para cagA foram sequenciados e as sequências foram alinhadas com sequências de referência do National Center for Biotechnology Information (NCBI) (Bethesda/EUA). As análises filogenéticas foram realizadas a partir do sequenciamento e construção da árvore filogenética. RESULTADOS: H. pylori foi detectado em 65,9% (77/117) dos pacientes brasileiros com diferentes distúrbios gastroduodenais. No total, 80,5% (62/77) das cepas foram cagA-positivas. As idades dos pacientes com cepas cagA-positivas (15 homens e 47 mulheres) variaram de 18 a 74 anos. As lesões foram categorizadas como não severas e severas de acordo com o laudo endoscópico e histopatológico. A lesão esogastroduodenal não severa mais prevalente foi gastrite 54/77 (70,12%), seguida de esofagite 12/77 (15,58%) e duodenite 12/77 (15,58%). Em contraste, as lesões severas mais prevalentes foram atrofia 7/77 (9,09%), seguida de metaplasia 3/77 (3,86%) e adenocarcinoma gástrico 2/77 (2,59%). As análises filogenéticas realizadas com as sequências parciais do gene cagA obtidas de cepas locais foram agrupadas no mesmo clado. Nenhuma diferença na distribuição filogenética foi detectada entre doenças severas e não severas. CONCLUSÃO: O gene cagA é altamente prevalente entre isolados de H. pylori de lesões gástricas em pacientes brasileiros. A presença do gene cagA não foi considerada um marcador de severidade das lesões esogastroduodenais no presente estudo. Este é o primeiro estudo a investigar a estrutura filogenética da população de cepas de H. pylori em uma capital brasileira. Esses resultados irão contribuir para o entendimento sobre o desfecho clínico da infecção por H. pylori. INTRODUCTION Helicobacter pylori is a gram-negative bacterium that colonizes the human gastric mucosa1. It is estimated that approximately half of the world’s population is colonized by H. pylori2. Transmission routes of H. pylori are associated with precarious socioeconomic conditions. Therefore, the prevalence of H. pylori infection is significantly higher in developing countries3. In Brazil, the prevalence of infection in some regions is comparable to that of infection rates in Africa, where rates can reach 90%4,5. H. pylori infection favors the development of gastrointestinal diseases, such as gastritis, ulcers, atrophy, lymphoma of the lymphoid tissue of the mucosa (MALT), and gastric adenocarcinoma (GA)6. Due to its well-established role in carcinogenesis, H. pylori was classified as a Group I carcinogen by the World Health Organization (WHO) in 19947. In addition, H. pylori infection is associated with gastroesophageal reflux (GERD). The mechanism underlying H. pylori infection-associated GERD is not yet fully understood. Some studies have shown that H. pylori-positive patients with arthritis have hypergastrinemia with a consequent decrease in gastric pH. This leads to the worsening of GERD symptoms. However, other studies have reported that the use of proton pump inhibitors in the treatment of H. pylori infection can lead to an increase in gastric pH levels, reducing the symptoms of GERD8-10. The development of esogastroduodenal lesions depends on the complex and dynamic relationship between the parasite and the host. This, in turn, is determined by several factors. These include genetic susceptibility of the host, environmental factors, and bacterial virulence11. The bacterial strains have various virulence genes that influence the pathogenicity of the infection; these include ureA, ureB, vacA, cagE, sabA, ice, and the gene associated with cytotoxin A (cagA)12-14. The cagA oncogene, located on the pathogenicity island (cag-PAI), encodes the cytotoxin associated with gene A (CagA)15,16. The interaction of CagA, with molecules in the gastric epithelium of the host, can increase the severity of esogastroduodenal diseases17. The bacterium uses the type IV secretion system (T4SS) to inject bacterial factors into the host’s intracellular environment18,19. Once in the intracellular medium, CagA can follow two pathways: independent phosphorylative and dependent phosphorylative. In the independent phosphorylative pathway, the main cellular changes are interruption of mitogenic signals, changes in cell-cell junctions, and the exacerbation of the activity of inflammatory pathways15. The dependent phosphorylative pathway occurs when CagA is initially phosphorylated in the EPYIA region (Glu-Pro-Ile-Try-Ala) by the kinases of the SCR and Abl family, followed by binding to the SH2 domain of SHP-2 phosphatase16,20. The formation of the CagA-SHP-2 complex causes abnormal cell events. These include the dysregulation of cell growth, changes in the cytoskeleton, increased proliferation and mobility, changes in cell junctions, and the expression of pro-inflammatory, pro-mitogenic, and pro-apoptotic proteins12. cagA is one of the most characterized virulence genes as severe esogastroduodenal lesions, such as GA, are frequently associated with cagA-positive H. pylori strains21,22. Although some studies have demonstrated the association of this gene with severe esogastroduodenal diseases, there is still a lack of information regarding the Brazilian population. The aim of this study was to investigate the prevalence of cagA in dyspeptic patients, as well as the association of the oncogene with the severity of different esogastroduodenal lesions. In addition, the present study evaluated the phylogenetic relationship of cagA-positive H. pylori strains isolated from patients with severe and non-severe diseases. METHODS Ethical considerations The study protocol was reviewed and approved by the Research Ethics Committee of the Federal University of Goias (CEP/UFG). The study was conducted in accordance with the Ethical Standards of the Brazilian National Committee of Ethics in Human Research, which follows the principles of the Declaration of Helsinki. The approval number is: 2.519.032 (CAAE: 83422017.7.0000.5078). Informed consent was obtained from all the participants. Study participants The study was conducted in Goiânia, State of Goiás, Central West Brazil. Both male and female participants and those aged 18 years and older who agreed to participate in the study were recruited from a referral center for gastric diseases. Participants were excluded from the study if they used antibiotics and immunosuppressants eight weeks prior to sample collection, the use of proton pump inhibitors two weeks prior to sample collection, gestation, lactation, active gastrointestinal bleeding, and a history of gastrectomy. The participants were recruited from January to December 2018. A total of 117 participants were included in the study. Samples After clinical evaluation, the participants underwent endoscopy, which was performed by a trained endoscopist. Macroscopic data included topography, localization, and type of injury. During the procedure, gastric biopsies were carried out (two in the antrum, two in the body) in accordance with the recommendations of the IV Consensus on Helicobacter pylori infection23. The samples were sent to the clinical pathology laboratory of the University hospital for histopathological analysis and to the Nucleus for the Study of Helicobacter pylori at the Federal University of Goiás (NEHP/UFG) for molecular analysis. Histopathological analysis Histopathological examination was performed at the pathology laboratory of the reference hospital. All clinical specimens were fixed in 10% formaldehyde and stained with hematoxylin-eosin and Giemsa stain24. The gastric mucosa was assessed according to the Sydney system25. Esogastroduodenal injuries and severity criteria Endoscopic and histopathological reports were used to segregate patients with severe and non-severe esophagogastroduodenal lesions. According to the recommendations of Paredes-Osses et al., 201726 and Bellolio et al., 201927, injuries categorized as severe were GA, gastric atrophy, intestinal and non-severe metaplasia, esophagitis, duodenitis, gastritis, and ulcers. DNA extraction and genotyping of H. pylori Molecular analysis was carried out at the Nucleus for the Study of Helicobacter pylori at the Federal University of Goiás (NEHP/UFG). The clinical specimens were subjected to DNA extraction using the commercial kit KitQIamp DNA Minikit® (Qiagen, Valencia, CA, USA), according to the manufacturer’s instructions. The DNA concentration was determined using NanoDrop® (ND-1000 UV-Vis). H. pylori was detected by polymerase chain reaction (PCR) using the ribosomal 16S rRNA gene as described previously by Luscenti and Gatti, 200828. Positive samples for the 16S rRNA gene were subjected to amplification of the cagA virulence gene by PCR as described by Dadashzadeh et al., 201729. The primer sequences, reaction conditions, and sizes of the amplified fragments are listed in Table 1. TABLE 1 Sequence of primers, reaction conditions and sizes of amplified fragments of the 16S rRNA and cagA genes. Gene Primer Primer sequence Amplification bp Reference Conditions 16S rRNA hpx1 CTGGAGARACTAAGYCCTCC 94°C 5’, 40 cycles 94°C 1’ 150 Lusceti and Gatti, 2008 hpx 2 GAGGAATACTCATTGCGAAGGCGA 59°C 1’ / 72°C 1’ and 72°C 7’. cagA cag1 ATGACTAACGAAACTATT 94°C 5’, 25 cycles 94°C 1’ 232 Dadashzadeh et al., 2017 cag2 CAGGATTTTTGATCGCTTTATT 53°C 1’ / 72°C 1’ and 71°C 7’. The PCR products were stained with Blue Green Loading Dye I (LGC Biotecnologia, São Paulo, Brazil) and then subjected to electrophoresis on 2% agarose gel. The product was visualized under ultraviolet light and the images were documented. Sequencing and phylogenetic analysis of the cagA gene Sequencing was performed according to the method proposed by Sanger et al., 197830, using the DYEnamicTM ET Terminator Cycle Sequencing Kit (GE Healthcare, USA) and ABI Prism 3100 (Applied Biosystems). Phylogenetic analyses were performed using the Molecular Evolutionary Genetics Analysis Software (MEGA), version 10.131. The phylogenetic tree was constructed using the maximum parsimony method with 1000 bootstraps considering the gaps generated in the alignment as a fifth base. Data analysis Statistical analyses was performed using the GraphPad Prism version 7.0, and SAS version 9.1 packages. The probability of severity, as well as its association with the cagA gene, was estimated using odds ratios (ORs). Fisher’s exact test was used to analyze the sex and severity. The relationship between age and severity was evaluated using two-way ANOVA with Tukey’s post-hoc test. Data will be presented as mean and standard deviation (mean ± standard deviation). The results were considered statistically significant in case of P<0.05, with a 95% confidence interval (CI). RESULTS DNA extracted from gastric biopsies was used for molecular screening of the bacteria by amplifying the 16S rRNA gene. Samples that amplified a 150 bp fragment were considered positive (Figure 1A). H. pylori-positive samples were used to amplify a 232 bp fragment of the cagA virulence gene (Figure 1B). FIGURE 1 Amplification products of the H. pylori 16S rRNA and cagA genes. M: molecular weight labeled (1a. 2000 bp / 1b. 1000 bp); C +: positive control; (a) lanes 1 and 2: 16S rRNA gene amplification product (150 bp amplicon); (b) lanes 1 and 2: cagA gene amplification product (232 bp amplicon). H. pylori was detected in 65.9% (77/117) of samples from gastric specimens. Among H. pylori-positive samples, 80.5% (62/77) were cagA-positive and 19.5% (15/77) were cagA-negative. H. pylori-positive patients were segregated into two groups based on the type of lesion (non-severe and severe). A total of 90 clinical outcomes were detected, 78 of which were non-severe and 12 were severe. Since the same patient could have more than one esogastroduodenal lesion, the number of clinical outcomes was higher than the number of patients in the study. The most prevalent non-severe esogastroduodenal lesion was gastritis 54/77 (70.12%), followed by esophagitis 12/77 (15.58%) and duodenitis 12/77 (15.58%). In contrast, the most prevalent severe lesions were atrophy 7/77 (9.09%), followed by metaplasia 3/77 (3.86%) and GA 2/77 (2.59%). Gastric biopsy samples from cagA-positive H. pylori patients with severe and non-severe lesions were used for photomicrography, as shown in Figure 2. Photomicrographs 2a and 2b show severe lesions in the gastric tissues of patients with atrophy and GA, respectively. FIGURES 2c and 2d show gastritis and duodenitis, respectively, considered non-severe lesions. FIGURE 2 Photomicrograph of gastric tissue lesions in patients infected with positive H. pylori cagA strains. (a) Atrophy in the gastric mucosa (*) and multifocal inflammatory infiltrate in the submucosa (arrow). 10x. Giemsa. (b) GA - it is possible to observe proliferation of tubular structures containing cells with atypical cells and evidence of malignancy (arrowhead). 10x. Giemsa. (c) Gastritis, discrete inflammatory aggregates (arrowhead), and the presence of H. pylori (arrow) are observed. 10x. Giemsa (d) Duodenitis - it is possible to observe multifocal inflammatory infiltrate (arrow). 10x. Giemsa. The analysis of the association between the 90 clinical outcomes found 78 non-severe cases and 12 severe cases. In addition, it found the presence of cagA was performed to assess the role of this gene in the severity of esogastroduodenal diseases. The results showed that there was no statistically significant association between cagA and lesion severity (OR=0.90, CI: 0.2200-3.6821, P=0.8835) (Table 2). TABLE 2 Relationship between the presence of cagA and the severity of esogastroduodenal injuries. Non-severe Severe OR CI 95% P diseases diseases (n=78) (n=12) cagA+ (n=62) 60 (76.92%) 9 (75.00%) 0.90 0.2200-3.6821 0.8835 cagA- (n=15) 18 (23.08%) 3 (25.00%) OR: odds ratio, was used for statistical analysis. Clinical outcomes were also analyzed individually to assess whether the cagA gene was specifically associated with the severity of esogastroduodenal lesions. The odds ratios, confidence intervals, and P-values, are listed in Table 3. Additionally, we evaluated whether the cagA gene acted as a risk or protection factor in the development of specific gastropathy. Statistical analyses did not show an association between cagA and the various isolated clinical outcomes (Table 3). TABLE 3 Relationship between clinical outcomes* and the H. pylori cagA virulence gene. Non-severe diseases cagA Disease OR CI 95% P Gastritis No (n=23) Yes (n=54) cagA+ 20 (86.96%) 42 (77.78%) 0.5250 0.1331-2.0716 0.3575 cagA- 3 (13.04%) 12 (22.22%) Esophagitis No (n=65) Yes (n=12) cagA+ 53 (81.54%) 9 (75.00%) 0.6792 0.1595-2.8932 0.6009 cagA- 12 (18.46%) 3 (25.00%) Duodenitis No (n=65) Yes (n=12) cagA+ 53 (81.54%) 9 (75.00%) 0.6792 0.1595-2.8932 0.6009 cagA- 12 (18.46%) 3 (25.00%) Severe diseases cagA Disease OR CI 95% P Atrophy No (n=70) Yes (n=7) cagA+ 57 (81.43%) 5 (71.43%) 0.5702 0.0994-3.2713 0.5285 cagA- 13 (18.57%) 2 (28.7%) Metaplasia No (n=74) Yes (n=3) cagA+ 60 (81.08%) 2 (66.67%) 0.4667 0.0395-5.5171 0.5453 cagA- 14 (18.92%) 1 (33.33%) Gastric adenocarcinoma No (n=75) Yes (n=2) cagA+ 60 (80.00%) 2 (100.00%) 1.281 0.0584-28.0755 0.8751 cagA- 15 (20.00%) 0 (0.00%) OR: odds ratio, was used for statistical analysis. *Clinical outcomes were detected by endoscopic and histopathological reports. The relationship between severity and sex showed that in severe esogastroduodenal lesions, 18.8% of female patients were infected with cagA-negative H. pylori strains and 10.6% were infected with cagA-positive H. pylori strains (18.18±11.62 vs 10.63±4.49). In male patients with severe diseases, 25% were infected with cagA-negative H. pylori strains and 20% were infected with cagA-positive H. pylori strains (25.0±21.65 vs 20.0±10.32). No statistically significant differences were observed between the groups (Figure 3). FIGURE 3 Role of the cagA gene in the severity of disease outcome according to sex. Black bars, male; white bars, female. Test used: Fisher’s exact test. The age of the evaluated patients ranged between 18 and 71 years; the average age was 44.4 years. The analysis of the age groups of patients with non-severe esogastroduodenal injuries with cagA-positive and cagA-negative gastric specimens showed that there was no statistically significant association in the non-severe injury group (mean ± SD; 14.28±13.43). In patients with severe injuries, no statistically significant association was found between the oncogene and the age group (mean ± SD; 15.08±18.53) (Figure 4). FIGURE 4 Evaluation of possible association between the cagA oncogene and the severity of esogastroduodenal lesions according to the age group of the patients. Circles filled in black: severe disease; circles filled in gray: non-severe disease. The two-way ANOVA test with Tukey’s post-hoc test was used for statistical analysis. The phylogenetic tree was constructed from the alignment of 16 cagA sequences from local strains in the present study; 20 reference sequences obtained from the NCBI GenBank (http://www.ncbi.nlm.nih.gov/Genbank/). The sequences used in the construction of the phylogenetic tree were obtained from H. pylori strains isolated from patients with severe and non-severe esogastroduodenal lesions. Phylogenetic analysis showed that local strains were similar. In addition, it was observed that sequences obtained from patients five and six showed a strong genetic association between them and most of the reference sequences. H. pylori strains from patients with severe and non-severe pathologies were scattered in the phylogenetic tree. Moreover, our study did not detect any difference in the phylogenetic distribution between severe and non-severe diseases (Figure 5). FIGURE 5 Phylogenetic tree constructed with sequences of the H. pylori cagA gene. Triangles filled in white represent non-severe strains; black triangles represent severe strains. Neighbor joining was built on MEGA 5.0, using maximum parsimony and 1000 repetition bootstraps, based on the 16 local cagA sequences and another 10 reference sequences obtained from the GenBank database. DISCUSSION H. pylori is an oncobacterium widely recognized globally and it is estimated that approximately half of the world’s population is infected by it2. Different genotypes of H. pylori produce different virulence factors. Our study focused on the characterization of the H. pylori cagA virulence gene from gastric biopsy samples which were obtained from patients with diseases of the upper gastrointestinal tract and its relationship with clinical status. The presence of the cagA oncogene is extremely important for the establishment of severe and non-severe esogastroduodenal lesions. In the present study, the cagA gene was detected in 80.5% (62/77) of the patients infected with H. pylori. This infection rate is considered high compared to other regions of the world. Our results are similar to those of studies conducted in Iran, Greece, and Bulgaria which showed detection rates of 70.0%, 73.0%, and 83.0% respectively32. On the other hand, some countries showed lower rates of cagA detection. These included Chile (15.2%) and Malaysia (43.0%)24,33. The different rate of detection of the cagA gene can possibly be attributed to the genetic polymorphism, characteristics of different H. pylori strains, as well as the different rates of prevalence of infection in these countries34. Several severe and non-severe clinical outcomes were associated with the presence of cagA-positive H. pylori strains. The association between severity and the oncogene may be due to factors such as the genetic profile of the strains circulating in the region, the sample size of the study, and variations in socioeconomic conditions24,35. In the present study, a comparison was made between the different clinical outcomes (severe and non-severe) in patients infected with H. pylori cagA-positive strains. There was no statistical difference between the presence of the gene and the severity of esogastroduodenal lesions in the study population. Similar results were found in Chile where research showed that there was no association between the gene and the severity of esogastroduodenal lesions24. In contrast, studies conducted in the Brazilian population by Ramis et al., 201036 demonstrated a relationship between cagA and severe diseases. In the present study, the most prevalent severe and non-severe injuries were atrophy and gastritis, respectively. Similar results were found in a study by Cavalcante et al. 201237 where gastritis was the most prevalent non-severe injury. In contrast, in the study by Oliveira et al. 200338 - carried out in South-West Brazil - showed that one of the most prevalent severe injury was gastric cancer. The individual evaluation of several clinical outcomes associated with the cagA gene did not demonstrate statistical significance. To assess the association of the cagA gene with the severity of gastric diseases in different countries, a bibliographic survey of global gastric cancer incidence rates was carried out in both sexes and all ages which was standardized by age estimated in 2018 (age-standardised incidence rates, ASIR). The levels of gastric cancer risk were segregated according to the geographical location, in low, medium, and high categories, as per the International Agency for Research on Cancer (IARC) recommendations39. As shown in Table 4, we observed that in several regions (with a high incidence of gastric cancer), the cagA gene was not associated with severity corroborating our data. TABLE 4 Association of the cagA gene with the risk of severe diseases in areas of low, moderate, or high risk of gastric cancer. Continents Countries ASIR in both sexes (2018) cagA severity-related References Africa South Africa 4.0 No Tanih NF, et al. 2010 Egypt 2.8 No El-Khlousy M, et al. 2016 Gambia 1.4 Yes Secka O, et al. 2011 Ghana 5.7 Yes Archampong TN, et al. 2017 Morocco 4.7 No Boukhris AS, et al. 2012 Senegal 6.8 Yes Breurec S, et al. 2012 Asia Iran 15.8 Yes Bakhti SZ, et al. 2020 Bangladesh 5.2 No Aftab H, et al. 2017 China 20.7 No Pinto-Ribeiro I, et al. 2016 South Korea 39.6 Yes Boonyanugomol W, et al. 2020 India 4.5 No Jeyamani L, et al. 2018 Japan 27.5 Yes Matsunari O, et al. 2011 Malaysia 5.2 No Osman HA, et al. 2015 Thailand 3.6 Yes Boonyanugomol W, et al. 2020 Latin America Brazil 7.9 Yes Cavalcante MQF, et al. 2012 Brazil 7.9 Yes Vinagre RMDF, et al. 2013 Brazil 7.9 No Gatti LL, et al. 2005 Chile 17.8 No Paredes-Osses E, et al. 2017 Colombia 12.8 Yes Watada M, et al. 2011 Costa Rica 13.4 Yes Molina-Castro S, et al. 2019 Cuba 5.7 No Feliciano O, et al. 2015 North America United States 4.1 No Homan M, et al. 2014 United States 4.1 No Niknam R, et al. 2014 Dominican Republic 6.6 No Shiota S, et al. 2014 Europe Spain 6.6 Yes González CA, et al. 2011 Estonia 11.4 No Andreson H, et al. 2002 Italy 7.2 Yes Chiarini A, et al. 2009 Poland 8.3 No Biernat MM, et al. 2014 Portugal 11.0 Yes Almeida N, et al. 2014 Russia 13.3 No Momynaliev K, et al. 2003 Age-standardised incidence rates were obtained from GLOBOCAN 2018 (http://gco.iarc.fr/today). The photomicrographs from the present study showed histopathological patterns of severe (atrophy and GA) and non-severe (gastritis and duodenitis) lesions. The mechanisms involved in the genesis of esogastroduodenal diseases associated with H. pylori infection have not yet been fully elucidated. However, it is well understood that the presence of the bacterium in the gastric mucosa can cause changes in gastric homeostasis38. In addition, from phosphorylative and non-phosphorylative pathways, the CagA oncoprotein can induce exacerbated inflammation and GA induction40. The prevalence of infection in patients with cagA-positive H. pylori strains may vary according to the sex of the individual. Studies have shown that these variations may be due to differences in lifestyle between men and women4. In the present study, the relationship between the sex of patients and the severity of esogastroduodenal diseases was evaluated. No statistical significance was observed in patients of both sexes. The proportion of female patients in the present study was almost three times higher than that of males. This can be explained by the greater demand for women by basic health services facilitating early detection and effective treatment41-44. Through phylogenetic evaluation, it was not possible to segregate the cagA sequences isolated from patients with severe and non-severe esogastroduodenal diseases. In part, this can be explained by partial sequencing of the virulence gene, which was used in the analysis. The similarity between the sequences of patients five and six suggests that at some point, these patients may have been infected by the same strain from a different region. In addition, it is possible that they may have resided in the same house or city so that the same strain infected both of them through different routes of transmission. It is also possible that, in addition to biogeographic similarities, both share the same non-severe clinical outcomes. The different mechanisms underlying the pathogenesis of these strains can be explained by the genetic variations between them. The screening of a large number of samples would provide a better understanding of the possible variations in the cagA gene. Hence, a more comprehensive phylogeographic analysis is needed to elucidate the impact of genetic heterogeneity of H. pylori on dyspeptic patients in Brazil. Although this study involved a small sample number and partial gene sequences, this is the first Brazilian study that used partial cagA sequences from H. pylori to build a phylogenetic tree. The present study has high scientific relevance, since information about the mechanisms involved in the parasite-host relationship is scarce in the researched population. Some limitations were observed in the study, such as the low sample size of patients with severe esogastroduodenal lesions and the partial sequencing of the cagA gene. Despite the limitations, the study opens perspectives for the development of personalized medicine in the Brazilian territory. CONCLUSION H. pylori infection is highly prevalent in patients with dyspepsia in central Brazil. The cagA oncogene was not considered to be a molecular marker of the severity of esogastroduodenal lesions. Through phylogenetic analyses, it was not possible to segregate strains from patients with severe and non-severe diseases. This study provides additional insight into the cagA profiles of the different strains of H. pylori and opens perspectives for studies with a larger sample size of esogastroduodenal disease patients as well as research that aims to assess the association between genetic variability and clinicopathological outcomes. ACKNOWLEDGMENTS We would like to thank the Genetics and Biodiversity Laboratory at the Federal University of Goiás. We also like to thank Editage for English language editing. REFERENCES 1 1. Warren JR, Marshall B. Unidentified Curved Bacilli on Gastric Epithelium in Active Chronic Gastritis. Lancet. 1983;321:1273-5. Warren JR Marshall B Unidentified Curved Bacilli on Gastric Epithelium in Active Chronic Gastritis Lancet 1983 321 1273 1275 2 2. Zamani M, Ebrahimtabar F, Zamani V, Miller WH, Alizadeh-Navaei R, Shokri-Shirvani J, et al. Systematic review with meta-analysis: the worldwide prevalence of Helicobacter pylori infection. Aliment Pharmacol Ther. 2018;47:868-76. Zamani M Ebrahimtabar F Zamani V Miller WH Alizadeh-Navaei R Shokri-Shirvani J Systematic review with meta-analysis: the worldwide prevalence of Helicobacter pylori infection Aliment Pharmacol Ther 2018 47 868 876 3 3. Zamani M, Vahedi A, Maghdouri Z, Shokri-Shirvani J. Role of food in environmental transmission of Helicobacter pylori. Casp J Intern Med. 2017;8:146-52. Zamani M Vahedi A Maghdouri Z Shokri-Shirvani J Role of food in environmental transmission of Helicobacter pylori Casp J Intern Med 2017 8 146 152 4 4. Basílio ILD, Catão MDFC, Carvalho JDDS, Freire-Neto FP, Ferreira LC, Jerô­nimo SMB. Risk factors of Helicobacter pylori infection in an urban community in Northeast Brazil and the relationship between the infection and gastric diseases. Rev Soc Bras Med Trop. 2018;51:183-9. Basílio ILD Catão MDFC Carvalho JDDS Freire-Neto FP Ferreira LC Jerô­nimo SMB Risk factors of Helicobacter pylori infection in an urban community in Northeast Brazil and the relationship between the infection and gastric diseases Rev Soc Bras Med Trop 2018 51 183 189 5 5. Hooi JKY, Lai WY, Ng WK, Suen MMY, Underwood FE, Tanyingoh D, et al. Global Prevalence of Helicobacter pylori Infection: Systematic Review and Meta-Analysis. Gastroenterology. 2017;153:420-9. Hooi JKY Lai WY Ng WK Suen MMY Underwood FE Tanyingoh D Global Prevalence of Helicobacter pylori Infection: Systematic Review and Meta-Analysis Gastroenterology 2017 153 420 429 6 6. Kamboj AK, Cotter TG, Oxentenko, Amy S. Oxentenko M. Helicobacter pylori: The Past, Present, and Future in Management. Mayo Clin Proc. 2017;92:599-604. Kamboj AK Cotter TG Oxentenko Amy S. Oxentenko M Helicobacter pylori: The Past, Present, and Future in Management Mayo Clin Proc 2017 92 599 604 7 7. Cortes MCC, Yamakawa A, Casingal CR, Fajardo LSN, Juan MLG, De Guzman BB, et al. Diversity of the cagA gene of Helicobacter pylori strains from patients with gastroduodenal diseases in the Philippines. FEMS Immunol Med Microbiol. 2010;60:90-7. Cortes MCC Yamakawa A Casingal CR Fajardo LSN Juan MLG De Guzman BB Diversity of the cagA gene of Helicobacter pylori strains from patients with gastroduodenal diseases in the Philippines FEMS Immunol Med Microbiol 2010 60 90 97 8 8. Junior LR, Miler C, Geocze S, Chehter L. Helicobacter pylori eradication does not influence gastroesophageal reflux disease: a prospective, parallel, randomized, open-label, controlled trial. Arq Gastroenterol. 2012;49:56-63. LR Junior Miler C Geocze S Chehter L Helicobacter pylori eradication does not influence gastroesophageal reflux disease: a prospective, parallel, randomized, open-label, controlled trial Arq Gastroenterol 2012 49 56 63 9 9. Scida S, Russo M, Miraglia C, Leandro G, Franzoni L, Meschi T, et al. Relationship between Helicobacter pylori infection and GERD. Acta Biomed. 2018;89:40-3. Scida S Russo M Miraglia C Leandro G Franzoni L Meschi T Relationship between Helicobacter pylori infection and GERD Acta Biomed 2018 89 40 43 10 10. Liu L, Gao H, Wang H, Zhu K, Yu W, Zhang Y, et al. Comparison of esophageal function tests to investigate the effect of Helicobacter pylori infection on gastroesophageal reflux disease (GERD). Med Sci Monit. 2018;24:4791-7. Liu L Gao H Wang H Zhu K Yu W Zhang Y Comparison of esophageal function tests to investigate the effect of Helicobacter pylori infection on gastroesophageal reflux disease (GERD) Med Sci Monit 2018 24 4791 4797 11 11. Araújo-Filho I, Brandão-neto J, Araújo L, Pinheiro M, Medeiros AC. Prevalence of Helicobacter pylori infection in advanced carcinoma. Arq Gastroenterol . 2006;43:288-92. Araújo-Filho I Brandão-neto J Araújo L Pinheiro M Medeiros AC Prevalence of Helicobacter pylori infection in advanced carcinoma Arq Gastroenterol 2006 43 288 292 12 12. Zhang RG, Duan GC, Fan QT, Chen SY. Role of Helicobacter pylori infection in pathogenesis of gastric carcinoma. World J Gastrointest Pathophysiol. 2016;7:97. Zhang RG Duan GC Fan QT Chen SY Role of Helicobacter pylori infection in pathogenesis of gastric carcinoma World J Gastrointest Pathophysiol. 2016 7 97 97 13 13. Tomb JF, White O, Kerlavage AR, Clayton RA, Sutton GG, Fleischmann RD, et al. The complete genome sequence of the gastric pathogen Helicobacter pylori. Nature. 1997;388:539-47. Tomb JF White O Kerlavage AR Clayton RA Sutton GG Fleischmann RD The complete genome sequence of the gastric pathogen Helicobacter pylori Nature 1997 388 539 547 14 14. Pandya HB, Agravat HH, Patel JS. Prevalence of specific Helicobacter pylori CagA, VacA, IceA, UreC genotypes and its clinical relevance in the patients with acid-peptic diseases. J Clin Diagnostic Res. 2017;11:23-6. Pandya HB Agravat HH Patel JS Prevalence of specific Helicobacter pylori CagA, VacA, IceA, UreC genotypes and its clinical relevance in the patients with acid-peptic diseases J Clin Diagnostic Res 2017 11 23 26 15 15. Hatakeyama M. Oncogenic mechanisms of the Helicobacter pylori CagA protein . Nat Rev Cancer. 2004;4:688-94. Hatakeyama M Oncogenic mechanisms of the Helicobacter pylori CagA protein Nat Rev Cancer 2004 4 688 694 16 16. Braga LLBC, Oliveira MAA, Gonçalves MHRB, Chaves FK, Benigno TGS, Gomes AD, et al. CagA phosphorylation EPIYA-C motifs and the vacA i genotype in Helicobacter pylori strains of asymptomatic children from a high-risk gastric cancer area in northeastern Brazil. Mem Inst Oswaldo Cruz. 2014;109:1045-9. Braga LLBC Oliveira MAA Gonçalves MHRB Chaves FK Benigno TGS Gomes AD CagA phosphorylation EPIYA-C motifs and the vacA i genotype in Helicobacter pylori strains of asymptomatic children from a high-risk gastric cancer area in northeastern Brazil Mem Inst Oswaldo Cruz 2014 109 1045 1049 17 17. Tegtmeyer N, Wessler S, Necchi V, Rohde M, Harrer A, Rau TT, et al. Helicobacter pylori employs a unique basolateral type IV secretion mechanism for CagA delivery. Cell Host Microbe. 2017;22:552-60. Tegtmeyer N Wessler S Necchi V Rohde M Harrer A Rau TT Helicobacter pylori employs a unique basolateral type IV secretion mechanism for CagA delivery Cell Host Microbe 2017 22 552 560 18 18. Nishizawa T, Suzuki H. Gastric carcinogenesis and underlying molecular mechanisms: Helicobacter pylori and novel targeted therapy. Biomed Res Int. 2014;2015. Nishizawa T Suzuki H Gastric carcinogenesis and underlying molecular mechanisms: Helicobacter pylori and novel targeted therapy Biomed Res Int 2014 2015 19 19. Miftahussurur M, Yamaoka Y. Helicobacter pylori virulence genes and host genetic polymorphisms as risk factors for peptic ulcer disease. Expert Rev Gastroenterol Hepatol. 2015;9:1535-47. Miftahussurur M Yamaoka Y Helicobacter pylori virulence genes and host genetic polymorphisms as risk factors for peptic ulcer disease Expert Rev Gastroenterol Hepatol 2015 9 1535 1547 20 20. Lind J, Backert S, Pfleiderer K, Berg DE, Yamaoka Y, Sticht H, et al. Systematic analysis of phosphotyrosine antibodies recognizing single phosphorylated EPIYA-motifs in CagA of western-type Helicobacter pylori strains. PLoS One. 2014;9:14-8. Lind J Backert S Pfleiderer K Berg DE Yamaoka Y Sticht H Systematic analysis of phosphotyrosine antibodies recognizing single phosphorylated EPIYA-motifs in CagA of western-type Helicobacter pylori strains PLoS One 2014 9 14 18 21 21. Rugge M. Gastric cancer risk in patients with Helicobacter pylori infection and following its eradication. Gastroenterol Clin North Am. 2015;44:609-24. Rugge M Gastric cancer risk in patients with Helicobacter pylori infection and following its eradication Gastroenterol Clin North Am 2015 44 609 624 22 22. Matos JI, Sousa HAC, Marcos-Pinto R, Dinis-Ribeiro M. Helicobacter pylori CagA and VacA genotypes and gastric phenotype: A meta-analysis. Eur J Gastroenterol Hepatol. 2013;25:1431-41. Matos JI Sousa HAC Marcos-Pinto R Dinis-Ribeiro M Helicobacter pylori CagA and VacA genotypes and gastric phenotype: A meta-analysis Eur J Gastroenterol Hepatol 2013 25 1431 1441 23 23. Coelho LGV, Marinho JR, Genta R, Ribeiro LT, Passos M do CF, Zaterka S, et al. IVth Brazilian consensus conference on Helicobacter pylori infection. Arq Gastroenterol . 2018;55:97-121. Coelho LGV Marinho JR Genta R Ribeiro LT Passos M do CF Zaterka S IVth Brazilian consensus conference on Helicobacter pylori infection Arq Gastroenterol 2018 55 97 121 24 24. Giemsa G. A simplification and perfection of my methylene azure-methylene blue-eosin staining method for the political purpose of Romanowsky-Nochteschen chromatin staining. Zentralbl Bakteriol. 1904;308-11. Giemsa G A simplification and perfection of my methylene azure-methylene blue-eosin staining method for the political purpose of Romanowsky-Nochteschen chromatin staining Zentralbl Bakteriol 1904 308 311 25 25. Stolte M, Meining A. The Updated Sydney System: Classification and grading of gastritis as the basis of diagnosis and treatment. Can J Gastroenterol. 2001;15:591-8. Stolte M Meining A The Updated Sydney System: Classification and grading of gastritis as the basis of diagnosis and treatment Can J Gastroenterol 2001 15 591 598 26 26. Paredes-Osses E, Sáez K, Sanhueza E, Hebel S, González C, Briceño C, et al. Association between cagA, vacAi, and dupA genes of Helicobacter pylori and gastroduodenal pathologies in Chilean patients. Folia Microbiol (Praha). 2017;62:437-44. Paredes-Osses E Sáez K Sanhueza E Hebel S González C Briceño C Association between cagA, vacAi, and dupA genes of Helicobacter pylori and gastroduodenal pathologies in Chilean patients Folia Microbiol Praha 2017 62 437 444 27 27. Bellolio E, Riquelme I, Riffo-Campos AL, Rueda C, Ferreccio C, Villaseca M, et al. Assessment of gastritis and gastric cancer risk in the Chilean population using the OLGA system. Pathol Oncol Res. 2019;25:1135-42. Bellolio E Riquelme I Riffo-Campos AL Rueda C Ferreccio C Villaseca M Assessment of gastritis and gastric cancer risk in the Chilean population using the OLGA system Pathol Oncol Res 2019 25 1135 1142 28 28. Luscenti RS, Gatti LL. Molecular diagnosis of Helicobacter pylori infection in the gastric mucosal. Rev Para Med. 2008;22:21-6. Luscenti RS Gatti LL Molecular diagnosis of Helicobacter pylori infection in the gastric mucosal Rev Para Med 2008 22 21 26 29 29. Dadashzadeh K, Peppelenbosch MP, Adamu AI. Helicobacter pylori pathogenicity factors related to gastric cancer. Can J Gastroenterol Hepatol . 2017;2017:1-6. Dadashzadeh K Peppelenbosch MP Adamu AI Helicobacter pylori pathogenicity factors related to gastric cancer Can J Gastroenterol Hepatol 2017 2017 1 6 30 30. Sanger F, Coulson AR, Friedmann T, Air GM, Barrell BG, Brown NL, et al. The nucleotide sequence of bacteriophage φX174. J Mol Biol. 1978;125:225-46. Sanger F Coulson AR Friedmann T Air GM Barrell BG Brown NL The nucleotide sequence of bacteriophage φX174 J Mol Biol 1978 125 225 246 31 31. Kumar S, Stecher G, Li M, Knyaz C, Tamura K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol Biol Evol. 2018;35:1547-9. Kumar S Stecher G Li M Knyaz C Tamura K MEGA X: Molecular evolutionary genetics analysis across computing platforms Mol Biol Evol 2018 35 1547 1549 32 32. Eusebi LH, Zagari RM, Bazzoli F. Epidemiology of Helicobacter pylori infection. Helicobacter. 2014;19(S1):1-5. Eusebi LH Zagari RM Bazzoli F Epidemiology of Helicobacter pylori infection Helicobacter 2014 19 S1 1 5 33 33. Leja M, Grinberga-Derica I, Bilgilier C, Steininger C. Epidemiology of Helicobacter pylori infection. Helicobacter. 2019;24(S1):2-6. Leja M Grinberga-Derica I Bilgilier C Steininger C Epidemiology of Helicobacter pylori infection Helicobacter 2019 24 S1 2 6 34 34. Román-Román A, Martínez-Santos VI, Castañón-Sánchez CA, Albañil-Muñoz AJ, González-Mendoza P, Soto-Flores DG, et al. CagL polymorphisms D58/K59 are predominant in Helicobacter pylori strains isolated from mexican patients with chronic gastritis. Gut Pathog. 2019;11:1-11. Román-Román A Martínez-Santos VI Castañón-Sánchez CA Albañil-Muñoz AJ González-Mendoza P Soto-Flores DG CagL polymorphisms D58/K59 are predominant in Helicobacter pylori strains isolated from mexican patients with chronic gastritis Gut Pathog 2019 11 1 11 35 35. Abu-Taleb AMF, Abdelattef RS, Abdel-Hady AA, Omran FH, El-Korashi LA, Abdel-Aziz El-Hady H, et al. Prevalence of Helicobacter pylori cagA and iceA genes and their association with gastrointestinal diseases. Int J Microbiol. 2018;2018. Abu-Taleb AMF Abdelattef RS Abdel-Hady AA Omran FH El-Korashi LA Abdel-Aziz El-Hady H Prevalence of Helicobacter pylori cagA and iceA genes and their association with gastrointestinal diseases Int J Microbiol 2018 2018 36 36. Ramis IB, Fonseca TL, de Moraes EP, Fernandes MS, Mendoza-Sassi R, Rodrigues O, et al. Molecular Basis of pathogenicity in Helicobacter pylori clinical isolates. J Clin Microbiol. 2010;48:3776-8. Ramis IB Fonseca TL de Moraes EP Fernandes MS Mendoza-Sassi R Rodrigues O Molecular Basis of pathogenicity in Helicobacter pylori clinical isolates J Clin Microbiol 2010 48 3776 3778 37 37. Cavalcante MQ, Silva CI, Braga-Neto MB, Fialho AB, Nunes Fialho A, Barbosa AM, et al. Helicobacter pylori vacA and cagA genotypes in patients from northeastern Brazil with upper gastrointestinal diseases. Mem Inst Oswaldo Cruz . 2012;107:561-3. Cavalcante MQ Silva CI Braga-Neto MB Fialho AB Nunes Fialho A Barbosa AM Helicobacter pylori vacA and cagA genotypes in patients from northeastern Brazil with upper gastrointestinal diseases Mem Inst Oswaldo Cruz 2012 107 561 563 38 38. Oliveira AG, Santos A, Guerra JB, Rocha GA, Rocha AM, Oliveira CA, et al. babA2- and cagA-positive Helicobacter pylori strains are associated with duodenal ulcer and gastric carcinoma in Brazil. J Clin Microbiol . 2003;41:3964-6. Oliveira AG Santos A Guerra JB Rocha GA Rocha AM Oliveira CA babA2- and cagA-positive Helicobacter pylori strains are associated with duodenal ulcer and gastric carcinoma in Brazil J Clin Microbiol 2003 41 3964 3966 39 39. Estimated age-standardized incidence rates (World) in 2018, all cancers, both sexes, all ages [Internet]. Lyon, France: International Agency for Research on Cancer; 2018 [cited 2020 Mar 1]. Available from: Available from: http://gco.iarc.fr/today . Estimated age-standardized incidence rates (World) in 2018, all cancers, both sexes, all ages Lyon, France International Agency for Research on Cancer 2018 2020 Mar 1 Available from: http://gco.iarc.fr/today 40 40. Gomes LI, Rocha GA, Rocha AMC, Soares TF, Oliveira CA, Bittencourt PFS, et al. Lack of association between Helicobacter pylori infection with dupA-positive strains and gastroduodenal diseases in Brazilian patients. Int J Med Microbiol. 2008;298:223-30. Gomes LI Rocha GA Rocha AMC Soares TF Oliveira CA Bittencourt PFS Lack of association between Helicobacter pylori infection with dupA-positive strains and gastroduodenal diseases in Brazilian patients Int J Med Microbiol 2008 298 223 230 41 41. Backert S, Tegtmeyer N. Type iv secretion and signal transduction of Helicobacter pylori cagA through interactions with host cell receptors. Toxins (Basel). 2017;9:115. Backert S Tegtmeyer N Type iv secretion and signal transduction of Helicobacter pylori cagA through interactions with host cell receptors Toxins Basel 2017 9 115 115 42 42. Ferro A, Morais S, Pelucchi C, Dierssen-Sotos T, Martín V, López-Carrillo L, et al. Sex differences in the prevalence of Helicobacter pylori infection: An individual participant data pooled analysis (StoP Project). Eur J Gastroenterol Hepatol . 2019;31:593-8. Ferro A Morais S Pelucchi C Dierssen-Sotos T Martín V López-Carrillo L Sex differences in the prevalence of Helicobacter pylori infection: An individual participant data pooled analysis (StoP Project) Eur J Gastroenterol Hepatol 2019 31 593 598 43 43. Levorato CD, de Mello LM, da Silva AS, Nunes AA. Factors associated with the demand for health services from a gender-relational perspective. Cienc e Saude Coletiva. 2014;19:1263-74. Levorato CD de Mello LM da Silva AS Nunes AA Factors associated with the demand for health services from a gender-relational perspective Cienc e Saude Coletiva 2014 19 1263 1274 44 44. Ibrahim A, Morais S, Ferro A, Lunet N, Peleteiro B. Sex-differences in the prevalence of Helicobacter pylori infection in pediatric and adult populations: Systematic review and meta-analysis of 244 studies. Dig Liver Dis. 2017;49:742-9. Ibrahim A Morais S Ferro A Lunet N Peleteiro B Sex-differences in the prevalence of Helicobacter pylori infection in pediatric and adult populations: Systematic review and meta-analysis of 244 studies Dig Liver Dis 2017 49 742 749 Disclosure of funding: no funding received
location_on
Instituto Brasileiro de Estudos e Pesquisas de Gastroenterologia e Outras Especialidades - IBEPEGE. Rua Dr. Seng, 320, 01331-020 São Paulo - SP Brasil, Tel./Fax: +55 11 3147-6227 - São Paulo - SP - Brazil
E-mail: secretariaarqgastr@hospitaligesp.com.br
rss_feed Acompanhe os números deste periódico no seu leitor de RSS
Acessibilidade / Reportar erro