The expression patterns of MALAT-1, NEAT-1, THRIL, and miR-155-5p in the acute to the post-acute phase of COVID-19 disease

Abbasi-Kolli, Mohammad; Nahand, Javid Sadri; Kiani, Seyed Jalal; Khanaliha, Khadijeh; Khatami, Ali Reza; Taghizadieh, Mohammad; Torkamani, Ali Rajabi; Babakhaniyan, Kimiya; Bokharaei-Salim, Farah

doi:10.1016/j.bjid.2022.102354

Acessibilidade / Reportar erro

Brasil

Brazilian Journal of Infectious Diseases

Español English

Brasil

Español English

sumário « anterior atual seguinte »

Sumário

Original Article • Braz J Infect Dis 26 (3) • 2022 • https://doi.org/10.1016/j.bjid.2022.102354 copy

The expression patterns of MALAT-1, NEAT-1, THRIL, and miR-155-5p in the acute to the post-acute phase of COVID-19 disease

Authorship SCIMAGO INSTITUTIONS RANKINGS

ABSTRACT

Introduction:

One of the hallmarks of COVID-19 is overwhelming inflammation, which plays a very important role in the pathogenesis of COVID-19. Thus, identification of inflammatory factors that interact with the SARS-CoV-2 can be very important to control and diagnose the severity of COVID-19. The aim of this study was to investigate the expression patterns of inflammation-related non-coding RNAs (ncRNAs) including MALAT-1, NEAT-1, THRIL, and miR-155-5p from the acute phase to the recovery phase of COVID-19.

Methods:

Total RNA was extracted from Peripheral Blood Mononuclear Cell (PBMC) samples of 20 patients with acute COVID-19 infection and 20 healthy individuals and the expression levels of MALAT-1, NEAT-1, THRIL, and miR-155-5p were evaluated by real-time PCR assay. Besides, in order to monitor the expression pattern of selected ncRNAs from the acute phase to the recovery phase of COVID-19 disease, the levels of ncRNAs were re-measured 6–7 weeks after the acute phase.

Result:

The mean expression levels of MALAT-1, THRIL, and miR-155-5p were significantly increased in the acute phase of COVID-19 compared with a healthy control group. In addition, the expression levels of MALAT-1 and THRIL in the post-acute phase of COVID-19 were significantly lower than in the acute phase of COVID-19. According to the ROC curve analysis, these ncRNAs could be considered useful biomarkers for COVID-19 diagnosis and for discriminating between acute and post-acute phase of COVID-19.

Discussion:

Inflammation-related ncRNAs (MALAT-1, THRIL, and miR-150-5p) can act as hopeful biomarkers for the monitoring and diagnosis of COVID-19 disease.

Keywords:
COVID-19; Long non-coding RNAs; MicroRNAs; Inflammation; Biomarker

Size/bp	Sequences	Name	Direction	Real-time PCR based on SYBR-Green I fluorescence
76/bp	5′ - CTTCCCTAGGGGATTTCAGG - 3′	MALAT-F	Forward primer	Real Time PCR for MALAT-1
	5′ - GCCCACAGGAACAAGTCCTA - 3′	MALAT-R	Reverse primer
116/bp	5′ - CTTCCTCCCTTTAACTTATCCATTCAC - 3′	NEAT-F	Forward primer	Real Time PCR for NEAT-1
	5′ - CTCTTCCTCCACCATTACCAACAATAC - 3′	NEAT-R	Reverse primer
121/bp	5′ - GAGTGCAGTGGCGTGATCTC - 3′	THRIL-F	Forward primer	Real Time PCR for THRIL
	5′ - AAAATTAGTCAGGCATGGTGGTG - 3′	THRIL-R	Reverse primer
163/bp	5′ -CGACCACTTTGTCAAGCTCA - 3′	GAPDH-F	Forward primer	Real Time PCR for GAPDH
	5′ -CCCTGTTGCTGTAGCCAAAT - 3′	GAPDH-R	Reverse primer
73/bp	5′ - GTGGCCGAGGACTTTGATTG - 3′	β-actin-F	Forward primer	Real Time PCR for b-actin
	5′ - CCTGTAACAACGCATCTCATATT - 3′	β-actin-R	Reverse primer

Parameters	Male	Female	Total	p-value
Healthy individuals n (%)	25 (50.0%)	25 (50.0%)	50 (100.0%)	-
Age	37.2±13.3 (23-67)	35.0±11.2 (24-59)	36.2±12.1 (23-67)	0.569 Student t test
SARS-CoV-2 infected participants n (%)	25 (50.0%)	25 (50.0%)	50 (100.0%)	-
Age	38.1±8.6 (28-53)	34.0±12.9 (22-67)	36.1±10.9 (22-67)	0.415 Student t test
Clinical manifestations of patients with SARS-CoV-2 infection
Fever	35 (70.0%)	30 (60.0%)	65 (65.0%)	1.000 Fisher’s exact test
Chills	25 (50.0%)	35 (70.0%)	60 (60.0%)	0.650 Fisher’s exact test
Headache	35 (70.0%)	40 (80.0%)	75 (75.0%)	1.000 Fisher’s exact test
Skeletal pain	35 (70.0%)	35 (70.0%)	70 (70.0%)	1.000 Fisher’s exact test
Chest pain	10 (20.0%)	15 (30.0%)	25 (25.0%)	1.000 Fisher’s exact test
Shortness of breath	10 (20.0%)	10 (20.0%)	20 (20.0%)	1.000 Fisher’s exact test
Decreased smell	5 (10.0%)	25 (50.0%)	30 (30.0%)	0.141 Fisher’s exact test
Decreased taste	10 (20.0%)	15 (30.0%)	25 (25.0%)	1.000 Fisher’s exact test
Confusion	10 (20.0%)	15 (10.0%)	15 (15.0%)	1.000 Fisher’s exact test
Dry cough	20 (40.0%)	30 (60.0%)	50 (50.0%)	0.658 Fisher’s exact test
Sputum cough	10 (20.0%)	0 (00.0%)	10 (10.0%)	0.474 Fisher’s exact test
Runny nose	15 (30.0%)	20 (40.0%)	35 (35.0%)	1.000 Fisher’s exact test
Cape of nose	20 (40.0%)	25 (50.0%)	45 (45.0%)	1.000 Fisher’s exact test
Bleeding stomach	0 (00.0%)	5 (10.0%)	5 (5.0%)	1.000 Fisher’s exact test
Gastrointestinal symptoms	25 (50.0%)	20 (40.0%)	45 (45.0%)	1.000 Fisher’s exact test

	MALAT-1	NEAT-1	THRIL	miR-155-5p
RdRp	0.43^ns	0.28^ns	0.4^ns	−0.7^c c p < 0.001; ns, not significant.
N gene	0.35^ns	0.24^ns	0.33^ns	−0.61^b b p < 0.01
Sex Age	0.09^ns	0.17^ns	0.07^ns	−0.05^ns
Bleeding stomach	0.11^ns	0.28^ns	0.28^ns	−0.08^ns
Gastrointestinal symptoms	0.37^ns	0.02^ns	0.16^ns	0.08^ns
Decreased taste	−0.33^ns	0.45^a a p < 0.05	0.04^ns	0.02^ns
Decreased smell	−0.05^ns	0.07^ns	0.14^ns	−0.18^ns
Cape of nose	0.12^ns	0.3^ns	0.41^a a p < 0.05	−0.07^ns
Runny nose	0.1^ns	0.24^ns	0.36^ns	−0.19^ns
Shortness of breath	−0.1^ns	0.38^ns	0.38^ns	0.36^ns
Chest pain	0.07^ns	0.43^ns	0.46^a a p < 0.05	0.3^ns
Sputum cough	−0.31^ns	0.58^b b p < 0.01	0.42^a a p < 0.05	0.41^a a p < 0.05
Dry cough	−0.2^ns	0.46^a a p < 0.05	0.57^b b p < 0.01	−0.31^ns
Skeletal pain	0.55^b b p < 0.01	0.13^ns	0.2^ns	0.001^ns
Chills	0.28^ns	0.17^ns	0.39^ns	0.13^ns
Headache	−0.18^ns	−0.2^ns	0.13^ns	0.33^ns
Confusion	0.07^ns	0.36^ns	0.17^ns	0.13^ns
Fever	0.61^c c p < 0.001; ns, not significant.	0.1^ns	−0.004^ns	0.2^ns

Brazilian Society of Infectious Diseases Rua Augusto Viana, SN, 6º., 40110-060 Salvador - Bahia - Brazil, Telefax: (55 71) 3283-8172, Fax: (55 71) 3247-2756 - Salvador - BA - Brazil
E-mail: bjid@bjid.org.br

Acompanhe os números deste periódico no seu leitor de RSS

[1] * Corresponding author. E-mail address: bokharaei.f@iums.ac.ir (F. Bokharaei-Salim).