Prevalence and molecular analysis of multidrug-resistant <i>Acinetobacter baumannii</i> in the extra-hospital environment in Mthatha, South Africa

Anane A, Yaw; Apalata, Teke; Vasaikar, Sandeep; Okuthe, Grace Emily; Songca, Sandile

doi:10.1016/j.bjid.2019.09.004

Acessibilidade / Reportar erro

Brasil

Brazilian Journal of Infectious Diseases

Español English

Brasil

Español English

sumário « anterior atual seguinte »

Sumário

Original Articles • Braz J Infect Dis 23 (6) • Nov-Dec 2019 • https://doi.org/10.1016/j.bjid.2019.09.004 copy

Prevalence and molecular analysis of multidrug-resistant Acinetobacter baumannii in the extra-hospital environment in Mthatha, South Africa

Authorship SCIMAGO INSTITUTIONS RANKINGS

ABSTRACT

Introduction:

The presence of Acinetobacter baumannii outside hospitals remains unclear. This study aimed to determine the prevalence of multidrug-resistance (MDR) A. baumannii in the extra-hospital environment in Mthatha, South Africa and to investigate the frequency of carbapenemase-encoding genes.

Material and Methods:

From August 2016 to July 2017 a total of 598 abattoir samples and 689 aquatic samples were collected and analyzed presumptively by cultural methods for the presence of A. baumannii using CHROMagar™ Acinetobacter medium. Species identiﬁcation was performed by autoSCAN-4 (Dade Behring Inc., IL) and confirmed by the detection of their intrinsic bla_OXA-51 gene. Confirmed MDR A. baumannii isolates were screened for the presence of carbapenemase-encoding genes, ISAba1 insertion sequence and integrase intI1.

Results:

In total, 248 (19.3%) Acinetobacter species were isolated. Acinetobacter. baumannii was detected in 183 (73.8%) of which 85 (46.4%) and 98 (53.6%) were recovered from abattoir and aquatic respectively. MDR A. baumannii was detected in 56.5% (48/85) abattoir isolates and 53.1% (52/98) aquatic isolates. Isolates showed high resistance to antimicrobials most frequently used to treat Acinetobacter infections such as piperacillin/tazobactam; abattoir (98% of isolates resistant), aquatic (94% of isolates resistant), ceftazidime (84%, 83%), ciprofloxacin (71%, 70%), amikacin (41%, 42%), imipenem (75%, 73%), and meropenem (74%, 71%). All the isolates were susceptible to tigecycline and colistin. All the isolates carried bla_OXA-51-like. The bla_OXA-23 was detected in 32 (66.7%) abattoir isolates and 11 (21.2%) aquatic isolates. The bla_OXA-58-like was positive in 7 (14.6%) and 4 (7.7%) abattoir and aquatic isolates, respectively. Both groups of isolates lacked bla_OXA-24-like, bla_IMP-type, bla_VIM-type, bla_NDM-1, bla_SIM, bla_AmpC, ISAba1 and inI1. Isolates showed high level of Multiple Antibiotic Resistance Index (MARI) ranging from 0.20-0.52.

Conclusion:

Extra-hospital sources such as abattoir and aquatic environments may be a vehicle of spread of MDR A. baumannii strains in the community and hospital settings.

Keywords:
Acinetobacter baumannii; Carbapenemase-encoding genes; Extra-hospital; Multidrug-resistance; ISAba1; intI1

Gene	Oligonucleotide sequence	Fragment size (bp)	Location	References
16SrRNA	F: 5'TTT AAG CGA GGA GGA GG3' R: 5'ATT CTA CCA TCC TCT CCC3'	240	16SrRNA	³²32 Vanbroekhoven K, Ryngaert A, Wattiau P, De Mot R, Springael D. Acinetobacter diversity in environmental samples assessed by 16S rRNA gene PCR‐DGGE fingerprinting. FEMS Microbiol Ecol. 2004;50:37-50.
OXA-23-like	F: 5'GATCGGATTGGAGAACCAGA3' R: 5'ATTTCTGACCGCATTTCCAT3'	501	bla_OXA-23	³³33 Cherkaoui A, Emonet S, Renzi G, Schrenzel J. Characteristics of multidrug-resistant Acinetobacter baumannii strains isolated in Geneva during colonization or infection. Ann Clin Microbiol Antimicrob. 2015;14:1.
OXA-24-like	F: 5'GGTTAGTTG GCC CCC TTA AA3' R: 5'AGTTGAGCGAAAAGGGGATT3'	246	bla_OXA-24	³³33 Cherkaoui A, Emonet S, Renzi G, Schrenzel J. Characteristics of multidrug-resistant Acinetobacter baumannii strains isolated in Geneva during colonization or infection. Ann Clin Microbiol Antimicrob. 2015;14:1.
OXA-51-like	F: 5'TAATGCTTT GATCGG CCT TG3' R: 5'TGGATTGCACTT CAT CTT GG3'	353	bla_OXA-51	³³33 Cherkaoui A, Emonet S, Renzi G, Schrenzel J. Characteristics of multidrug-resistant Acinetobacter baumannii strains isolated in Geneva during colonization or infection. Ann Clin Microbiol Antimicrob. 2015;14:1.
OXA-58-like	F: 5'AAGTATTGGGGCTTGTGCTG-3' R: 5'CCCCTCTGCGCTCTACATAC3'	599	bla_OXA-58	³³33 Cherkaoui A, Emonet S, Renzi G, Schrenzel J. Characteristics of multidrug-resistant Acinetobacter baumannii strains isolated in Geneva during colonization or infection. Ann Clin Microbiol Antimicrob. 2015;14:1.
IMP-1	F: 5'GATGGTATGGTGGCTCTTGT3' R: 5'TTAATTTGCCGGACTTAGGC3'	448	Bla_IMP	³⁴34 Da Silva GJ, Correia M, Vital C, et al. Molecular characterization of blaIMP-5, a new integron-borne metallo-β-lactamase gene from an Acinetobacter baumannii nosocomial isolate in Portugal. FEMS Microbiol Lett. 2002;215:33-9.
NDM-1	F: 5'ATTAGCCGCTGCATTGAT3' R: 5'CATGTCGAGATAGGAAGTG3'	154	bla_NDM	³⁵35 Naas T, Ergani A, Carrër A, Nordmann P. Real-time PCR for detection of NDM-1 carbapenemase genes from spiked stool samples. Antimicrob Agents Chemother. 2011;55:4038-43.
VIM-like	F: 5'ACTCACCCCCATGGAGTTTT3' R: 5'ACGACTGAGCGATTTGTGTG3'	815	bla _VIM	³⁶36 Cardoso O, Leitao R, Figueiredo A, Sousa JC, Duarte A, Peixe LV. Metallo-beta-lactamase VIM-2 in clinical isolates of Pseudomonas aeruginosa from Portugal. Microb Drug Resist. 2002;8:93-7.
SIM-1-like	F: 5'TAATGCTTT GATCGG CCT TG3' R: 5'TGGATTGCACTT CAT CTT GG3'	353	bla _SIM	³³33 Cherkaoui A, Emonet S, Renzi G, Schrenzel J. Characteristics of multidrug-resistant Acinetobacter baumannii strains isolated in Geneva during colonization or infection. Ann Clin Microbiol Antimicrob. 2015;14:1.
AmpC	F: ACAGAGGAGCTAATCATGCG R: GTTCTTTTAAACCATATACC	1243	bla _ampC	³⁷37 Héritier C, Poirel L, Nordmann P. Cephalosporinase over-expression resulting from insertion of ISAba1 in Acinetobacter baumannii. Clin Microbiol Infect. 2006;12:123-30.
ISAba1	F: 5-CACGAATGCAGAAGTTG-3 R: 5-CGACGAATACTATGACAC-3	599	ISAba1	³⁸38 Woodford N, Ellington MJ, Coelho JM, et al. Multiplex PCR for genes encoding prevalent OXA carbapenemases in Acinetobacter spp. Int J Antimicrob Agents. 2006;27:351-3, http://dx.doi.org/10.1016/j.ijantimicag.2006.01.004 . http://dx.doi.org/10.1016/j.ijantimicag....
ISAba1/bla_OXA-23-like	F: AATGATTGGTGACAATGAAG R: ATTTCTGACCGCATTTCCAT	1433	ISAba1/bla _OXA-23	³⁸38 Woodford N, Ellington MJ, Coelho JM, et al. Multiplex PCR for genes encoding prevalent OXA carbapenemases in Acinetobacter spp. Int J Antimicrob Agents. 2006;27:351-3, http://dx.doi.org/10.1016/j.ijantimicag.2006.01.004 . http://dx.doi.org/10.1016/j.ijantimicag....
ISAba1/bla _OXA-51-like	F: AATGATTGGTGACAATGAAG R: TGGATTGCACTTCATCTTGG	1252	ISAba1/bla _OXA-51	³¹31 Turton JF, Ward ME, Woodford N, et al. The role of ISAba1 in expression of OXA carbapenemase genes in Acinetobacter baumannii FEMS. Microbiol Lett. 2006;258:72-7.
intI1	F: 5'CAG TGG ACA TAA GCC TGT TC3' R: 5'CCC GAC GCA TAG ACT GTA3'	160	Integrase gene (intI1)	³⁹39 Koeleman JGM, Stoof J, van der Bijl MW, Vandenbroucke-Grauls CMJE, Savelkoul PHM. Identification of epidemic strains of Acinetobacter baumannii by integrase gene PCR. J Clin Microbiol. 2001;39:8-13.

Acinetobacter species isolated	Total no. of isolates	Abattoir isolates		Aquatic isolates
Acinetobacter species isolated	Total no. of isolates	Source	Number of isolates found	Source	Number of isolates found
A. baumannii	100	Floors	5	Sediment	17
		Doors	1	Water sample	15
		Knives	9	Gills	5
		Saws	7	Intestines	3
		Handling panels	2	Eyes	5
		Slaughter area	4	Skin	7
		Abdomen (Flank)	7
		Thorax (Lateral)	3
		Crutch	2
		Breast (Lateral)	8
		Total	48 (56.5%)	Total	52 (53.1%)
Acinetobacter lwoffii	36	Floors	2	Sediment	5
		Doors	3	Water sample	4
		Knives	3	Gills	2
		Saws	2	Intestines	3
		Handling panels	2	Eyes	1
		Slaughter area	4	Skin	4
		Abdomen (Flank)	1
		Total	17 (20%)	Total	19 (19.4%)
Acinetobacter calcoaceticus	25	Floors	3	Sediment	4
		Doors	4	Water sample	3
		Saws	2	Gills	1
		Handling panels	1	Intestines	2
		Slaughter area	1	Eyes	1
				Skin	3
		Total	11 (12.9%)	Total	14 (14.3%)
Acinetobacter pittii	22	Floors	3	Sediment	4
		Doors	1	Water sample	3
		Handling panels	3	Intestines	4
		Slaughter area	1	Skin	2
		Breast (Lateral)	1
		Total	9 (10. 6%)	Total	13 (13.3%)
Total	183		85		98

Sampling sites	Five antibiotics (n) (%)	Six antibiotics (n) (%)	Seven antibiotics (n) (%)	>Seven antibiotics (n) (%)
Abattoir	2 (4.2%)	10 (20.8%)	5 (10.4%)	31 (64.6%)
Aquatic	7 (13.5%)	21 (40.4%)	6 (11.5%)	18 (34.6%)

Brazilian Society of Infectious Diseases Rua Augusto Viana, SN, 6º., 40110-060 Salvador - Bahia - Brazil, Telefax: (55 71) 3283-8172, Fax: (55 71) 3247-2756 - Salvador - BA - Brazil
E-mail: bjid@bjid.org.br

Acompanhe os números deste periódico no seu leitor de RSS

[1] *Corresponding author. E-mail address: tapalata@wsu.ac.za (T. Apalata).