Epithelial responses and Candida albicans pathogenicity are enhanced in the presence of oral streptococci

Abstract

Experimental models that consider host-pathogen interactions are relevant for improving knowledge about oral candidiasis. The aim of this study was to assess the epithelial immune responses, Candida penetration of cell monolayers, and virulence during mixed species culture infections. Single species cultures of Candida albicans and mixed cultures (C. albicans, Streptococcus mutans, and Streptococcus sanguinis) were used to infect monolayers of HaCaT and FaDu ATCC HTB-43 cells for 12 h. After infection, IL-18 and IL-34 gene expression was measured to assess epithelial cell immune responses, and lactate dehydrogenase (LDH) activity was measured as an indicator of cell damage. Microscopy determined C. albicans morphology and penetration of fungal cells through the keratinocyte monolayer. Monolayers devoid of infection served as controls. Data were analyzed by an ANOVA one-way test followed by Tukey’s post-hoc test (α = 0.05). The results found that IL-18 and IL-34 gene expression and LDH activity were significantly (p < 0.05) upregulated for both cell lines exposed to mixed species cultures compared with C. albicans alone. Candida albicans yeast and hyphae were evident in C. albicans only infections. In contrast, monolayers infected by C. albicans, S. mutans, and S. sanguinis exhibited higher microbial invasion with several hyphal aggregates detected. The presence of streptococci in C. albicans infection enhances the virulence and pathogenicity of the fungus with associated increased immune responses and tissue damage. Extrapolation of these findings to oral infection would indicate the added potential benefit of managing bacterial components of biofilms during treatment.

Key Words: Biofilms; Interleukins; Pathogenicity; Candida albicans; Streptococcus

Resumo

O objetivo deste estudo foi avaliar a resposta epithelial imune, a colonização da Candida albicans em monocamadas celulares e sua virulência em resposta a infecções de culturas de biofilme multiespécie. Culturas de biofilme monoespécie de C. albicans e culturas mistas (C. albicans, Streptococcus mutans e Streptococcus sanguinis) foram utilizadas para infectar monocamadas de células HaCaT e FaDu por 12 h. Após a infecção, a expressão dos genes IL-18 e IL-34 foi medida para avaliar as respostas imunes das células epiteliais. A atividade da lactato desidrogenase (LDH) foi medida como um indicador de dano celular. A microscopia determinou a morfologia de C. albicans e a penetração das células fúngicas através da monocamada de queratinócitos. Monocamadas em que não houve infecção serviram como controles. Os dados foram analisados por um teste ANOVA one-way seguido pelo teste post-hoc de Tukey (α = 0,05). Os resultados demonstraram que a expressão gênica de IL-18 e IL-34 e a atividade de LDH foram (p < 0,05) reguladas positivamente para ambas as linhagens de células expostas a culturas de espécies mistas em comparação com C. albicans isoladamente. Leveduras de C.albicans e hifas foram evidentes em infecções apenas por C. albicans. Entretanto, monocamadas infectadas por C. albicans, S. mutans e S. sanguinis exibiram maior invasão microbiana com vários agregados de hifas detectados. Dessa maneira, a presença de estreptococos na infecção por C. albicans aumentou a virulência e a patogenicidade do fungo com respostas imunes aumentadas associadas a danos nos tecidos. A extrapolação desses achados para a infecção oral indicaria o potencial benéfico do controle dos componentes bacterianos em biofilmes durante a terapia da candidíase

Introduction

Candida albicans is a commensal fungus that colonizes the mucosa and prosthetic devices in the oral cavity ¹. Usually, C. albicans is a normal component of the microbial microbiome where it predominates in its yeast morphology, which has a lower potential for harmful effects on the host. However, often in cases of poor oral hygiene, or where there is host debilitation, C. albicans can form robust and complex biofilms ². In such conditions, C. albicans exhibits higher yeast-to-hyphal (filamentous form) transition, with the latter having a greater association with pathogenicity. Hyphal forms of C. albicans can physically penetrate the oral epithelium and promote oral candidiasis ^2,3,4.

During oral candidosis, C. albicans produces a range of virulence factors including phospholipases, secreted aspartyl proteinases, and toxins that can promote inflammatory responses ^5,6. In such processes, epithelial cells are essential in the activation of signaling responses and thus ensuing immune defenses against infection ⁷. The production of the cytokines interleukin-18 (IL-18) and interleukin-34 (IL-34) are key components in these responses. IL-18 induces the production of interferon-gamma (IFN- ɣ) through the activation of T cells, while IL-34 leads to the expansion of macrophage numbers and their maturation ^8,9. Interleukin responses are critical in the recruitment of other effector cells to the infection site ^10,11. Essentially, epithelial cells are the frontline defense against C. albicans infection. Although the immune responses are largely understood during C. albicans tissue invasion ¹², the role of IL-18 and IL-34 still needs further knowledge including its gene expression in the context of epithelial invasion.

Considering the complex polymicrobial biofilms and dynamic interactions in the oral environment and in oral candidosis, C. albicans is often found in association with oral bacteria ¹³. Previous investigations have shown that Candida-Streptococcus interactions increase the virulence and pathogenicity of C. albicans^{13,14,15,16,17}, contributing to the invasiveness of C. albicans. As such, along with the potentiation of hyphal invasion, consideration of host response in these interkingdom infections is warranted. Thus, an experimental model that considers both groups of microorganisms may improve our knowledge of oral candidosis and offer additional targeted therapies. This present investigation aimed to evaluate the in vitro epithelial cell immune response, damage, and fungal invasiveness of Candida-Streptococcus cultures. The study innovation includes a new point of view of polymicrobial interactions considering the epithelial invasion and response during oral candidosis.

Materials and methods

Experimental design

This in vitro study used monolayers of HaCaT or FaDu human cells to evaluate epithelial responses induced by mixed cultures comprised of C. albicans and Streptococcus species. Infection groups (n=8 for each group) were single C. albicans and mixed species of C. albicans, Streptococcus mutans, and Streptococcus sanguinis. In addition, non-infected controls of both cell lines were used. After 12 h infection, the epithelial responses measured were IL-18 and IL-34 gene expression and induced tissue damage as determined by lactate dehydrogenase (LDH) activity. In addition, C. albicans morphology and invasiveness were ascertained by light microscopy.

Microorganisms and growth conditions

Candida albicans ATCC 90028, S. mutans ATCC 25175 and S. sanguinis ATCC 10556 were used to form test cultures. Candida albicans was initially cultured on Sabouraud Dextrose Agar (SDA) (Oxoid, Basingstoke, United Kingdom), while S. mutans and S. sanguinis were grown on Blood Agar (blood agar base; Oxoid) supplemented with 5% (v/v) of defibrinated horse blood (TCS Biosciences, Buckingham, United Kingdom). Cells were then cultured aerobically in Brain Heart Infusion liquid medium (BHI; Oxoid) for 24 h at 37°C. Resulting cultures were centrifugated (3000 g for 5 min), gently washed (×2) in phosphate-buffered saline (PBS; pH 7.0), and resuspended in Modified Dulbecco Eagle Medium (DMEM; Life Technologies, Paisley, UK) supplemented with 10% (v/v) Fetal Bovine Serum (FBS; Life Technologies) and 50 mM glucose. Using a spectrophotometer (DiluPhotometer™; Implen, Westlake Village, CA, USA), cell density was adjusted to an OD₆₀₀ (1 × 10⁵ CFU/ mL of C. albicans and OD₆₀₀ 1 × 10⁷ CFU/ mL of streptococci cells) ¹⁸.

Cell culture conditions and monolayer infection

HaCaT and FaDu ATCC HTB-43 cells were used to form two different human cell monolayers. Cells were cultured in Dulbecco's Modified Eagle Medium (DMEM; Life Technologies, Paisley, UK) supplemented with 10% (v/v) Fetal Bovine Serum (FBS; Life Technologies) without antibiotics at 37°C and in 5 % CO₂ until > 85% confluence was reached. HaCaT and FaDu were seeded, separately, in 24-well plates reaching a final concentration of 2 × 10⁵ cells/well and formed a monolayer. Infection was performed using the microbial cultures previously described following the infection groups (n=8 for each group), single C. albicans, and mixed species of C. albicans, Streptococcus mutans, and Streptococcus sanguinis. The microorganisms were added to the plate at the cell density adjusted to an OD₆₀₀ (1 × 10⁵ CFU/ mL of C. albicans and OD₆₀₀ 1 × 10⁷ CFU/ mL of streptococci cells) ¹⁸. Plates were incubated for 12 h at 37º C in a humidified 5% CO₂ environment. After incubation, the supernatant and monolayer cells were collected for analysis.

Gene expression by qPCR

To determine immune epithelial response during infection, qPCR evaluated IL-18 and IL-34 gene expression. Primers were designed from full-length gene sequences obtained from the PubMed nucleotide platform using Primer3 software ¹⁹ (Table 1). GAPDH and β-actin served as reference genes (Table 1).

Cell monolayers were collected and incubated in Trizol®, for 2 min. Extraction of total RNA was performed using the RNeasy Mini Kit (QIAGEN) in accordance with the manufacturer's instructions and following previous investigations (Cavalcanti et al., 2015). Reverse transcription reactions for cDNA synthesis used 5 μl of total RNA (200 ng μl^-1) template, 1 μl of 10 mM dNTPs, 1 μl of 50 μg ml^-1 random primers, 1 μl of 25 U μl^-1 RNasin RNase inhibitor, 5 μl of M-MLV reaction buffer (×5) and 1 μl of 200 U μl^-1 M-MLV (Promega, Southampton, UK). Molecular-grade water was added to achieve a final reaction volume of 25 μl. The reaction mix was incubated at 70°C for 5 min, followed by incubation at 37°C for 60 min. The resulting cDNA was stored at -20°C before use for qPCR.

Table 1
Forward (F) and reverse (R) primers used for evaluation of C. albicans virulence gene expression by quantitative polymerase chain reaction (qPCR)

Target gene	Sequence (5' ( 3')
IL-18	F - CCTTCCAGATCGCTTCCTCTCGCAACAA
Interleukin 18	R - CAAGCTTGCCAAAGTAATCTGATTCCAGGT
GAPDH	F - ACATCATCCCTGCCTCTAC
Housekeeping Gene	R - CCACCTTCTTGATGTCATCATATTTG
ß -Actin	F - GAGCACAGAGCCTCGCCTTTGCCGAT
Housekeeping Gene	R - ATCCTTCTGACCCATGCCCACCATCACG
IL-34	F - GGACAAGCTGCAGTACAGGAGCCGACTT
Interleukin 34	R - AGCCTGGTGACGTTGGCGATTCTGAACA

The qPCR was performed in 96-well plates in an ABI Prism 7000 instrument (Life Technologies) using a 20-μl reaction volume comprised of 2 μl of cDNA, 10 μl (×2) of SYBR-Green PCR Master Mix (Precision Master Mix; Primer Design, Southampton, UK), 1 μl of each primer (10 mM), and 6 μl of molecular biology grade water. An initial denaturation at 95°C for 2 min was undertaken, followed by 40 cycles of denaturation at 95°C for 15 s, primer annealing at 58°C for 30 s and primer extension at 72°C for 30 s. A final extension at 72°C for 2 min was performed, followed by cooling at 4° C. A primer dissociation stage at 60°C was used to generate a melting curve to verify the amplified product.

According to the amplification curves of genes evaluated, the threshold was adjusted. Based on the cycle number at which both the target and reference genes reached the threshold cycle (Ct), mean values of triplicate measurements were used to calculate the target gene’s expression using the ΔCt method ²⁰.

Lactate Dehydrogenase (LDH) activity

To measure human cell damage, the LDH activity was determined using an LDH Cytotoxicity Assay kit (Thermo Fisher Scientific, Cramlington, UK), following the manufacturer's instructions. After incubation, the cell culture supernatant was collected, added to the LDH enzyme assay reagent, and the absorbance read at 490/680 nm. Control samples were used for normalization ¹⁸.

Visualization of C. albicans invasiveness by inverted light microscopy

An inverted light microscope (Olympus CK2; Olympus Optical Go Ltd, London, UK). was used to visualize the proliferation of the microorganisms through HaCaT keratinocytes monolayers. Images were obtained using ×40 objective magnification and were qualitatively analyzed.

Statistical analysis

Statistical analysis was performed using the Statistical Package for the Social Sciences (SPSS, IBM, Chicago) with a significance of 5%. The assumptions for equality of variances and normal error distribution were assessed for each variable accordingly. One-way ANOVA was used to analyze epithelial cell gene expression and LDH activity. Post-hoc comparisons were performed using Tukey’s test.

Results

Gene expression analyses showed that IL-18 and IL-34 genes were significantly (p < 0.05) upregulated for both cell lines when exposed to mixed species infections. In contrast, IL-18 gene expression was similar for uninfected cell lines and those exposed only to C. albicans (p > 0.05) (Figure 1). Gene expression of IL-34 was significantly (p < 0.05) elevated for cell lines infected with C. albicans compared with non-infected cell lines (Figure 2).

Based on LHD activity, tissue damage was significantly (p < 0.05) higher in cells infected by a mixed species inoculum compared with C. albicans only and non-infected tissue. Additionally, a statistical difference in LDH activity was found between C. albicans cell line infection and non-infected controls (p < 0.05) (Figure 3).

Representative images of keratinocyte monolayers and C. albicans morphology revealed microbial proliferation and C. albicans morphological state. In C. albicans only infections, C. albicans yeast, and some dispersed hyphae were evident. Interestingly, in monolayers infected by C. albicans, S. mutans, and S. sanguinis, higher microbial proliferation, and invasiveness were observed, with more numerous hyphal aggregates (Figure 4).

Figure 1
IL-18 gene expression (qPCR) for HaCaT and FaDu cell lines. Monolayers without infection (control); single C. albicans infection; mixed infection by C. albicans, S. mutans, and S. sanguinis (Ca + Sm + Ss). Human target genes were normalized using the ß-actin and GAPDH (housekeeping) genes. Different letters indicate a significant difference (p< 0.05).

Figure 2
IL-34 gene expression (qPCR) for HaCaT and FaDu cell lines. Monolayers without infection (control); single C. albicans infection; mixed infection by C. albicans, S. mutans, and S. sanguinis (Ca + Sm + Ss). Human target genes were normalised using the ß-actin and GAPDH (housekeeping) genes. Different letters indicate a significant difference (p< 0.05).

Figure 3
Lactate dehydrogenase (LDH) activity for HaCaT and FaDu cell lines. Monolayers without infection (control); single C. albicans infection; mixed infection by C. albicans, S. mutans, and S. sanguinis (Ca + Sm + Ss). Different letters indicate a significant difference (p< 0.05).

Figure 4
Representative images of keratinocytes monolayer and C. albicans morphology in the inverted light microscopy. A) Monolayers without infection (control). B) single C. albicans biofilms. C) mixed infection by C. albicans, S. mutans, and S. sanguinis. Note, in the single biofilm C. albicans yeast, and some hyphae dispersed. In mixed biofilms, intense microbial proliferation, and hyphae aggregates.

Discussion

The oral epithelium is the primary barrier to preventing microbial infection in the mouth ⁷. Therefore, understanding how epithelial cells respond to a fungi-bacterial infection would be beneficial and could be an indicator of the effectiveness of new therapeutic approaches. This study used HaCaT and FaDu cell lines. The former was used to investigate the response of keratinocytes (most abundant cells in oral mucosa), whilst FaDu cells have previously been reported as being less susceptible to damage by C. albicans^21,22. Also, we justify the chosen experimental in agreement with the period that the monolayers can stand before cell damage ^22,23. Our findings revealed that a mixed Candida-Streptococcus infection increased the immune response, cell damage, and microbial proliferation and led to higher invasiveness by C. albicans.

Cytokines released by epithelial cells may orchestrate the oral mucosa's proinflammatory process ²². Here, IL-18 and IL-34 genes were upregulated in both cell lines exposed to mixed biofilms. IL-18 is the so-called gamma interferon (IFN-γ) inducing factor ^11,24. This interleukin is released by macrophages stimulating IFN‐γ production, which plays a role in host defense against C. albicans^25,26. In the present study, C. albicans infection did not increase IL-18 gene expression. This result contrasts with observations in murine models with disseminated candidiasis ^26,27. Such differences in IL-18 production could relate to the time of infection, C. albicans morphology, or other differences between the models used. Importantly, when Candida-Streptococcus mixed biofilms were present, the IL-18 response was upregulated. These findings indicate that interaction between these species infections leads to increased fungal virulence with associated earlier proinflammatory responses. Importantly, a previous study with Streptococcus sanguinis, Streptococcus mutans, Actinomyces viscosus, and Actinomyces odontolyticus showed that bacterial-only infection did not promote significant tissue damage or invasiveness ¹⁸.

IL-34 gene expression was upregulated in HaCaT and FaDu-infected cells. Infection with C. albicans, S. mutans, and S. sanguinis led to higher IL-34 gene expression compared with C. albicans only. These findings reinforce our hypothesis that mixed-species infections elevate the ensuing immune response. IL-34 is suggested as a biomarker for infectious diseases and screening of anti-inflammatory therapies ¹⁰. This role has been assigned to IL-34 as this interleukin can promote tolerance to C. albicans through the downregulation of TLR2 and Dectin-1 expression by macrophages, resulting in lower TNFα production ²⁸. Although IL-34 is important, only one investigation has evaluated its expression in C. albicans infection models ²⁸. To our knowledge, this study is the first that explores IL-34 expression during Candida-Streptococcus interaction.

In addition to the effect of bacterial presence on the epithelial immune response, tissue damage, and pathogenicity were also investigated. LDH activity is widely used to measure tissue injury during infection. Our findings revealed that Candida-Streptococcus infection promoted significantly higher damage of cells compared with those infected with C. albicans only. This result is in agreement with a previous investigation that explored interactions between C. albicans and Streptococcus species, where the presence of polymicrobial biofilms on Reconstituted human oral epithelium (RHOE), also resulted in higher damage, based on LDH ¹⁸. Polymicrobial interactions establish homeostasis and dysbiosis in the oral biofilm ²⁹. Due to variations in microbial numbers or the host environment, microbial communities may interact to potentiate pathogenicity ³⁰. For Candida-Streptococcus interactions, an increase in the capacity of S. mutans to demineralize the enamel of teeth has been reported ^14,31.

Similarly, interactions between C. albicans and S. sanguinis have been implicated in promoting an increase in the biofilm biomass to form robust biofilms ³². Finally, the presence of certain bacterial species significantly increases C. albicans virulence ^18,33. It is important to highlight that other studies have been exploring the interactions between Candida-Streptococcus by the use of probiotics point of view, due to their ability to inhibit some virulence factors such as coaggregation and dimorphism ^34,35, however, these comparisons should not be extrapolated because in the context of probiotics, S. salivarius K12, for example is a different reference strain, which can modulate different response when compared to those used in the present study.

Also, in the present study, the morphological transition between yeast to hyphal forms was explored as a virulence factor ³⁶. Microscopy demonstrated intense microbial proliferation with several hyphal aggregates after contamination with different species. Even though hyphal morphogenesis is a relevant virulence marker, this approach does not explore the mechanisms involved and this is an area for further study. The expression of a subset of genes encoding virulence factors (e.g. Hwp1, Als3, Sap4, Sap5, Sap6, Ece1, Hyr1 ³⁷ would be relevant to further enhance our understanding of the mechanistic basis of bacterial-induced modulation of C. albicans virulence.

Although this study did not use single S. mutans and S. sanguinis infections as control, previous studies demonstrated that a bacterial biofilm of these species did not modulate host interleukins' gene expression ¹⁸. Moreover, the bacterial infections did not affect the LDH activity and had limited invasion and tissue proliferation compared to uninfected controls ¹⁸. Thus, these previous data support our findings that epithelial immune responses and pathogenicity of Candida albicans are enhanced in the presence of oral streptococci.

Microscopy revealed higher C. albicans invasion of cell monolayers in mixed infections. Candida albicans can induce endocytosis or actively penetrate host cells ³⁶. In the first process, the fungus expresses invasins (i.e. Als3 and Ssa1) which bind to host ligands, such as E-cadherin, triggering fungal entry into the host cell ³⁷. In contrast, active penetration occurs by physical pressure exerted by directed hyphal growth, hyphal extension, and hydrolytic enzyme secretion ³⁸. Despite the fact that these mechanisms are well established in single C. albicans biofilms, the bacterial contribution to endocytosis and active penetration remains poorly explored.

Taken together, our results demonstrated an important contribution of oral streptococci to the epithelial immune response and pathogenicity of C. albicans infections. Clinically, consideration of the bacterial component as a potential modulator of candidosis might be of benefit in the management strategies of the infection.

Acknowledgments

The authors wish to thank the Conselho Nacional de Desenvolvimento Científico e Tecnológico - Brazil (CNPq) and Coordenação de Aperfeiçoamento de Pessoal de Nível Superior -Brazil (CAPES) for providing scholarship to the first and second third author. This work was funded by the Public Call nº 03/2020 Produtividade em Pesquisa PROPESQ/PRPG/UFPB proposal code PVG13203-2020.

References

• ¹ Vila, T., Sultan, A. S., Montelongo-Jauregui, D., & Jabra-Rizk, M. A. Oral Candidiasis: A Disease of Opportunity. Journal of fungi 2020, 6(1): 15.
• ² Nobile, C. J., & Johnson, A. D. Candida albicans Biofilms and Human Disease. Annual review of microbiology 2015; 69: 71-92.
• ³ Gulati, M., & Nobile, C. J.. Candida albicans biofilms: development, regulation, and molecular mechanisms. Microbes and infection 2016; 18(5):310-321.
• ⁴ Arkowitz, R. A., & Bassilana, M. Recent advances in understanding Candida albicans hyphal growth. F1000Res. 2019; 21;8.
• ⁵ Niewerth, M., & Korting, H. C. Phospholipases of Candida albicans Mycoses 2001; 44(9-10):361-367.
• ⁶ Staniszewska M. Virulence Factors in Candida species. Current protein & peptide science 2020; 21(3):313-323.
• ⁷ Rast, T. J., Kullas, A. L., Southern, P. J., & Davis, D. A. Human Epithelial Cells Discriminate between Commensal and Pathogenic Interactions with Candida albicans. PloS one 2016; 11(4), e0153165.
• ⁸ Morse DJ, Wilson MJ, Wei X, et al. Denture-associated biofilm infection in three-dimensional oral mucosal tissue models. J Med Microbiol 2018; 67(3):364-375.
• ⁹ Guillonneau C, Bézie S, Anegon I. Immunoregulatory properties of the cytokine IL-34. Cell Mol Life Sci. 2017; 74(14):2569-2586.
• ¹⁰ Baghdadi, M., Endo, H., Tanaka, Y., Wada, H., & Seino, K. I. Interleukin 34, from pathogenesis to clinical applications. Cytokine 2017; 99:139-147.
• ¹¹ Yasuda, K., Nakanishi, K., & Tsutsui, H. Interleukin-18 in Health and Disease. International journal of molecular sciences 2019; 20(3), 649.
• ¹² Höfs, S., Mogavero, S., & Hube, B. Interaction of Candida albicans with host cells: virulence factors, host defense, escape strategies, and the microbiota. Journal of microbiology 2016; 54(3):149-169.
• ¹³ Bertolini, M., & Dongari-Bagtzoglou, A. The Relationship of Candida albicans with the Oral Bacterial Microbiome in Health and Disease. Advances in experimental medicine and biology 2019; 1197:69-78.
• ¹⁴ Falsetta, M. L., Klein, M. I., Colonne, P. M., Scott-Anne, K., Gregoire, S., Pai, C. H., Gonzalez-Begne, M., et al. Symbiotic relationship between Streptococcus mutans and Candida albicans synergizes virulence of plaque biofilms in vivo Infection and immunity 2014; 82(5): 1968-1981.
• ¹⁵ Cavalcanti, Y. W., Wilson, M., Lewis, M., Del-Bel-Cury, A. A., da Silva, W. J., & Williams, D. W. Modulation of Candida albicans virulence by bacterial biofilms on titanium surfaces. Biofouling 2016; 32(2):123-134.
• ¹⁶ Metwalli KH, Khan SA, Krom BP, Jabra-Rizk MA Streptococcus mutans, Candida albicans, and the human mouth: a sticky situation. PLoS Pathog. 2013;9(10):e1003616.
• ¹⁷ Pereira R, Dos Santos Fontenelle RO, de Brito EHS, de Morais SM. Biofilm of Candida albicans: formation, regulation and resistance. J Appl Microbiol. 2021 Jul;131(1):11-22.
• ¹⁸ Cavalcanti, Y. W., Morse, D. J., da Silva, W. J., Del-Bel-Cury, A. A., Wei, X., Wilson, M., et al. Virulence and pathogenicity of Candida albicans is enhanced in biofilms containing oral bacteria. Biofouling 2015; 31(1): 27-38.
• ¹⁹ Koressaar, T., & Remm, M. Enhancements and modifications of primer design program Primer3. Bioinformatics 2007; 23(10):1289-1291.
• ²⁰ Bustin, S. A., Benes, V., Garson, J. A., Hellemans, J., Huggett, J., Kubista, M., et al. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clinical chemistry 2009; 55(4):611-622.
• ²¹ Martinez-Lopez, R., Park, H., Myers, C. L., Gil, C., & Filler, S. G. Candida albicans Ecm33p is important for normal cell wall architecture and interactions with host cells. Eukaryotic cell 2006; 5(1):140-147.
• ²² Groeger, S. E., & Meyle, J. Epithelial barrier and oral bacterial infection. Periodontology 2000 2015; 69(1): 46-67.
• ²³ Zink S, Nass T, Rösen P, Ernst JF. Migration of the fungal pathogen Candida albicans across endothelial monolayers. Infect Immun. 1996 Dec;64(12):5085-91. doi: 10.1128/iai.64.12.5085-5091.1996. PMID: 8945550; PMCID: PMC174492.
  » https://doi.org/10.1128/iai.64.12.5085-5091
• ²⁴ Vecchié, A., Bonaventura, A., Toldo, S., Dagna, L., Dinarello, C. A., & Abbate, A. IL-18 and infections: Is there a role for targeted therapies?. Journal of cellular physiology 2021; 236(3):1638-1657.
• ²⁵ Rouabhia, M., Ross, G., Pagé, N., & Chakir, J. Interleukin-18 and gamma interferon production by oral epithelial cells in response to exposure to Candida albicans or lipopolysaccharide stimulation. Infection and immunity 2002; 70(12): 7073-7080.
• ²⁶ Shen, H., Yu, Y., Chen, S. M., Sun, J. J., Fang, W., Guo, S. Y., et al . Dectin-1 Facilitates IL-18 Production for the Generation of Protective Antibodies Against Candida albicans Frontiers in microbiology 2020; 11: 1648.
• ²⁷ Netea, M. G., Vonk, A. G., van den Hoven, M., Verschueren, I., Joosten, L. A., van Krieken, J. H., et al. Differential role of IL-18 and IL-12 in the host defense against disseminated Candida albicans infection. European journal of immunology 2003; 33(12):3409-3417
• ²⁸ Xu, R., Sun, H. F., Williams, D. W., Jones, A. V., Al-Hussaini, A., Song, B., & Wei, X. Q. IL-34 Suppresses Candida albicans Induced TNFα Production in M1 Macrophages by Downregulating Expression of Dectin-1 and TLR2. Journal of immunology research 2015; 328146.
• ²⁹ Peleg, A. Y., Hogan, D. A., & Mylonakis, E. Medically important bacterial-fungal interactions. Nature reviews. Microbiology 2010; 8(5): 340-349.
• ³⁰ Marsh P. D. Dental plaque: biological significance of a biofilm and community life-style. Journal of clinical periodontology 2005; 32 Suppl 6:7-15.
• ³¹ Sampaio, A. A., Souza, S. E., Ricomini-Filho, A. P., Del Bel Cury, A. A., Cavalcanti, Y. W., & Cury, J. A. Candida albicans Increases Dentine Demineralization Provoked by Streptococcus mutans Biofilm. Caries research 2019; 53(3):322-331.
• ³² Diaz, P. I., Xie, Z., Sobue, T., Thompson, A., Biyikoglu, B., Ricker, A., Ikonomou, L., & Dongari-Bagtzoglou, A. Synergistic interaction between Candida albicans and commensal oral streptococci in a novel in vitro mucosal model. Infection and immunity 2012; 80(2):620-632.
• ³³ Morse, D. J., Wilson, M. J., Wei, X., Bradshaw, D. J., Lewis, M., & Williams, D. W. Modulation of Candida albicans virulence in vitro biofilms by oral bacteria. Letters in applied microbiology 2019; 68(4):337-343.
• ³⁴ Allaker RP, Stephen AS. 2017. Use of probiotics and oral health. Curr Oral Health Rep. 4:309-318.
• ³⁵ Mokhtar M, Rismayuddin NAR, Mat Yassim AS, Ahmad H, Abdul Wahab R, Dashper S, Arzmi MH. Streptococcus salivarius K12 inhibits Candida albicans aggregation, biofilm formation and dimorphism. Biofouling. 2021 Aug;37(7):767-776. doi: 10.1080/08927014.2021.1967334. Epub 2021 Aug 23. PMID: 34425729.
  » https://doi.org/10.1080/08927014.2021.1967334
• ³⁶ Calderone, R. A., & Fonzi, W. A. 2001. Virulence factors of Candida albicans Trends in microbiology 2001; 9(7):327-335.
• ³⁷ Mayer, F. L., Wilson, D., & Hube, B. Candida albicans pathogenicity mechanisms. Virulence 2013; 4(2):119-128.
• ³⁸ Wächtler, B., Citiulo, F., Jablonowski, N., Förster, S., Dalle, F., Schaller, M., Wilson, D., & Hube, B. Candida albicans-epithelial interactions: dissecting the roles of active penetration, induced endocytosis and host factors on the infection process. PloS one 2012; 7(5), e36952.

Funding

• This work was funded by the Public Call nº 03/2020 Produtividade em Pesquisa PROPESQ/PRPG/UFPB proposal codes PVG13203-2020 and PVG13277-2020

Publication Dates

• Publication in this collection
  17 July 2023
• Date of issue
  May-Jun 2023

History

• Received
  09 Feb 2023
• Accepted
  11 May 2023