In this work, four isolates of endophytic fungi (Alternaria alternata, Colletotrichum gloesporioides, Glomerella cingulata and Nigrospora sphaerica), deposited in the culture collection ‘University Recife Mycologia’ (URM) at the Universidade Federal de Pernambuco, were characterized for the genes ITS 1 and 4 (region 5.8 S) and evaluated for taxol production.
Keywords
Paclitaxel; Taxol route genes; ITS; Colletotrichum gloesporioides
| Isolate | City of collection | Year | Plant |
|---|---|---|---|
| Nigrospora sphaerica | Recife | 2007 | Indigofera suffruticosa |
| Alternaria alternata | Recife | 2007 | Lippia sidoides (stem) |
| Colletotrichum gloesporioides | Jaboatão dos Guararapes | 2012 | Plantago major (leaf) |
| Glomerella cingulata | Arcoverde | 2008 | Bean leaves |
| Gene | Primers | Sequences (5'-3') | Size of amplification |
|---|---|---|---|
| ts |
ts - F ts - R |
CAAACCCATGTCGAATTGAGAAG CAAGTTTGCATACACTCTGGAATCT |
631 bp |
| dbat |
dbat - F dbat - R |
GGGAGGGTGCTCTGTTTG GTTACCTGAACCACCAGAGG |
153 bp |
| bapt |
bapt - F bapt - R |
CCTCTCTCCGCCATTGACAA TCGCCATCTCTGCCATACTT |
453 bp |
| Isolate | Size (pb) | Similarity (%) | Similar species |
|---|---|---|---|
| Nigrospora sphaerica | 621 | - | Not identified |
| Colletotrichum gloeosporioides | 666 | 99 | Colletotrichum gloeosporioides |
| Alternaria alternata | 573 | 99 | Alternaria alternata |
| Glomerella cingulata | 587 | 99 | Glomerella cingulata |
