Antimicrobial susceptibility, virulence determinant carriage and molecular characteristics of Staphylococcus aureus isolates associated with skin and soft tissue infections

ABSTRACT

A better understanding of the antimicrobial susceptibility, carriage of virulence determinants and molecular characteristics of Staphylococcus aureus isolates associated with skin and soft tissue infections (SSTIs) may provide further insights related to clinical outcomes with these infections. From January 2012 to September 2013, a total of 128 non-duplicateS. aureus isolates were recovered from patients with SSTIs. All 128 S. aureus SSTI isolates carried at least five virulence genes tested. Virulence genes detected among at least 70% of all tested isolates included hld (100%), hla (95.3%),icaA (96.9%), clf (99.2%),sdrC (79.7%), sdrD (70.3%), andsdrE (72.7%). The prevalence of MRSA isolates with 10 virulence genes tested (54.4%, 31/56) was significantly higher than that among MSSA isolates (35.2%, 25/71) (p < 0.05). The positive rates of seb, sen, sem, sdrE and pvl among MRSA isolates were significantly higher than among MSSA isolates (p< 0.05). ST7 and ST630 accounting for 10.9% were found to be the predominant STs. The most prevalent spa type was t091 (8.6%). MRSA-ST59-SCCmec IV was the most common clone (12.3%) among MRSA isolates whereas among MSSA isolates the dominant clone was MSSA-ST7 (15.5%). Six main clonal complexes (CCs) were found, including CC5 (52.3%), CC7 (11.7%), CC59 (8.6%), CC88 (6.3%), CC398 (4.7%), and CC121 (3.1%). A higher carriage of seb and sec was found among CC59 isolates. In comparison to CC5 and CC7 isolates, those with the highest carriage rates (>80.0%) of sdrC and sdrD, CC59 isolates had lower prevalence of these two virulence genes. All CC59 isolates were susceptible to gentamicin and trimethoprim/sulfamethoxazole, while CC5 and CC7 isolates had resistance rates to these two antimicrobials of 25.4% and 20.9%, and 40.0% and 40.0%, respectively. The resistance rates for tetracycline, clindamycin, and erythromycin among CC5 isolates were lower than among CC7 and CC59 isolates. In conclusion, the molecular typing of S. aureusSSTI isolates in the present study showed considerable heterogeneity. ST7 and ST630 became prevailing clones. Different S. aureus clones causing SSTIs were associated with specific antimicrobial resistance and virulence gene profiles.

Keywords: Staphylococcus aureus; Skin and soft tissue infections; Molecular characteristic; Virulence genes

Introduction

Staphylococcus aureus, particularly methicillin-resistantS. aureus (MRSA), is an important human pathogen responsible for many infectious diseases including skin and soft tissue infections (SSTIs), foreign-body infections, pneumonia, septic arthritis, endocarditis, osteomyelitis, sepsis, and bloodstream infections in both hospital and community settings. ¹ The ability of this clinically important pathogen to successfully persist within the hosts is largely due to the carriage of a battery of virulence factors which promote adhesion, acquisition of nutrients, and evasion of host immunologic responses. ^2and3 Some S. aureus isolates also produce one or more additional exoproteins, such as toxic shock syndrome toxin-1 (TSST-1), staphylococcal enterotoxins (SEs), exfoliative toxins (ETs), and leukocidins. ^2,3and4 Recently, Panton-Valentine leukocidin (pvl) encoded by two contiguous and cotranscribed genes (lukS-PV andlukF-PV) is an important virulence factor for community-acquired MRSA (CA-MRSA) affecting individuals without apparent risk factors for hospital acquisition. ^5and6S. aureus is the most common bacterial pathogen identified from SSTIs. ⁷ SSTIs caused by MRSA is associated with a high incidence of treatment failure and recurrence.⁸ A better understanding of the antimicrobial susceptibility, carriage of virulence determinants, and molecular characteristics of S. aureusisolates associated with SSTIs may provide further insights related to clinical outcomes of these infections. Molecular typing has proved to be an important tool to investigate MRSA epidemiology. Pulsed-field gel electrophoresis (PFGE) patterns, SCCmec typing, spa typing, and multi-locus sequence typing (MLST) have been proven useful for monitoring the evolutionary process of pandemic MRSA clones. ¹ In China, ST239-MRSA-III is a predominant MRSA clone among adults, while ST59-MRSA-IV is the most prevalent clone among children. ^9and10 In a previous study we investigated the molecular typing of S. aureus isolated from patients with SSTIs at our hospital from December 2002 to June 2008 and found that ST239, ST1018, ST59, ST7, and ST88 were the most prevalent sequence types. ¹¹ A shift of important clones has been observed in several studies. ^12,13and14 A report from China found a rapid change of MRSA over a 15-year period at a tertiary care hospital, when the ST239-MRSA-III-t037 clone was replaced by the emerging ST239-MRSA-III-t030 clone. ¹⁵ Understanding the shift of important clones at the local and international levels is of great significance. To understand the shift of S. aureus clones associated with SSTIs, the present study aimed to investigate the antimicrobial susceptibility, carriage of virulence determinants, and molecular characteristics of S. aureus isolates associated with SSTIs at the hospital in 2012-2013.

Materials and methods

Collection of clinical isolates and S. aureus confirmation

From January 2012 to September 2013, a total of 128 non-duplicate S. aureus isolates (single isolate per patient) were collected at The First Affiliated Hospital of Wenzhou Medical University, China from pus samples of hospitalized patients with SSTIs. Lesions requiring incision and drainage or with spontaneously draining purulent fluid, carbuncles, furuncles, boils, cellulitis with purulent drainage, chronic ulcer, and deep wounds were included.S. aureus isolates from patients with SSTIs with clinical signs and symptoms of infection such as increased white blood cell counts, fever, local redness, swelling, and exudate were considered invasive isolates and included for investigation. Isolates were identified as S. aureus using Gram stain, positive catalase and coagulase test results, and Vitek microbiology analyzer (bioMérieu, Marcy l'Etoile, France).S. aureus ATCC25923 was used as a control strain.

Ethics statement

This study was approved by the Institutional Ethics Review Board of The First Affiliated Hospital of Wenzhou Medical University. All patients provided written informed consent for this study. The written informed consents were also obtained from the next of kin, caretakers, or guardians on behalf of the minors/children enrolled.

Antimicrobial susceptibility testing

S. aureus susceptibility to penicillin (10 units), erythromycin (15 µg), clindamycin (2 µg), rifampicin (5 µg), tetracycline(30 µg), linezolid (30 µg), mupirocin (5 µg), quinupristin/dalfopristin (15 µg), trimethoprim/sulfamethoxazole (1.25/23.75 µg), gentamicin (10 µg), ciprofloxacin (5 µg), Chloramphenicol (30 µg), and nitrofurantoin (300 µg) were determined using disc diffusion test recommended by the Clinical and Laboratory Standards Institute (CLSI).¹⁶ All discs were obtained from Oxoid Ltd. Vancomycin MICs for S. aureus isolates were determined by agar dilution method. Interpretive standards for the antimicrobial susceptibility test and D-test for tested S. aureus isolates were in accordance with the guidelines provided by CLSI. ¹⁶ Susceptibility of S. aureus to mupirocin was determined by disc diffusion, with a zone diameter ≥14 mm on a 5 µg disc indicating susceptibility as described previously. ^17and18S. aureus ATCC 25923 and Escherichia coliATCC25922 were used as reference strains for antimicrobial susceptibility testing.

DNA extraction

S. aureus isolates tested were cultured on blood agar overnight at 35 °C. Then, three to four bacterial colonies were suspended and incubated in 150 µL sterile distilled water with lysostaphin (1 mg/mL) (Sangon, China) at 37 °C for 1 h. Finally, DNA was extracted following the instructions of the Genomic DNA Extraction kit (Sangon, China). The extracted DNA was stored at -20 °C and prepared for PCR detection.

Identification of MRSA isolates and pvl detection

A multiplex PCR protocol was used for simultaneous amplification ofmecA, 16S rRNA, and pvl genes as described previously. ¹⁹ MRSA isolates harbouring mecA were confirmed using MRSA N315 and pvl-positive MRSA isolate identified in our previous study as positive control strains. ²⁰

Detection of virulence genes

Virulence genes, including toxins (sea, seb, sec, sed, seg, seh, sei, sej, seo, sen, sem, edin, hla, hlb, hld, hlg, tst, eta, etb), adhesins (clfA, cna, sdrC, sdrD, andsdrE), icaA and arcA were identified using PCR assays with primers and conditions previously described.^21and22 PCR primers used for PCR assays were shown in Table 1.

Table 1
PCR primers used for PCR assays.

PCR product	Primer description	Primer sequence	Refs.
sea	sea-Upsea-Dn	TTGCAGGGAACAGCTTTAGGCAATC TGGTGTACCACCCGCACATTGA	21
seb	seb-Upseb-Dn	GACATGATGCCTGCACCAGGAGA AACAAATCGTTAAAAACGGCGACACAG	21
sec	sec-Upsec-Dn	CCCTACGCCAGATGAGTTGCACA CGCCTGGTGCAGGCATCATATC	21
sed	sed-Upsed-Dn	GAAAGTGAGCAAGTTGGATAGATTGCGGCTAG CCGCGCTGTATTTTTCCTCCGAGAG	21
see	see-Upsee-Dn	TGCCCTAACGTTGACAACAAGTCCA TCCGTGTAAATAATGCCTTGCCTGAA	21
seg	seg-Upseg-Dn	TGCTCAACCCGATCCTAAATTAGACGA CCTCTTCCTTCAACAGGTGGAGACG	21
seh	seh-Upseh-Dn	CATTCACATCATATGCGAAAGCAGAAG GCACCAATCACCCTTTCCTGTGC	21
sei	sei-Upsei-Dn	TGGAGGGGCCACTTTATCAGGA TCCATATTCTTTGCCTTTACCAGTG	21
sejsemsenseo	sej-Upsej-Dnsem-Upsem-Dnsen-Upsen-Dnseo-Upseo-Dn	CTCCCTGACGTTAACACTACTAATAACCC TATGGTGGAGTAACACTGCATCAAAA CTATTAATCTTTGGGTTAATGGAGAAC TTCAGTTTCGACAGTTTTGTTGTCAT ATGAGATTGTTCTACATAGCTGCAAT AACTCTGCTCCCACTGAAC AGTTTGTGTAAGAAGTCAAGTGTAGA ATCTTTAAATTCAGCAGATATTCCATCTAAC	21 22 22 22
tst	tst-Uptst-Dn	AGCCCTGCTTTTACAAAAGGGGAAAA CCAATAACCACCCGTTTTATCGCTTG	21
eta	eta-Upeta-Dn	CGCTGCGGACATTCCTACATGG TACATGCCCGCCACTTGCTTGT	21
etbhlahlbhldhlg	etb-Upetb-Dnhla-Uphla-Dnhlb-Uphlb-Dnhld-Uphld-Dnhlg-Uphlg-Dn	GAAGCAGCCAAAAACCCATCGAA TGTTGTCCGCCTTTACCACTGTGAA CTGATTACTATCCAAGAAATTCGATTG CTTTCCAGCCTACTTTTTTATCAGT GTGCACTTACTGACAATAGTGC GTTGATGAGTAGCTACCTTCAGT AAGAATTTTTATCTTAATTAAGGAAGGAGTG TTAGTGAATTTGTTCACTGTGTCGA GTCAYAGAGTCCATAATGCATTTAA CACCAAATGTATAGCCTAAAGTG	21 22 22 22 22
sdrC	sdrC-UpsdrC-Dn	CGCATGGCAGTGAATACTGTTGCAGC GAAGTATCAGGGGTGAAACTATCCACAAATTG	21
sdrD	sdrD-UpsdrD-Dn	CCACTGGAAATAAAGTTGAAGTTTCAACTGCC CCTGATTTAACTTTGTCATCAACTGTAATTTGTG	21
sdrE	sdrE-UpsdrE-Dn	GCAGCAGCGCATGACGGTAAAG GTCGCCACCGCCAGTGTCATTA	21
cna	cna-Upcna-Dn	TTCACAAGCTTGGTATCAAGAGCATGG GAGTGCCTTCCCAAACCTTTTGAGC	21
clfA	clfA-UpclfA-Dn	ATTGGCGTGGCTTCAGTGCTTG GCTTGATTGAGTTGTTGCCGGTGT	21
arcA	arcA-UparcA-Dn	CACGTAACTTGCTAGAACGAG GAGCCAGAAGTACGCGAG	21
icaA	icaA-UpicaA-Dn	TCAGACACTTGCTGGCGCAGTC TCACGATTCTCTCCCTCTCTGCCATT	21

S. aureus isolates harbouring virulence genes determined in our previous study were used as positive control strains for detecting virulence genes. ²⁰

SCCmec typing

SCCmec typing of MRSA isolates was performed using a battery of multiplex PCRs as described previously. ²³ MRSA isolates with unanticipated fragments or lacking fragments by multiplex PCR were defined as non-typeable (NT). MRSA NCTC 10442 (SCCmecI), MRSA N315 (SCCmec II), MRSA 85/2082 (SCCmec III), MRSA JCSC 4744 (SCCmecIV), and MRSA WZ153 (SCCmec V) were used as control strains for SCCmec typing.

spa typing

The spa variable repeat region from each S. aureus isolate was amplified using simplex PCR oligonucleotide primers as previously described. ^24and25 Following their purification and sequencing, spa types were assigned using the spa database website (http://www.ridom.de/spaserver).

Multi-locus sequence typing (MLST)

MLST typing of S. aureus isolates was performed using amplification of internal fragments of the seven housekeeping genes ofS. aureus as described previously. ²⁶ Following purification and sequencing of these genes, the sequences were compared with the existing sequences available on the MLST website forS. aureus (http://saureus.mlst.net), and STs were determined according to the allelic profiles. Novel STs were deposited in the MLST database (http://saureus.mlst.net/).

Statistical analysis

Differences between groups were assessed by using the chi-square test. The software SPSS 13.0 was used to perform calculations. p-Values of <0.05 were considered statistically significant.

Results and discussion

Antimicrobial susceptibility

Among 128 S. aureus isolates, 57 (44.5%) were identified as MRSA determined by cefoxitin disc diffusion test and were positive formecA. The MRSA prevalence in the present study was lower than the 54.1% reported between December 2002 and June 2008. ¹¹ The resistance rates for S. aureus, MRSA, and MSSA isolates to antimicrobials are listed in Table 2. All isolates tested were susceptible to vancomycin, linezolid, dalfopristin/quinupristin, and nitrofurantoin. Of 128 S. aureusisolates, 72.7% (93/128) with resistance to three or more classes of antimicrobial agents tested were defined as multidrug-resistant isolates. Only two isolates tested were susceptible to all antimicrobial agents tested. Twenty-three (18.0%) isolates were only resistant to penicillin. Ten (7.8%) isolates were concomitantly resistant to two antimicrobial agents tested (penicillin and another antimicrobial agent). Resistance rates of S. aureus, MRSA, and MSSA isolates to penicillin, clindamycin, and gentamicin were above 60%, whereas to tetracycline, gentamicin, ciprofloxacin, trimethoprim/sulfamethoxazole, chloramphenicol and rifampicin were less than 40%. Three isolates were positive for D-test, indicating that resistance of these isolates to clindamycin was inducible. Only one MRSA isolate was resistant to mupirocin as it exhibited no zone of inhibition.

Table 2
Antimicrobial resistance profiles of MRSA, MSSA, and S. aureus isolates.

	MRSA (n = 57) R (%)	MSSA (n = 71) R (%)	S. aureus (n = 128)R (%)
Tetracycline	36.8	28.2	32.0
Gentamicin	31.6	14.1	21.9
Penicillin	96.5	97.2	96.9
Oxacillin	100	0.0	44.5
Clindamycin	71.9	66.2	68.8
Erythromycin	71.9	67.6	69.5
Ciprofloxacin	36.8	15.5	25.0
Linezolid	0	0	0
Rifampicin	10.5	0	4.7
Trimethoprim/sulfamethoxazole	28.1	19.7	23.4
Nitrofurantoin	0	0	0
Cefaclor	40.4	1.4	18.8
Chloroamphenicol	15.8	5.6	10.2
Imipenem	17.5	0	7.8
Mupirocin	1.8	0	0.8
Dalfopristin/quinupristin	0	0	0
Vancomycin	0	0	0

Virulence gene profiling

The invasiveness of S. aureus largely depends on the carriage of a battery of virulence factors. ^2and3 All S. aureus SSTI isolates in the present study harboured at least five virulence genes tested. Frequencies of virulence genes are shown in Table 3. Virulence genes were detected among at least 70% of all tested isolates includedhld (100%), hla (95.3%),icaA (96.9%), clf (99.2%),sdrC (79.7%), sdrD (70.3%), andsdrE (72.7%). Less than 10% of the isolates tested carriedeta (7.0%), sed (6.3%),seh (7.0%), tst (4.7%), and edin (5.5%). Multiple isolates harboured pvl (12.5%), sea(35.9%), seb (14.8%), sec (21.1%),sei (21.1%), seg (26.6%),sem (30.5%), sen (31.3%),seo (27.3%), hlb (22.7%),hlg (18.8%), and cna (32.0%). AllS. aureus isolates tested were negative for sej, etb, and arcA. Fifty-six (43.75%, 56/128) isolates harboured more than 10 tested virulence genes, among which two isolates harboured 16 genes, seven isolates 14 genes, 13 isolates 13 genes, six isolates 12 genes, 10 isolates 11 genes, and 18 isolates 10 genes. Of MRSA isolates, 54.4% (31/56) harboured more than 10 tested virulence genes, which was significantly higher than that among MSSA isolates (35.2%, 25/71) (p < 0.05).

Table 3
The frequencies of virulence genes among S. aureus, MRSA and MSSA isolates.

	S. aureus (n = 128) (%)	MRSA (n = 57) (%)	MSSA (n = 71) (%)	p-valuesa
sea	35.9	42.1	31.0	>0.05
seb	14.8	21.1	9.9	<0.05
sec	21.1	21.1	21.1
sed	6.3	1.8	9.9	>0.05
seg	26.6	31.6	22.5	>0.05
seh	7.0	3.5	9.9	>0.05
sei	21.1	21.1	21.1
sej	0	0	0
sen	31.3	43.9	21.1	<0.05
sem	30.5	43.9	19.7	<0.05
seo	27.3	26.3	28.2	>0.05
tst	4.7	5.3	4.2	>0.05
eta	7.0	1.8	11.3	>0.05
etb	0	0	0
clfA	99.2	98.2	100	>0.05
cna	32.0	26.3	36.6	>0.05
sdrC	79.7	89.5	71.8	>0.05
sdrD	70.3	70.2	70.4	>0.05
sdrE	72.7	80.7	66.2	<0.05
icaA	96.9	96.5	97.2	>0.05
arcA	0	0	0
pvl	12.5	15.8	9.9	<0.05
hla	95.3	100	91.5	>0.05
hlb	22.7	26.3	19.7	>0.05
hld	100	100	100
hlg	18.8	17.5	19.7	>0.05
edin	5.5	0	9.9	>0.05

• ^a
  MRSA group was compared with MSSA group.

Staphylococcal enterotoxins (SEs), including five major classical antigenic types of SEs (SEA to SEE) and newly identified SEs are the cause of food poisoning in humans.²⁷ Additionally, SEs are also associated with other diseases such as allergy sensitization, asthma, chronic obstructive pulmonary disease, scarlet fever, glomerulonephritis, and vasculitis.^{28,29,30and31} The genes encoding these SEs but sej were found amongS. aureus SSTI isolates, with different carriage proportions ranging from 6.3% to 35.9% in this investigation. In particular, the positive rates for seb, sen, and sem among MRSA isolates were significantly higher than among MSSA isolates (p < 0.05). The Sdr proteins encoded by the tandemly arrayed sdrC, sdrD, and sdrE are microbial surface components which recognize adhesive matrix molecules and have different roles in S. aureus pathogenicity. ³² Strong correlations between S. aureus invasiveness and the presence of one of the allelic variants of the sdrE gene, as well as carriage of the sdrD gene and bone infections caused by S. aureus, have been reported previously. ^33and34 Our previous study showed that 95.5% (85/89) of S. aureus isolates responsible for bloodstream infection harboured at least one sdr locus and 84.3% (75/89) possessed more than twosdr loci. ³⁵ Similarly, 120 (93.8%) of 128 SSTI isolates in the present study were found to harbour at least one sdr locus (sdrC, sdrD, or sdrE), with 18 (14.1%), 39 (30.5%), and 63 (49.2%) harbouring one, two, or three of these loci, respectively. The positive rate ofsdrE among MRSA isolates was significantly higher than among MSSA isolates. S. aureus isolates producing TSST-1 encoded by the tst gene have been associated with toxic shock syndrome, staphylococcal scarlet fever, and neonatal toxic shock-like exanthematous diseases. ³ However, the present study found that only 4.7% of S. aureus SSTI isolates harboured tst. Our previous study found that the prevalence of hlb among S. aureus isolates associated with bloodstream infection was 67.4%.³⁵ However, hlb was only identified among 22.7% ofS. aureus SSTI isolates, while the positivity rates ofhla and hld were 95.3% and 100%, respectively.

pvl has been closely associated with CA-MRSA infections and there is a strong epidemiological association between carriage ofpvl genes and successful CA-MRSA lineages. ^1and36 Infections caused by pvl-positive S. aureus isolates are predominantly represented by skin and soft-tissue infection. ^5and6 Among S. aureus isolates causing SSTI in our hospital between December 2002 and June 2008, the overall positivity rates ofpvl genes 23.4% (26/111), and among MRSA and MSSA isolates the rates were, 21.7% (13/60) and 25.5% (13/51), respectively. ¹¹ Compared with our previous study, the overall positivity rates ofpvl genes in the present study (12.5%) was lower, as were the rates among MRSA (15.8%) and MSSA (9.9%) isolates, indicating that there is a decreased trend in the prevalence of pvl genes amongS. aureus SSTI isolates at our hospital.

Molecular typing

Molecular typing of S. aureus isolates tested are shown in Table 4. Among 57 MRSA isolates, 24, 14, 13, and three harboured SCCmec types III, IV, II, and V, respectively. Three isolates were classified as non-typeable.

Table 4
Molecular characteristics of S. aureus SSTIs isolates.

CC (no.)	STs (no.)	spa types (no.)	MRSA (no.)	MSSA (no.)	SCCmec (no.)
5 (60)	ST630 (14)	t377 (7)	2	5	III (2)
		t4047 (2)		2
		t030 (1)	1		III
		t4549 (1)		1
		t4047 (2)	2		II (1), IV (1)
		t5554 (1)		1
	ST5 (8)	t2460 (2)	2		II (2)
		t311 (2)	2		II (2)
		t4352 (1)	1		II
		t002 (1)		1
		t548 (1)		1
		t535 (1)		1
	ST965 (7)	t062 (7)	7		III (4), II (2), NT (1)
	ST25 (6)	t349 (2)		2
		t227 (2)	2		III (2)
		t8170 (1)		1
		t078 (1)		1
	ST188 (5)	t189 (4)	1	3	II
		t1858 (1)	1		III
	ST239 (4)	t030 (3)	3		III (3)
		t2270 (1)	1		III (1)
	ST6 (4)	t701 (3)		3
		t10519 (1)	1		III
	ST1462 (3)	t189 (3)		3
	ST1821 (3)	t377 (1)		1
		t2196 (1)		1
		t4549 (1)	1		II
	ST8 (2)	t008 (1)		1
		t377 (1)		1
	ST15 (1)	t062		1
	ST118 (1)	t189 (1)		1
	ST1920 (1)	t286 (1)		1
	ST72 (1)	t148		1
	ST1 (7)	t127 (7)	2	5	III (2)
7 (15)	ST7 (14)	t091 (8)	2	6	III (2)
		t796 (5)		5
		t2828 (1)	1		IV
	ST789 (1)	t091 (1)	1		III
59 (11)	ST59 (11)	t437 (8)	7	1	IV (6), V (1)
		t163 (3)	2	1	IV (1), NT (1)
88 (8)	ST88 (8)	t5348 (3)	1	2	IV
		t1764 (1)	1		II
		t5351 (1)		1
		t2788 (1)		1
		t7637	1		V
		t1376	1		IV
398 (6)	ST398 (6)	t571 (4)	1	3	IV
		t011 (1)		1
		t034 (1)		1
121 (4)	ST121 (4)	t159 (3)	2	1	III (1), IV (1)
		t2091 (1)		1

A total of 28 STs were identified among 128 S. aureus isolates. ST7 and ST630 accounting for 10.9% (14/128 each) were found to be the predominant STs, followed by ST59 (8.6%, 11/128), ST5 (6.3%, 8/128), ST88 (6.3%, 8/128), ST1 (5.5%, 7/128), ST965 (5.5%, 7/128), ST398 (4.7%, 6/128 each), ST25 (4.7%, 6/128), and ST188 (3.9%, 5/128). ST239, ST6, and ST121 accounted for four isolates each. ST1463 and ST1821 accounted for three isolates each. ST8 and ST1349 accounted for two isolates each. The remaining STs including ST12, ST15, ST118, ST692, ST789, ST1281, ST1920, ST2259, ST2832, ST2833, and ST72 were identified in only one isolate. The STs of nine isolates were not identified. Two novel STs characterized as ST2832 and 2833 were identified in two MRSA isolates and have been deposited in the MLST database (http://saureus.mlst.net/). Sixteen PVL-positive isolates were distributed among nine different STs including ST88 (five isolates), ST59 (three isolates), and ST121 (two isolates). ST239 and ST5 were the most dominant STs in China. ^9and37 Interestingly, in the present study, these two predominant STs were found to be minor clones, while ST630 and ST7, seldom noted in Chinese isolates previously, were the major clones among S. aureus SSTI isolates. Another study from China found ST398 accounting for 17.1% (28/164) as the most common ST among S. aureus SSTI isolates. ³⁸ In contrast to our previous study where ST239 was the most prevalent ST accounting for 21.6% (24/111) of S. aureus SSTI isolates, ¹¹ this ST accounted for only 3.1% (4/128) in the present study. Interestingly, ST630 not found in our previous study turned out to be the predominant ST in the present study, while ST1018, the second most prevalent ST in our previous study, was not found.

Fifty-two spa types were identified among the 128 isolates. The most prevalent spa type was t091 (8.6%, 11/128), followed by t062 (7.0%, 9/128), t377 (7.0%, 9/128), t437 (7.0%, 9/128), t189 (6.3%, 8/128), t127 (4.7%, 6/128), t796 (3.9%, 4/128), t571 (3.1%, 3/128), t4047 (3.1%, 3/128), and t030 (3.1%, 3/128). Other types identified includedt159, t163, t5348, andt701 (three isolates each). In previous reports of Chinese isolates, t30 and t37, typically associated with ST239, were the most prevalent spa types. ^9and15 The proportions of t37 and t30 were extremely low, as well as the proportions of ST239 and ST5 in the present study.

Fifty-seven MRSA isolates were distributed in different clones. 12.3% (7/57) of MRSA isolates belonged to MRSA-ST59-SCCmecIV-t 437/163, which was the most common clone in the present study. Likewise, in a study from China ST59-MRSA-IVa-t437 was found to be the predominant clone among CA-MRSA isolates associated with SSTIs in children. ³⁹ Our previous study conducted between December 2002 and June 2008 found that ST239-MRSA-SCCmec III accounting for 30.2% (19/63) was the most prevalent clone among MRSA SSTI isolates, followed by ST1018-MRSA-SCCmecIII accounting for 15.9% (10/63). ¹¹ However, only three MRSA isolates were ST239-MRSA-SCCmec III and there was no ST1018-MRSA-SCCmecIII isolate in the present study. Among 71 MSSA isolates, the dominant clone was MSSA-ST7 (15.5%, 11/71), followed by MSSA-ST630 (12.7%, 9/71), MSSA-ST398 and MSSA-ST1 (7.0%, 5/71 each), and MSSA-ST25 and MSSA-ST88 (5.6%, 4/71 each). MRSA-ST398 isolates are usually associated with infections in both animals and humans. ^40and41 ST398 MSSA isolates of human origin are usually linked tot571. ⁴² In the present study, four of six ST-398 S. aureus isolates, including three MSSA and one MRSA isolate, were linked to t571.

Taken together, our data showed that S. aureus isolates associated with SSTIs were genetically diverse and the main clones associated with SSTIs are going through a rapid shift in our hospital.

Comparison of antimicrobial resistance and molecular typing among the major clonal complexes (CCs)

Clustering analysis by eBURST v3 showed that six clonal complexes (CCs) were found (Table 4), including CC5 (52.3%, 67/128), CC7 (11.7%, 15/128), CC59 (8.6%, 11/128), CC88 (6.3%, 8/128), and CC398 (4.7%, 6/128). The distribution of some virulence genes, especially enterotoxin genes, were correlated with different MRSA lineages.^43and44 In the present study, a higher carriage of seb andsec was found among CC59 isolates, while a higher carriage of enterotoxin genes were found among CC5 isolates ( Table 5). All CC7 and CC59 isolates were not carryingseh and seo, while 11.8% and 34.2% of CC5 isolates were found to carry these two genes, respectively. Although the proportions of seb and sec among CC5 and CC7 isolates were low, the positivity rates of these two enterotoxin genes among CC59 isolates were 54.5% (seb) and 63.6% (sec). The prevalence of cna among CC5 isolates was 38.8%, while this virulence gene was identified in none of the CC7 and CC59 isolates. Compared with the higher carriage rates (>80.0%) ofsdrC and sdrD among CC5 and CC7 isolates, the positivity rates of two sdr loci were significantly lower among CC59 isolates, especially sdrD prevalence of 9.1%. Interestingly, all CC59 isolates carried sdrE, while only 26.7% of CC7 isolates were found to carry sdrE. The carriage rates ofpvl and hlb among CC59 isolates were significantly higher than those rates among CC5 and CC7 isolates (p < 0.05). These differences in carriage rates of virulence genes among different CC isolates suggested that different S. aureus lineages associated with SSTIs have specific patterns of virulence genes.

Table 5
Specific antimicrobial resistance and virulence gene profiles of major CCs.

	CC5 (n = 67) (%)	CC7 (n = 15) (%)	CC59 (n = 11) (%)
Virulence genes
sea	37.3	23.3	27.3
seb	7.5	13.3	54.5
sec	19.4	0	63.6
sed	10.4	6.7	0
seg	34.3	0	27.3
seh	11.8	0	0
sei	29.8	6.7	0
sen	44.8	6.7	27.3
sem	40.3	6.7	9.1
seo	34.3	0	0
tst	7.5	0	0
eta	9	6.7	9.1
clfA	100	100	100
cna	38.8	0	0
sdrC	89.6	93.3	54.5
sdrD	82.1	100	9.1
sdrE	82.1	26.7	100
icaA	95.5	100	100
pvl	4.5	0	27.3
hla	91.0	93.3	100
hlb	26.9	0	45.5
hld	100	100	100
hlg	10.4	13.3	27.3
edin	4.5	0	0
Antimicrobial agents
MRSA	43.3	26.7	81.8
Tetracycline	25.4	66.7	45.5
Gentamycin	25.4	40.0	0
Penicillin	97	93.3	100
Clindamycin	59.7	73.3	81.8
Erythromycin	62.7	73.3	81.8
Ciprofloxacin	35.8	6.7	18.2
Rifampicin	7.5	0	0
Trimethoprim/sulfamethoxazole	20.9	40	0
Chloroamphenicol	9.0	0	27.3
Mupirocin	0	6.7	0

The predominant MRSA clones in China were associated with specific antimicrobial resistance profiles.⁴⁵ In the present study, although 81.8% of CC59 isolates were MRSA, all isolates were susceptible to gentamicin, rifampicin, and trimethoprim/sulfamethoxazole (Table 5). However, the resistance rates for gentamicin and trimethoprim/sulfamethoxazole were respectively 25.4% and 20.9% among CC5 isolates, and 40.0% and 40.0% among CC7 isolates (Table 5). The resistance rates for tetracycline, clindamycin, and erythromycin among CC5 isolates were relatively lower relative to CC7 and CC59 isolates (Table 5). As the prevalence of MRSA among CC7 isolates was lower than CC5 and CC59 isolates, the resistance rates of some antimicrobial agents among CC7 isolates were lower than other CC isolates, such as ciprofloxacin and chloramphenicol. However, only one isolate with resistance to mupirocin in this investigation belonged to CC7.

In conclusion, the molecular characteristic of S. aureus SSTI isolates in the present study showed considerable heterogeneity and ST7 and ST630 were the prevalent clones. Different S. aureus clones causing SSTIs were associated with specific antimicrobial resistance and virulence gene profiles.

Acknowledgements

This study was supported by grants from Natural Science Fund of China (81271906H2002), Medical Science Fund of Zhejiang Province, China (2012RCA041) and Wenzhou Municipal Science and Technology Bureau, China (Y20130239).

References

• ¹ David MZ, Daum RS. Community-associated methicillin- resistant Staphylococcus aureus: epidemiology and clinical consequences of an emerging epidemic. Clin Microbiol Rev. 2010;23:616-87.
• ² Bubeck Wardenburg J, Patel RJ, Schneewind O. Surface proteins and exotoxins are required for the pathogenesis of Staphylococcus aureus pneumonia. Infect Immun. 2007;75:1040-4.
• ³ Dinges MM, Orwin PM, Schlievert PM. Exotoxins of Staphylococcus aureus. Clin Microbiol Rev. 2000;13:16-34.
• ⁴ Bunikowski R, Mielke ME, Skarabis H, et al. Evidence for a disease-promoting effect of Staphylococcus aureus- derived exotoxins in atopic dermatitis. J Allergy Clin Immunol. 2000;105:814-9.
• ⁵ Gillet Y, Issartel B, Vanhems P, et al. Association between Staphylococcus aureus strains carrying gene for Panton- Valentine leukocidin and highly lethal necrotising pneumonia in young immunocompetent patients. Lancet. 2002;359:753-9.
• ⁶ Francis JS, Doherty MC, Lopatin U, et al. Severe community-onset pneumonia in healthy adults caused by methicillin- resistant Staphylococcus aureus carrying the Panton- Valentine leukocidin genes. Clin Infect Dis. 2005;40:100-7.
• ⁷ Ray GT, Suaya JA, Baxter R. Incidence, microbiology, and patient characteristics of skin and soft-tissue infections in a U.S. population: a retrospective population-based study. BMC Infect Dis. 2013;13:252.
• ⁸ Labreche MJ, Lee GC, Attridge RT, et al. Treatment failure and costs in patients with methicillin- resistant Staphylococcus aureus (MRSA) skin and soft tissue infections: a South Texas Ambulatory Research Network (STARNet) study. J Am Board Fam Med. 2013;26:508-17.
• ⁹ Liu Y, Wang H, Du N, et al. Molecular evidence for spread of two major methicillin- resistant Staphylococcus aureus clones with a unique geographic distribution in Chinese hospitals. Antimicrob Agents Chemother. 2009;53:512-8.
• ¹⁰ Geng W, Yang Y, Wu D, et al. Community-acquired, methicillin- resistant Staphylococcus aureus isolated from children with community-onset pneumonia in China. Pediatr Pulmonol. 2010;45:387-94.
• ¹¹ Yao D, Yu FY, Qin ZQ, et al. Molecular characterization of Staphylococcus aureus isolates causing skin and soft tissue infections (SSTIs). BMC Infect Dis. 2010;10:133.
• ¹² Aires-de-Sousa M, Correia B, de Lencastre H. Changing patterns in frequency of recovery of five methicillin- resistant Staphylococcus aureus clones in Portuguese hospitals: surveillance over a 16 -year period. J Clin Microbiol. 2008;46:2912-7.
• ¹³ Sola C, Cortes P, Saka HA, et al. Evolution and molecular characterization of methicillin- resistant Staphylococcus aureus epidemic and sporadic clones in Cordoba, Argentina. J Clin Microbiol. 2006;44:192-200.
• ¹⁴ Conceicao T, Aires-de-Sousa M, Fuzi M, et al. Replacement of methicillin- resistant Staphylococcus aureus clones in Hungary over time: a 10 -year surveillance study. Clin Microbiol Infect. 2007;13:971-9.
• ¹⁵ Chen H, Liu Y, Jiang X, et al. Rapid change of methicillin- resistant Staphylococcus aureus clones in a Chinese tertiary care hospital over a 15 -year period. Antimicrob Agents Chemother. 2010;54:1842-7.
• ¹⁶ CLSI. Performance standards for antimicrobial susceptibility testing, 18th informational supplement (M100-S22). Wayne, PA, USA: Clinical and Laboratory Standards Institute; 2012.
• ¹⁷ Fuchs PC, Jones RN, Barry AL. Interpretive criteria for disk diffusion susceptibility testing of mupirocin, a topical antibiotic. J Clin Microbiol. 1990;28:608-9.
• ¹⁸ Anthony RM, Connor AM, Power EG, et al. Use of the polymerase chain reaction for rapid detection of high-level mupirocin resistance in staphylococci. Eur J Clin Microbiol Infect Dis. 1999;18:30-4.
• ¹⁹ McClure JA, Conly JM, Lau V, et al. Novel multiplex PCR assay for detection of the staphylococcal virulence marker Panton- Valentine leukocidin genes and simultaneous discrimination of methicillin- susceptible from - resistant staphylococci. J Clin Microbiol. 2006;44:1141-4.
• ²⁰ Yu F, Yang L, Pan J, et al. Prevalence of virulence genes among invasive and colonising Staphylococcus aureus isolates. J Hosp Infect. 2011;77:89-91.
• ²¹ Campbell SJ, Deshmukh HS, Nelson CL, et al. Genotypic characteristics of Staphylococcus aureus isolates from a multinational trial of complicated skin and skin structure infections. J Clin Microbiol. 2008;46:678-84.
• ²² Jarraud S, Mougel C, Thioulouse J, et al. Relationships between Staphylococcus aureus genetic background, virulence factors, agr groups (alleles), and human disease. Infect Immun. 2002;70:631-41.
• ²³ Kondo Y, Ito T, Ma XX, et al. Combination of multiplex PCRs for staphylococcal cassette chromosome mec type assignment: rapid identification system for mec, ccr, and major differences in junkyard regions. Antimicrob Agents Chemother. 2007;51:264-74.
• ²⁴ Koreen L, Ramaswamy SV, Graviss EA, et al. spa typing method for discriminating among Staphylococcus aureus isolates: implications for use of a single marker to detect genetic micro- and macrovariation. J Clin Microbiol. 2004;42:792-9.
• ²⁵ Harmsen D, Claus H, Witte W, et al. Typing of methicillin- resistant Staphylococcus aureus in a university hospital setting by using novel software for spa repeat determination and database management. J Clin Microbiol. 2003;41:5442-8.
• ²⁶ Enright MC, Day NP, Davies CE, et al. Multilocus sequence typing for characterization of methicillin- resistant and methicillin- susceptible clones of Staphylococcus aureus. J Clin Microbiol. 2000;38:1008-15.
• ²⁷ Thomas D, Chou S, Dauwalder O, et al. Diversity in Staphylococcus aureus enterotoxins. Chem Immunol Allergy. 2007;93:24-41.
• ²⁸ Semic- Jusufagic A, Bachert C, Gevaert P, et al. Staphylococcus aureus sensitization and allergic disease in early childhood: population-based birth cohort study. J Allergy Clin Immunol. 2007;119:930-6.
• ²⁹ Bachert C, Gevaert P, Zhang N, et al. Role of staphylococcal superantigens in airway disease. Chem Immunol Allergy. 2007;93:214-36.
• ³⁰ Wang CC, Lo WT, Hsu CF, et al. Enterotoxin B is the predominant toxin involved in staphylococcal scarlet fever in Taiwan. Clin Infect Dis. 2004;38:1498-502.
• ³¹ Koyama A, Kobayashi M, Yamaguchi N, et al. Glomerulonephritis associated with MRSA infection: a possible role of bacterial superantigen. Kidney Int. 1995;47:207-16.
• ³² Josefsson E, McCrea KW, Ni Eidhin D, et al. Three new members of the serine-aspartate repeat protein multigene family of Staphylococcus aureus. Microbiology. 1998;144 Pt 12:3387-95.
• ³³ Peacock SJ, Moore CE, Justice A, et al. Virulent combinations of adhesin and toxin genes in natural populations of Staphylococcus aureus. Infect Immun. 2002;70:4987-96.
• ³⁴ Trad S, Allignet J, Frangeul L, et al. DNA macroarray for identification and typing of Staphylococcus aureus isolates. J Clin Microbiol. 2004;42:2054-64.
• ³⁵ Yu F, Li T, Huang X, et al. Virulence gene profiling and molecular characterization of hospital-acquired Staphylococcus aureus isolates associated with bloodstream infection. Diagn Microbiol Infect Dis. 2012;74:363-8.
• ³⁶ Rasigade JP, Laurent F, Lina G, et al. Global distribution and evolution of Panton- Valentine leukocidin-positive methicillin- susceptible Staphylococcus aureus, 1981-2007. J Infect Dis. 2010;201:1589-97.
• ³⁷ Zhang W, Shen X, Zhang H, et al. Molecular epidemiological analysis of methicillin- resistant Staphylococcus aureus isolates from Chinese pediatric patients. Eur J Clin Microbiol Infect Dis. 2009;28:861-4.
• ³⁸ Zhao C, Liu Y, Zhao M, et al. Characterization of community acquired Staphylococcus aureus associated with skin and soft tissue infection in Beijing: high prevalence of PVL+ ST398. PLoS ONE. 2012;7:e38577.
• ³⁹ Wu D, Wang Q, Yang Y, et al. Epidemiology and molecular characteristics of community-associated methicillin- resistant and methicillin- susceptible Staphylococcus aureus from skin/soft tissue infections in a children&apos;s hospital in Beijing, China. Diagn Microbiol Infect Dis. 2010;67:1-8.
• ⁴⁰ van Duijkeren E, Ikawaty R, Broekhuizen-Stins MJ, et al. Transmission of methicillin- resistant Staphylococcus aureus strains between different kinds of pig farms. Vet Microbiol. 2008;126:383-9.
• ⁴¹ Pan A, Battisti A, Zoncada A, et al. Community-acquired methicillin- resistant Staphylococcus aureus ST398 infection, Italy. Emerg Infect Dis. 2009;15:845-7.
• ⁴² David MZ, Siegel J, Lowy FD, et al. Asymptomatic carriage of sequence type 398, spa type t571 methicillin- susceptible Staphylococcus aureus in an urban jail: a newly emerging, transmissible pathogenic strain. J Clin Microbiol. 2013;51:2443-7.
• ⁴³ Diep BA, Carleton HA, Chang RF, et al. Roles of 34 virulence genes in the evolution of hospital- and community-associated strains of methicillin- resistant Staphylococcus aureus. J Infect Dis. 2006;193:1495-503.
• ⁴⁴ Kim T, Yi J, Hong KH, et al. Distribution of virulence genes in spa types of methicillin- resistant Staphylococcus aureus isolated from patients in intensive care units. Korean J Lab Med. 2011;31:30-6.
• ⁴⁵ Cheng H, Yuan W, Zeng F, et al. Molecular and phenotypic evidence for the spread of three major methicillin- resistant Staphylococcus aureus clones associated with two characteristic antimicrobial resistance profiles in China. J Antimicrob Chemother. 2013;68:2453-7.

Publication Dates

• Publication in this collection
  Dec 2015

History

• Received
  21 May 2015
• Accepted
  10 Aug 2015