Accessibility / Report Error

Influence of Aae Autotransporter Protein on Adhesion and Biofilm Formation by Aggregatibacter actinomycetemcomitans

Abstract

The periodontopathogen Aggregatibacter actinomycetemcomitans colonizes oral cavity by binding to and invading epithelial cells as well as by participating in biofilms formed on hard surfaces. Aae, an autotransporter protein, is implicated in bacterial adhesion to epithelial cells. Due to the multiple functions of bacterial autotransporter proteins, this study aimed to evaluate the role of aae in A. actinomycetemcomitans ability to adhere to both saliva-coated hydroxyapatite (SHA) and biofilm. An aae null mutant was constructed. Its hydrophobic properties as well as its ability to adhere to epithelial cells, SHA and to form biofilm were evaluated and compared with the parental strain, A. actinomycetemcomitans VT1169. The aae null mutant showed reduced hydrophobicity, as well as decreased binding to SHA and biofilm formation compared to the parental strain. These data suggest that aae mediates A. actinomycetemcomitans adhesion to epithelial cells and may be involved in biofilm formation and interaction with adsorbed salivary proteins.

Key Words:
aae; Aggregatibacter actinomycetemcomitans; adhesion; biofilm formation; hydrophobicity.

Resumo

O peridontopatógeno Aggregatibacter actinomycetemcomitans coloniza a cavidade oral aderindo e invadindo as células epiteliais e participando da formação de biofilme em superfícies duras. Aae, uma proteína autotransportadora está relacionada com a adesão bacteriana às células epiteliais. Devido às múltiplas funções desempenhadas por proteínas bacterianas autotransportadoras, este estudo teve como objetivo avaliar o papel de aae de A. actinomycetemcomitans tanto na capacidade de aderir à hidroxiapatita recoberta por saliva (SHA), quanto a de formar biofilme. Um mutante nulo aae foi construído. Suas propriedades hidrofóbicas, bem como a sia capacidade para aderir às células epiteliais, à SHA e para formar biofilme foram avaliadas e comparadas com a cepa -mãe, A. Actinomycetemcomitans VT1169. O mutante nulo aae apresentou redução de hidrofobicidade, assim como diminuição da adesão à SHA e na formação de biofilme, quando comparado à cepa parental. Estes dados sugerem que aae media a adesão de A. Actinomycetemcomitans às células epiteliais e pode também estar envolvida na formação de biofilme e na interação com proteínas salivares adsorvidas.

Introduction

Adhesion of bacteria to host tissues is the first step in the infectious process 11. Fine, DH; Kaplan, JB; Kachlany, SC; Schreiner, HC. How we got attached to Actinobacillus actinomycetemcomitans: a model for infectious diseasesPeriodontol 2000 2006;42:114-157.. The expression of bacterial outer membrane proteins is influenced by both environmental 22. Longo, PL; Nunes, AC; Umeda, JE; Mayer, MP. Gene expression and phenotypic traits of Aggregatibacter actinomycetemcomitans in response to environmental changes. J Periodontal Res. 2013;48:766-772. and host factors and has specific interactions with host complementary receptors 33. Fives-Taylor, PM; Meyer, D; Mintz, K. Characteristics of Actinobacillus actinomycetemcomitans invasion of and adhesion to cultured epithelial cells. Adv Dent Res 1995;9:55-62.,44. Fives-Taylor, PM; Meyer, DH; Mintz, KP; Brissette, C. Virulence factors of Actinobacillus actinomycetemcomitans. Periodontol2000 1999;20:136-167.. Thus, changes in these bacterial outer membrane proteins may lead to alterations in hydrophobic properties and result in reduced attachment of bacteria to immobilized salivary proteins adsorbed to tooth surfaces or oral mucosa 55. Gibbons, RJ; Etherden, I. Comparative hydrophobicities of oral bacteria and their adherence to salivary pellicles. Infect Immun 1983;41:1190-1196..

Adhesive type IV pili mediate Aggregatibacter actinomycetemcomitans ability to colonize tooth surface 11. Fine, DH; Kaplan, JB; Kachlany, SC; Schreiner, HC. How we got attached to Actinobacillus actinomycetemcomitans: a model for infectious diseasesPeriodontol 2000 2006;42:114-157.. However, ability to adhere to saliva-coated hydroxyapatite (SHA) is decreased and requires interaction with salivary proteins 66. Fine, DH; Furgang, D; Schreiner, HC; Goncharoff, P; Charlesworth, J; Ghazwan, G et al... Phenotypic variation in Actinobacillus actinomycetemcomitans during laboratory growth: implications for virulence. Microbiol 145;1999:1335-1347.. Non-fimbriated variants exhibiting smooth colony morphology may still adhere to epithelial cells and form biofilms mediated by non-fimbrial components 77. Haase, EM; Bonstein, T; Palmer, Jr RJ; Scannapieco, FA. Environmental influences on Actinobacillus actinomycetemcomitans biofilm formation. Arch Oral Biol 2006; 51:299-314.,88. Rose, JE; Meyer, DH; Fives-Taylor, PM. Aae, an autotransporter involved in adhesion of Actinobacillus actinomycetemcomitans to epithelial cells. Infect Immun 2003;71:2384-2393.,99. Ruiz, T; Lenox, C; Radermacher, M; Mintz, KP. Novel surface structures are associated with the adhesion of Actinobacillus actinomycetemcomitans to collagen. Infect Immun 2006;74:6163-6170.,1010. Yue, G; Kaplan, JB; Furgan, D; Mansfield, KG; Fine, DH. A second Aggregatibacter actinomycetemcomitans autotransporter adhesin exhibits specificity for buccal epithelial cells in humans and Old World primates. Infect Immun 2007;75:4440-4448..

Three autotransporter proteins were recognized as having a role in the interaction of A. actinomycetemcomitans with the host: Aae, ApiA or Omp100 and EmaA 11. Fine, DH; Kaplan, JB; Kachlany, SC; Schreiner, HC. How we got attached to Actinobacillus actinomycetemcomitans: a model for infectious diseasesPeriodontol 2000 2006;42:114-157.,88. Rose, JE; Meyer, DH; Fives-Taylor, PM. Aae, an autotransporter involved in adhesion of Actinobacillus actinomycetemcomitans to epithelial cells. Infect Immun 2003;71:2384-2393.,99. Ruiz, T; Lenox, C; Radermacher, M; Mintz, KP. Novel surface structures are associated with the adhesion of Actinobacillus actinomycetemcomitans to collagen. Infect Immun 2006;74:6163-6170.,1010. Yue, G; Kaplan, JB; Furgan, D; Mansfield, KG; Fine, DH. A second Aggregatibacter actinomycetemcomitans autotransporter adhesin exhibits specificity for buccal epithelial cells in humans and Old World primates. Infect Immun 2007;75:4440-4448.,1111. Fine, DH; Velliyagounder, K; Furgang, D; Kaplan, JB. The Actinobacillus actinomycetemcomitans autotransporter adhesin Aae exhibits specificity for buccal epithelial cells from humans and Old World primates. Infect Immun 2005;73:1947-1953.,1212. Mintz, KP. Identification of an extracellular matrix protein adhesin, EmaA, which mediates the adhesion of Actinobacillus actinomycetemcomitans to collagen. Microbiology 2004;150:2677-2688.. Autotransporter proteins are characterized by an amino-terminal leader peptide, a secreted mature protein (or passenger domain) and a C-terminal domain 1313. Henderson, IR; Navarro-Garcia, F; Desvaux, M; Fernandez, RC; Ala'Aldeen, D. Type V protein secretion pathway: the autotransporter story. Microbiol Mol Biol Rev 2004;68:692-744.. These proteins present huge variations in passenger domain, explaining their wide range of effector functions, such as adhesion, invasion, biofilm formation, autoaggregation and cytotoxicity 1414. Wells ,TJ; Tree, JJ; Ulett ,GC; Schembri, MA. Autotransporter proteins: novel targets at the bacterial cell surface. FEMS Microbiol Lett. 2007;274:163-172..

Aae and ApiA are both related to adhesion of A. actinomycetemcomitans to human buccal epithelial cells 1010. Yue, G; Kaplan, JB; Furgan, D; Mansfield, KG; Fine, DH. A second Aggregatibacter actinomycetemcomitans autotransporter adhesin exhibits specificity for buccal epithelial cells in humans and Old World primates. Infect Immun 2007;75:4440-4448.. An aae null mutant strain has shown decreased adhesion to KB cells, derived from oral carcinoma 88. Rose, JE; Meyer, DH; Fives-Taylor, PM. Aae, an autotransporter involved in adhesion of Actinobacillus actinomycetemcomitans to epithelial cells. Infect Immun 2003;71:2384-2393., and total loss of adhesion to buccal epithelial cells (BECs) was found in an aae/apiA double-null mutant 1010. Yue, G; Kaplan, JB; Furgan, D; Mansfield, KG; Fine, DH. A second Aggregatibacter actinomycetemcomitans autotransporter adhesin exhibits specificity for buccal epithelial cells in humans and Old World primates. Infect Immun 2007;75:4440-4448.. Aae specifically binds to BECs 1111. Fine, DH; Velliyagounder, K; Furgang, D; Kaplan, JB. The Actinobacillus actinomycetemcomitans autotransporter adhesin Aae exhibits specificity for buccal epithelial cells from humans and Old World primates. Infect Immun 2005;73:1947-1953. and to blood vessel endothelial cells (HUVEC), but the domain involved in binding to BECs is located in a region of repeats, whereas a different domain is required for adhesion to HUVEC 1515. Fine, DH; Kaplan, JB; Furgang, D; Karched, M; Velliyagounder K; Yue G. Mapping the epithelial-cell-binding domain of the Aggregatibacter actinomycetemcomitans autotransporter adhesion Aae. Microbiology 2010;156:3412-3420..

Aae is identical to the C-terminal region of Haemophilus influenzae IgA1 protease and Hap adhesin, but there is no significant homology of the N-terminal region with other autotransporter proteins listed in the GenBank 11. Fine, DH; Kaplan, JB; Kachlany, SC; Schreiner, HC. How we got attached to Actinobacillus actinomycetemcomitans: a model for infectious diseasesPeriodontol 2000 2006;42:114-157. and this region is related to the BEC-binding domain 1515. Fine, DH; Kaplan, JB; Furgang, D; Karched, M; Velliyagounder K; Yue G. Mapping the epithelial-cell-binding domain of the Aggregatibacter actinomycetemcomitans autotransporter adhesion Aae. Microbiology 2010;156:3412-3420.. In Hap, the C-terminal 311 amino acid of the passenger domain (Haps) is involved in aggregation, microcolony formation and adhesion to epithelial cells. Furthermore, another domain, located in the C-terminal 511 residue of Hap is involved in binding to laminin, fibronectin and collagen IV 1616. Fink, DL; Buscher, AZ; Green, B; Fernsten, P. St Geme 3rd JW. The Haemophilus influenzae Hap autotransporter mediates microcolony formation and adherence to epithelial cells and extracellular matrix via binding regions in the C-terminal end of the passenger domain. Cell Microbiol 2003;5:175-186..

Hence, the present study aimed to test the hypothesis that aae is also involved in A. actinomycetemcomitans ability to adhere to saliva-coated hydroxyapatite (SHA) and in biofilm formation. An aae null mutant was constructed and its ability to adhere to epithelial cells and to SHA as well as to form biofilms was evaluated and compared with the parental strain.

Material and Methods

Bacterial Strains, Plasmids and KB Cells

The bacterial strains used in the study are presented in Table 1. A. actinomycetemcomitans strains were grown using Trypticase soy broth with 0.6% yeast extract (TSB-YE) in humidified 10% CO2 incubator at 37 ?#61616;C. Escherichia coli strains were grown in Luria-Bertani (LB) broth at 37 °C. For solid medium, 15 g/L of agar were added to liquid medium. Ampicilin, spectinomycin, kanamycin and rifampicin (100 μg.mL-1) were added as needed. KB cells were kindly provided by Dr. Paula Fives-Taylor, University of Vermont. Cells were cultured in 75 cm3 flasks with RPMI-1640 medium (Sigma Chemical Co, St. Louis, MO, USA) containing 5% of fetal bovine serum heat-inactivated (Cultilab, Campinas, SP, Brazil) and supplemented with 50 μg.mL-1 gentamycin at 37 °C in humidified atmosphere with 5% CO2.

Table 1
Bacterial strains and plasmids used in this study

Aae Knock-Out Mutant

The aae gene was obtained by amplification using AAE5 (5'CAG AAC CAC AAC CAG TAC CAG CAC AC 3') and AAE3 (5'GCA GAA GTG AGT TAT TCA TCG 3') (24) primers and DNA from SUNY465 strain as template. PCR was performed in a Gene Amp PCR System 2400 (Perkin Elmer Inc., Norwalk, CT, USA) and consisted of one initial denaturation step (94 °C for 5 min) and 40 cycles of denaturation at 94 °C for 15 s, annealing at 60 °C for 30 s and elongation at 72 °C for 2 min. The 2,732 bp fragment was cloned into pGEM-T Easy vector (Promega, Madison, WI, USA) and transformed in electrocompetent E. coli DH5α (paae). Transformants were selected in LB supplemented with ampicilin. The aae gene was interrupted by insertion of a spectinomycin resistance gene obtained from pdl269. Plasmidial DNA was used as template to amplify the spectinomycin resistance gene, aad9, using forward primer (5' GGTACCAAAGCTTTTCGT TCG TGA 3') and reverse primer (5' CGCCATAAGCTTGGGTTATTGTT 3'). An initial denaturing step at 94 °C for 5 min was followed by 30 cycles at 94 °C for 1 min, 54 °C for 30 s and 72 °C for 1 min, with a final extension step at 72 °C for 10 min. The 1,167 bp fragment was cloned into the pCR2.1-TOPO vector (Invitrogen Life Technologies, São Paulo, SP, Brazil) and transformed in E. coli TOPOF10. Transformants were selected in LB supplemented with kanamycin. Plasmid DNA (paad9) was digested with HindIII. The 1,148 bp HindIII fragment of paad9 was ligated to paae and transformed in electrocompetent E. coli JM109. Transformants were selected in spectinomycin LB agar. The aae/aad9 fragment was obtained after double digestion with EcoRI and Alw21I (AspHI) (Fermentas Life Sciences, São Paulo, SP, Brazil) ligated into the conjugative plasmid pVT1460 (pVTaae/aad9) and transformed in competent E. coli SM10(?#61548;pir) cells. Transformant cells were selected in LB with spectinomycin and plasmid identity was confirmed.

An allelic replacement mutagenesis system was used 1717. Mintz, KP, Fives-Taylor, PM. impA, a gene coding for an inner membrane protein, influences colonial morphology of Actinobacillus actinomycetemcomitans. Infect Immun 2000;68:6580-6586. to generate the aae null mutant isogenic to A. actinomycetemcomitans VT1169 (SUNY 465, rifampicin and nalidixic acid resistant). A. actinomycetemcomitans VT1169, the recipient strain, and E. coli SM10(?#61548;pir)pVTaae/aad9 were grown in broth to reach OD560 nm ~0.3 and ~0.5, respectively, and mixed. After conjugation, cells were grown on Trypticase soy agar with 0.6% yeast extract (TSA-YE) plates containing spectinomycin and rifampicin in 10% CO2 at 37 °C for 48 h. Isolated colonies of putative transconjugants were screened by PCR using EXP5 (5' GCA TTT GCG TCA GAG TTT AAT G 3') and primers 88. Rose, JE; Meyer, DH; Fives-Taylor, PM. Aae, an autotransporter involved in adhesion of Actinobacillus actinomycetemcomitans to epithelial cells. Infect Immun 2003;71:2384-2393., located upstream and downstream aae, respectively, exceeding the cloned region of aae in pGEM-T Easy vector. Product identities were confirmed by sequencing, performed in MegaBACE100 with DYEnamic ET Dye Terminator Kit (GE Healthcare Bio-Sciences Pittsburgh, PA, USA).

Bacterial Cultures

A. actinomycetemcomitans VT1169 and USP29 (aae- mutant) were grown in TSB-YE added with rifampicin or spectinomycin until mid-exponential phase under microaerophilic (10% CO2) incubation. The bacterial cultures were adjusted to an OD500 nm of 0.20 corresponding to 3 x 108 cells.mL-1.

Adhesion to KB Cells Assay

The binding capacity of the aae null mutant was determined by a standard adhesion assay 1818. Meyer, DH; Fives-Taylor, PM. Characteristics of adherence of Actinobacillus actinomycetemcomitans to epithelial cells. Infect Immun 1994;62:928-935.. Approximately 2 x 105 KB cells/well were seeded in a 24-well tissue culture plate and incubated overnight in 5% CO2 until confluence. Bacterial suspensions of A. actinomycetemcomitans parental strain (VT1169) and aae null mutant (USP29) were added to each well to reach a multiplicity of infection (MOI) of 1:100 (KB cell/bacteria). After 2 h of incubation at 37 °C, non-adhesive bacteria were removed by washing with PBS containing 1.0 mM CaCl2/0.5 mM MgCl2 and adherent/internalized bacteria were released with 0.1% Triton X-100. Samples were serially diluted and CFU estimated in TSA-YE plates. The experiment was performed in quadruplicate on three independent assays.

Adhesion to Hexadecane

The adhesion to hexadecane was assessed by a protocol modified as follows 55. Gibbons, RJ; Etherden, I. Comparative hydrophobicities of oral bacteria and their adherence to salivary pellicles. Infect Immun 1983;41:1190-1196.: bacterial cells were suspended in PUM buffer (9 mM K2HPO4, 50 mM KH2PO4, 30 mM urea, 0.8 mM MgSO4.7H2O, pH 7.1) to an OD500 nm ~0.85 corresponding to 1 x 109 CFU mL1, added with hexadecane (Sigma Aldrich, St. Louis, MO, USA). After phase separation, the fraction of adherent cells to hexadecane was estimated according the aqueous phase absorbance.

Figure 1
Agarose gel electrophoresis of the amplicons obtained with primers upstream and downstream of aae cloning sites (EXP5-AAE3) using as template DNA VT1169 (parental strain) (lane I) and USP29 aae- mutant strain (lane II). Predicted fragment sizes: lane I, 3,551 bp; lane II 4,698 bp. MW: 1 Kb plus DNA ladder (Invitrogen Life Technologies).

Biofilm Assay

Biofilm formation was estimated by a conventional crystal violet staining method 77. Haase, EM; Bonstein, T; Palmer, Jr RJ; Scannapieco, FA. Environmental influences on Actinobacillus actinomycetemcomitans biofilm formation. Arch Oral Biol 2006; 51:299-314.. Aliquots of bacterial cultures at 106 CFU mL-1 were added to the wells of 96-wells flat-bottom polystyrene microtiter plates (Corning Inc., Corning, NY, USA) and incubated statically under microaerophilic atmosphere at 37 °C for 14 h. Total cell density was estimated by turbidity measurement at OD490 nm. After washing with phosphate-buffer saline (PBS, pH 7.3), adherent cells were fixed with methanol and stained with 0.1% crystal violet. The dye was eluted in 95% ethanol (v/v) and absorbance was measured at 600 nm. Biofilm formation was considered as the ratio between absorbance value of crystal violet eluted from biofilm (OD600 nm) and absorbance value obtained from total growth (OD490 nm). Experiments were made in sextuplicate. Non-inoculated wells were used as controls for sterility.

Adherence to Saliva-Coated Hydroxyapatite

The adherence to SHA was assessed by a protocol modified as follows 66. Fine, DH; Furgang, D; Schreiner, HC; Goncharoff, P; Charlesworth, J; Ghazwan, G et al... Phenotypic variation in Actinobacillus actinomycetemcomitans during laboratory growth: implications for virulence. Microbiol 145;1999:1335-1347.: whole paraffin-stimulated saliva was obtained from six periodontally and medically healthy adults in wide mouth plastic tubes to achieve a minimum pooled volume of 40 mL. Salivary collection was divided into equal aliquots, frozen, clarified and heated to 60 °C for 30 min. Spherical hydroxyapatite beads (BDH Chemicals, Poole, U.K.) were added to the saliva and incubated for 2 h at 37 °C under slow rotation (5 rpm). The hydroxyapatite coated beads were washed, added with bacterial suspensions adjusted to ~3 x 108 CFU mL-1 in PBS and incubated for 2 h. After washing, cell/bead suspensions were subjected to sonication at low power impulse (Branson Ultrasonic Cleaner, Danbury, CT, USA) and allowed to settle down. Supernatants from non-sonicated (remnant non-adherent cells) and sonicated (adherent plus remnant non-adherent cells) tubes were inoculated on TSA-YE plates for CFU determination. The number of cells attached to SHA was the difference between CFU values determined in supernatant of sonicated and non-sonicated tubes. The experiment was performed in quadruplicate.

Statistical Analysis

Adhesion to KB cells, biofilm formation and adhesion to SHA of the parental and aae- mutant strains were compared by Student's t-test. Adhesion to n-hexadecane was evaluated by two analyses of variance followed by multiple comparisons Tukey's test. The significance level was set at p<0.05.

Results

Construction of an aae Knock-Out Strain

The chromosomal aae gene from VT1169 was interrupted by insertion of a spectinomycin cassette (aad9) in the HindIII unique site of aae by allelic replacement mutagenesis. Insertion was confirmed by amplification ( . 1) using primers located upstream and downstream the cloned aae gene (EXP5 and AAE3) and sequencing. No differences in growth curves were observed between parental (VT1169) and its isogenic mutant aae- strains (USP29) (data not shown). Both strains reached the mid exponential growth phase after 6 h in microaerophilic incubation.

Adhesion to KB Cells

As expected, the aae- mutant exhibited a marked reduction in adhesion to KB cells compared with the parental strain (p<0.01, Student's t-test). Results were reproducible in three independent assays (Fig. 2A).

Figure 2
Phenotypic traits of A. actinomycetemcomitans parental (VT1169) and aae null mutant strains (USP29). Asterisk indicates statistically significant differences. A: Binding to KB cells (Student's t-test test, p<0.01). B: Percentage of bacteria adherent to n-hexadecane (Tukey's test, p<0.0001). C: Biofilm formation (Student's t-test, p<0.001).

Adherence to Hexadecane

Bacterial cells' hydrophobic properties differed between parental and aae null mutant strains, with aae- mutant cells being more hydrophilic than those of the parental strain (Fig. 2B) (p<0.0001, Tukey's test).

Biofilm Formation

The parental strain (VT1169) showed greater ability to form biofilm than the aae null mutant (USP29). After 14 h of microaerophilic incubation, the aae- mutant showed a 66.5% reduction in biofilm formation in relation to parental strain (Fig. 2C) (p<0.001, Student's t-test).

Adherence to SHA

Parental strain adherence to SHA averaged 20.06±2.99x105 CFU mL-1, whereas only 1.55±0.29 x 105 CFU mL-1 of the aae null mutant strain were adherent. Thus, aae- mutant's ability to adhere to SHA was significantly reduced when compared with the parental type (p<0.05, Student's t-test).

Discussion

In order to investigate the role of aae in oral cavity colonization by A. actinomycetemcomitans, an aae null mutant strain was constructed and its phenotype analyzed. This approach, used in several studies analyzing A. actinomycetemcomitans surface proteins, may provide insight of the interaction between multiple bacterial proteins on the cell outer membrane and host receptors 88. Rose, JE; Meyer, DH; Fives-Taylor, PM. Aae, an autotransporter involved in adhesion of Actinobacillus actinomycetemcomitans to epithelial cells. Infect Immun 2003;71:2384-2393.,1010. Yue, G; Kaplan, JB; Furgan, D; Mansfield, KG; Fine, DH. A second Aggregatibacter actinomycetemcomitans autotransporter adhesin exhibits specificity for buccal epithelial cells in humans and Old World primates. Infect Immun 2007;75:4440-4448..

Reduced hydrophobicity, decreased ability to bind to saliva-coated hydroxyapatite, and less biofilm formed than in the parental strain was observed. The collected data indicated that aae might also play a role in the interaction with salivary proteins coating the oral surfaces, increasing the repertoire of attachment mechanisms of A. actinomycetemcomitans in the oral cavity.

The ability of A. actinomycetemcomitans to bind to epithelial cells has previously been shown 88. Rose, JE; Meyer, DH; Fives-Taylor, PM. Aae, an autotransporter involved in adhesion of Actinobacillus actinomycetemcomitans to epithelial cells. Infect Immun 2003;71:2384-2393.. In this study, the smooth variant (VT1169) showed higher level of binding to KB cells than the aae mutant strain (2-7 bacterial cells/KB cell vs. 1-2 bacterial cells/KB cell, respectively). Hence, the aae- strain exhibited reduced adhesion to KB cells, similar to values obtained in a previous study showing the aae role in adhesion to KB cells 88. Rose, JE; Meyer, DH; Fives-Taylor, PM. Aae, an autotransporter involved in adhesion of Actinobacillus actinomycetemcomitans to epithelial cells. Infect Immun 2003;71:2384-2393.. Additionally to Aae, other adhesins like ApiA, are involved in A. actinomycetemcomitans adhesion to BECs 1010. Yue, G; Kaplan, JB; Furgan, D; Mansfield, KG; Fine, DH. A second Aggregatibacter actinomycetemcomitans autotransporter adhesin exhibits specificity for buccal epithelial cells in humans and Old World primates. Infect Immun 2007;75:4440-4448.,1111. Fine, DH; Velliyagounder, K; Furgang, D; Kaplan, JB. The Actinobacillus actinomycetemcomitans autotransporter adhesin Aae exhibits specificity for buccal epithelial cells from humans and Old World primates. Infect Immun 2005;73:1947-1953.. Residual levels of binding to KB cells found in the aae- mutant strain were thus expected.

A serotype b strain was chosen due to its correlation with aggressive disease, reaching high cell counts in the subgingival biofilm, possibly due to more efficient colonization mechanisms 1919. Yang, HW; Asikainen, S; Doğan, B; Suda, R; Lai, CH. Relationship of Actinobacillus actinomycetemcomitans serotype b to aggressive periodontitis: frequency in pure cultured isolates. J Periodontol 2004;4:592-599..

A smooth strain was chosen because the aggregative phenotype observed in rough variants limits calculation of the number of adherent cells to a substrate 66. Fine, DH; Furgang, D; Schreiner, HC; Goncharoff, P; Charlesworth, J; Ghazwan, G et al... Phenotypic variation in Actinobacillus actinomycetemcomitans during laboratory growth: implications for virulence. Microbiol 145;1999:1335-1347.. The aae locus and the loci encoding other surface proteins, such as apiA and emaA, reside outside the tad colonization island and, although smooth-surfaced A. actinomycetemcomitans variants have little or no fimbriation, they can adhere to epithelial cells and form biofilm 33. Fives-Taylor, PM; Meyer, D; Mintz, K. Characteristics of Actinobacillus actinomycetemcomitans invasion of and adhesion to cultured epithelial cells. Adv Dent Res 1995;9:55-62.,77. Haase, EM; Bonstein, T; Palmer, Jr RJ; Scannapieco, FA. Environmental influences on Actinobacillus actinomycetemcomitans biofilm formation. Arch Oral Biol 2006; 51:299-314..

Although both rough and smooth variants are able to produce biofilm in appropriate growth conditions, rough strains produced towers of microcolonies anchored by a small contact area, whereas smooth strains produced biofilm with a reduced height open architecture 77. Haase, EM; Bonstein, T; Palmer, Jr RJ; Scannapieco, FA. Environmental influences on Actinobacillus actinomycetemcomitans biofilm formation. Arch Oral Biol 2006; 51:299-314.. Since a smooth variant was used, the biofilm studied here was independent from flp-1-mediated fimbriae.

Previous data have demonstrated that aae mutation in a rough strain did not seem to affect the capacity to attach to abiotic surfaces or to form biofilms 11. Fine, DH; Kaplan, JB; Kachlany, SC; Schreiner, HC. How we got attached to Actinobacillus actinomycetemcomitans: a model for infectious diseasesPeriodontol 2000 2006;42:114-157.. The present data using a smooth strain showed that biofilm formation was reduced in aae- null mutant. In smooth variants, its adhesion is mediated by specific non-fimbrial adhesins 99. Ruiz, T; Lenox, C; Radermacher, M; Mintz, KP. Novel surface structures are associated with the adhesion of Actinobacillus actinomycetemcomitans to collagen. Infect Immun 2006;74:6163-6170. and possibly other components, such as poly-N-acetyl-glucosamine (PGA) 2020. Kaplan, JB; Velliyagounder, K; Ragunath, C; Rohde, H; Mack, D; Knobloch, JKM et al.. Genes involved in the synthesis and degradation of matrix polysaccharide in Actinobacillus actinomycetemcomitans and Actinobacillus pleuropneumoniae biofilms. J Bacteriol 2004;186:8213-8220..

Bacterial binding results from a combination of affinity, electrostatic and hydrophobic interactions. Alterations in bacterial hydrophobic properties are expected when changes occur on cell surface protein composition 55. Gibbons, RJ; Etherden, I. Comparative hydrophobicities of oral bacteria and their adherence to salivary pellicles. Infect Immun 1983;41:1190-1196.,2121. Rosenberg, M. Microbial adhesion to hydrocarbons: twenty-five years of doing MATH. FEMS Microbiol Lett 2006;262:129-134.. Thus, surface changes caused by aae interruption resulted in more hydrophilic cells. The decreased biofilm formation observed in the aae null mutant strain may indicate a role of aae in this process, either directly or due to changes in cell wall hydrophobic properties, influencing the cell-cell interaction.

The ability to bind to SHA is greater in rough strains of A. actinomycetemcomitans than in smooth variants 66. Fine, DH; Furgang, D; Schreiner, HC; Goncharoff, P; Charlesworth, J; Ghazwan, G et al... Phenotypic variation in Actinobacillus actinomycetemcomitans during laboratory growth: implications for virulence. Microbiol 145;1999:1335-1347. and addition of saliva to A. actinomycetemcomitans cells reduces adhesion to KB cells 33. Fives-Taylor, PM; Meyer, D; Mintz, K. Characteristics of Actinobacillus actinomycetemcomitans invasion of and adhesion to cultured epithelial cells. Adv Dent Res 1995;9:55-62., indicating that these microorganism surface components interact with salivary proteins. The fimbriae are the main structure involved in biofilm formation in rough variants. However, the addition of polyclonal antiserum against a fimbrial peptide has only partially inhibited the adhesion of smooth variants 2222. Harano, K; Yamanak, A; Okuda, K. An antiserum to a synthetic fimbrial peptide of Actinobacillus actinomycetemcomitans blocked adhesion of the microorganism. FEMS Microbiol Lett. 1995;130:279-285., indicating a role of other surface components. It is currently known that fimbriae, lipopolysaccharide (LPS) and extracellular polymeric substance (EPS) play a role in the biofilm formation of A. actinomycetemcomitans and their expression is up regulated by iron limitation and anaerobiosis 2323. Amarasinghe, JJ; Scannapieco, FA; Haase, EM. Transcriptional and translational analysis of biofilm determinants of Aggregatibacter actinomycetemcomitans in response to environmental perturbation. Infect Immun 2009;77:2896-2907.. Our research groups has previously shown that the transcription of aae is not up-regulated in an anaerobic environment 22. Longo, PL; Nunes, AC; Umeda, JE; Mayer, MP. Gene expression and phenotypic traits of Aggregatibacter actinomycetemcomitans in response to environmental changes. J Periodontal Res. 2013;48:766-772., thus the present results obtained in microaerophilic atmosphere suggest that aae may be important in the adaptation to host environmental changes, such as increases in oxygen concentrations.

Acknowledgements

We thank Dr. Paula Fives-Taylor for donating the plasmids, KB cells and bacterial strains. We also thank Rosana Prisco for the statistical analysis. This study was supported by FAPESP grants 03/11172-5 and 03/08598-0.

References

  • 1
    Fine, DH; Kaplan, JB; Kachlany, SC; Schreiner, HC. How we got attached to Actinobacillus actinomycetemcomitans: a model for infectious diseasesPeriodontol 2000 2006;42:114-157.
  • 2
    Longo, PL; Nunes, AC; Umeda, JE; Mayer, MP. Gene expression and phenotypic traits of Aggregatibacter actinomycetemcomitans in response to environmental changes. J Periodontal Res. 2013;48:766-772.
  • 3
    Fives-Taylor, PM; Meyer, D; Mintz, K. Characteristics of Actinobacillus actinomycetemcomitans invasion of and adhesion to cultured epithelial cells. Adv Dent Res 1995;9:55-62.
  • 4
    Fives-Taylor, PM; Meyer, DH; Mintz, KP; Brissette, C. Virulence factors of Actinobacillus actinomycetemcomitans Periodontol2000 1999;20:136-167.
  • 5
    Gibbons, RJ; Etherden, I. Comparative hydrophobicities of oral bacteria and their adherence to salivary pellicles. Infect Immun 1983;41:1190-1196.
  • 6
    Fine, DH; Furgang, D; Schreiner, HC; Goncharoff, P; Charlesworth, J; Ghazwan, G et al... Phenotypic variation in Actinobacillus actinomycetemcomitans during laboratory growth: implications for virulence. Microbiol 145;1999:1335-1347.
  • 7
    Haase, EM; Bonstein, T; Palmer, Jr RJ; Scannapieco, FA. Environmental influences on Actinobacillus actinomycetemcomitans biofilm formation. Arch Oral Biol 2006; 51:299-314.
  • 8
    Rose, JE; Meyer, DH; Fives-Taylor, PM. Aae, an autotransporter involved in adhesion of Actinobacillus actinomycetemcomitans to epithelial cells. Infect Immun 2003;71:2384-2393.
  • 9
    Ruiz, T; Lenox, C; Radermacher, M; Mintz, KP. Novel surface structures are associated with the adhesion of Actinobacillus actinomycetemcomitans to collagen. Infect Immun 2006;74:6163-6170.
  • 10
    Yue, G; Kaplan, JB; Furgan, D; Mansfield, KG; Fine, DH. A second Aggregatibacter actinomycetemcomitans autotransporter adhesin exhibits specificity for buccal epithelial cells in humans and Old World primates. Infect Immun 2007;75:4440-4448.
  • 11
    Fine, DH; Velliyagounder, K; Furgang, D; Kaplan, JB. The Actinobacillus actinomycetemcomitans autotransporter adhesin Aae exhibits specificity for buccal epithelial cells from humans and Old World primates. Infect Immun 2005;73:1947-1953.
  • 12
    Mintz, KP. Identification of an extracellular matrix protein adhesin, EmaA, which mediates the adhesion of Actinobacillus actinomycetemcomitans to collagen. Microbiology 2004;150:2677-2688.
  • 13
    Henderson, IR; Navarro-Garcia, F; Desvaux, M; Fernandez, RC; Ala'Aldeen, D. Type V protein secretion pathway: the autotransporter story. Microbiol Mol Biol Rev 2004;68:692-744.
  • 14
    Wells ,TJ; Tree, JJ; Ulett ,GC; Schembri, MA. Autotransporter proteins: novel targets at the bacterial cell surface. FEMS Microbiol Lett. 2007;274:163-172.
  • 15
    Fine, DH; Kaplan, JB; Furgang, D; Karched, M; Velliyagounder K; Yue G. Mapping the epithelial-cell-binding domain of the Aggregatibacter actinomycetemcomitans autotransporter adhesion Aae. Microbiology 2010;156:3412-3420.
  • 16
    Fink, DL; Buscher, AZ; Green, B; Fernsten, P. St Geme 3rd JW. The Haemophilus influenzae Hap autotransporter mediates microcolony formation and adherence to epithelial cells and extracellular matrix via binding regions in the C-terminal end of the passenger domain. Cell Microbiol 2003;5:175-186.
  • 17
    Mintz, KP, Fives-Taylor, PM. impA, a gene coding for an inner membrane protein, influences colonial morphology of Actinobacillus actinomycetemcomitans Infect Immun 2000;68:6580-6586.
  • 18
    Meyer, DH; Fives-Taylor, PM. Characteristics of adherence of Actinobacillus actinomycetemcomitans to epithelial cells. Infect Immun 1994;62:928-935.
  • 19
    Yang, HW; Asikainen, S; Doğan, B; Suda, R; Lai, CH. Relationship of Actinobacillus actinomycetemcomitans serotype b to aggressive periodontitis: frequency in pure cultured isolates. J Periodontol 2004;4:592-599.
  • 20
    Kaplan, JB; Velliyagounder, K; Ragunath, C; Rohde, H; Mack, D; Knobloch, JKM et al.. Genes involved in the synthesis and degradation of matrix polysaccharide in Actinobacillus actinomycetemcomitans and Actinobacillus pleuropneumoniae biofilms. J Bacteriol 2004;186:8213-8220.
  • 21
    Rosenberg, M. Microbial adhesion to hydrocarbons: twenty-five years of doing MATH. FEMS Microbiol Lett 2006;262:129-134.
  • 22
    Harano, K; Yamanak, A; Okuda, K. An antiserum to a synthetic fimbrial peptide of Actinobacillus actinomycetemcomitans blocked adhesion of the microorganism. FEMS Microbiol Lett. 1995;130:279-285.
  • 23
    Amarasinghe, JJ; Scannapieco, FA; Haase, EM. Transcriptional and translational analysis of biofilm determinants of Aggregatibacter actinomycetemcomitans in response to environmental perturbation. Infect Immun 2009;77:2896-2907.

Publication Dates

  • Publication in this collection
    May-Jun 2016

History

  • Received
    03 May 2015
  • Accepted
    26 Mar 2016
Fundação Odontológica de Ribeirão Preto Av. do Café, S/N, 14040-904 Ribeirão Preto SP Brasil, Tel.: (55 16) 3602-3982, Fax: (55 16) 3633-0999 - Ribeirão Preto - SP - Brazil
E-mail: bdj@forp.usp.br