Resumo em Inglês:

The current world demand for bioethanol is increasing as a consequence of low fossil fuel availability and a growing number of ethanol/gasoline flex-fuel cars. In addition, countries in several parts of the world have agreed to reduce carbon dioxide emissions, and the use of ethanol as a fuel (which produces fewer pollutants than petroleum products) has been considered to be a good alternative to petroleum products. The ethanol that is produced in Brazil from the first-generation process is optimized and can be accomplished at low cost. However, because of the large volume of ethanol that is produced and traded each year, any small improvement in the process could represent a savings of billions dollars. Several Brazilian research programs are investing in sugarcane improvement, but little attention has been given to the improvement of yeast strains that participate in the first-generation process at present. The Brazilian ethanol production process uses sugarcane as a carbon source for the yeast Saccharomyces cerevisiae. Yeast is then grown at a high cellular density and high temperatures in large-capacity open tanks with cells recycle. All of these culture conditions compel the yeast to cope with several types of stress. Among the main stressors are high temperatures and high ethanol concentrations inside the fermentation tanks during alcohol production. Moreover, the competition between the desired yeast strains, which are inoculated at the beginning of the process, with contaminants such as wild type yeasts and bacteria, requires acid treatment to successfully recycle the cells. This review is focused on describing the problems and stressors within the Brazilian ethanol production system. It also highlights some genetic modifications that can help to circumvent these difficulties in yeast.

Resumo em Inglês:

Lettuce is a leafy vegetable widely used in industry for minimally processed products, in which the step of sanitization is the crucial moment for ensuring a safe food for consumption. Chlorinated compounds, mainly sodium hypochlorite, are the most used in Brazil, but the formation of trihalomethanes from this sanitizer is a drawback. Then, the search for alternative methods to sodium hypochlorite has been emerging as a matter of great interest. The suitability of chlorine dioxide (60 mg L-1/10 min), peracetic acid (100 mg L-1/15 min) and ozonated water (1.2 mg L-1 /1 min) as alternative sanitizers to sodium hypochlorite (150 mg L-1 free chlorine/15 min) were evaluated. Minimally processed lettuce washed with tap water for 1 min was used as a control. Microbiological analyses were performed in triplicate, before and after sanitization, and at 3, 6, 9 and 12 days of storage at 2 ± 1 ºC with the product packaged on LDPE bags of 60 µm. It was evaluated total coliforms, Escherichia coli, Salmonella spp., psicrotrophic and mesophilic bacteria, yeasts and molds. All samples of minimally processed lettuce showed absence of E. coli and Salmonella spp. The treatments of chlorine dioxide, peracetic acid and ozonated water promoted reduction of 2.5, 1.1 and 0.7 log cycle, respectively, on count of microbial load of minimally processed product and can be used as substitutes for sodium hypochlorite. These alternative compounds promoted a shelf-life of six days to minimally processed lettuce, while the shelf-life with sodium hypochlorite was 12 days.

Resumo em Inglês:

The development of mold of environmental origin in honey affects its quality and leads to its deterioration, so yeasts and molds counts have been used as an important indicator of hygiene levels during its processing, transportation and storage. The aim of this study was to evaluate the levels of yeasts and molds contamination and their correlation with moisture and acidity levels in Apis mellifera L. honey from central Brazil. In 20% of the samples, the yeasts and molds counts exceeded the limit established by legislation for the marketing of honey in the MERCOSUR, while 42.8% and 5.7% presented above-standard acidity and moisture levels, respectively. Although samples showed yeasts and molds counts over 1.0 x 10² UFC.g-1, there was no correlation between moisture content and the number of microorganisms, since, in part of the samples with above-standard counts, the moisture level was below 20%. In some samples the acidity level was higher than that established by legislation, but only one sample presented a yeasts and molds count above the limit established by MERCOSUR, which would suggest the influence of the floral source on this parameter. In general, of the 35 samples analyzed, the quality was considered inadequate in 45.7% of cases.

Resumo em Inglês:

A strain of lactic acid bacteria, Leuconostoc lactis, was isolated from the intestinal tract of black porgy, Sparus macrocephalus, and identified by conventional biochemical characteristics and 16S rDNA gene sequence analysis. The isolated strain had the ability of bile tolerance and resistance to low pH, and survived well in the trypsinase and pepsin solution. But the highly concentrated dose of trypsinase and pepsin affect the viability of the isolated strain. The isolate was resistant to several antibiotics, including Cephalothin, Ceftriaxone, Imipenem and Tobramycin. The isolate could autoaggregate itself and coaggregate with other bacteria in vitro. The autoaggregation percentage increased to 23.29% after 20 h of incubation. The percentage of coaggregation were respectively 31.21%, 29.44%, 10.74%, 16.49%, 24.36%, 24.41% and 20.99% for Vibrio parahaemolyticus, Listeria monocytogenes, Escherichia coli O157, Salmonella typhimurium, Shigella, Staphylococcus aureus and Proteusbacillus vulgaris after 20 h incubation of a mixed suspension. The supernatant of the strain inhibited the growth of several pathogens, such as V.parahaemolyticus, Vibrio harveyi, Vibrio alginolyticus, Staphylococcus aureus, Escherichia coli O157, Salmonella typhimurium, Bacillus subtilis, Proteusbacillus vulgaris and Shigella. These results indicated that the isolate, Leuconostoc lactis, might be an attractive candidate for perspectival strain for probiotics in marine aquaculture.

Resumo em Inglês:

Campylobacteriosis is a worldwide distributed zoonosis. One of the main virulence factors related to Campylobacter spp. in animals and humans is the cytolethal distending toxin (CDT), encoded by three adjacent genes (cdtA, cdtB, cdtC). The occurrence of Campylobacter spp. in samples of vegetables has not been reported in Brazil yet, and has seldom been described in the international literature. The detection of CDT in these strains has not been reported, either. The objectives of the present study were to determine the occurrence of Campylobacter spp. strains carrying virulence factors in samples of poultry and vegetables (lettuce and spinach) from different points of sale, thus verifying if vegetables are as an important vehicle for potentially virulent Campylobacter spp. strains as poultry. Twenty four strains were identified as Campylobacter jejuni by phenotypic and genotypic methods: 22 from broiler carcasses and two from lettuce samples. Three strains were identified as Campylobacter coli: two from broiler carcasses and one from lettuce. The presence of the cdt genes were detected in 20/24 (83.3%) C. jejuni strains, and 3/3 (100%) C. coli strains. The isolation of Campylobacter spp. strains with the cdt gene cluster in lettuce samples points to a new possible source of contamination, which could have an impact in the vegetable production chain and risk to public health. Results show that potentially virulent C. jejuni and C. coli strains remain viable in samples of broiler carcasses and vegetables at the points of sale.

Resumo em Inglês:

The aim of this work was to study the yeast populations and the main hygienic-sanitary microbial indicators in water buffalo mozzarella produced and commercialized in Minas Gerais, Brazil. Forty-two water buffalo mozzarella samples were purchased from retail outlets in Belo Horizonte. In addition, five samples of consecutive starter cultures, curd before acidification, acidified curd and mozzarella were collected at an industry in the city of Oliveira. Only three of the five water samples analyzed were suitable for consumption according to Brazilian sanitary standards. Four milk samples were highly contaminated with fecal coliforms, and did not meet the minimal hygienic-sanitary standards according to Brazilian regulations. Only one sample of buffalo muzzarela purchased from retail outlets exceeded the limit for coagulase-positive Staphylococcus. Eleven samples showed counts of thermotolerant coliforms higher than5x 10³ CFU.g-1, but still lower than the maximum permitted by the Brazilian laws. Salmonella spp. and Listeria monocytogenes were not isolated. Debaryomyces hansenii, Candida lusitaniae and C. parapsilosis were the prevalent yeast species isolated from cheese. Among samples from the production stages, the acidified curd presented the highest numbers of yeasts, with C. catenulata being the most frequent species isolated. Some opportunistic yeast species such as C. guilliermondii, C. tropicalis, C. parapsilosis, C. lusitaniae, C. catenulata, C. rugosa and C. krusei occurred in the mozzarella cheese samples analyzed. The mozzarella cheese presented a low microbial load as compared to other cheese already studied, and the yeast biota included species typical of cheese and also opportunistic pathogens.

Resumo em Inglês:

Phenolic compounds of nutraceutical importance viz., catechins (C), (-)-epicatechin (EC), (-)-epigallocatechin (EGC), (-)-epigallocatechin-3-gallate (EGCG) and (-)-epicatechin-3-gallate (ECG) were estimated in fresh green tea shoots of Camellia sinensis (L) O Kuntze cultivar. The total polyphenols and total catechins were in the range of 219.90 to 317.81 and 140.83 to 271.39 g/kg, respectively in monthly samples of tea. The values of C, EC, EGC, EGCG and ECG in tea powders as analyzed through high performance liquid chromatography (HPLC) were in the range of 1.560 to 3.661, 13.338 to 27.766, 26.515 to 39.597, 62.903 to 102.168 and 18.969 to 39.469 mg/g, respectively. Effect of tea extracts and standard flavanols against five pathogenic bacteria viz., Listeria monocytogenes (MTCC-839), Pseudomonas aeruginosa (MTCC-741), Bacillus cereus (MTCC-1272), Staphylococcus aureus (MTCC-96) and Escherichia coli (MTCC-443), and eleven indigenous potential bacterial probiotics belonging to genera Enterococcus, Bacillus and Lactobacillus spp. obtained from fermented foods of Western Himalayas, was investigated. EGCG, ECG and EGC exhibited antibacterial activity but, C and EC did not show this activity. Tea extracts having high concentrations of EGCG and ECG were more potent in antibacterial action against bacterial pathogens. Tea extracts and standard flavan-3-ols augmented viability of potential probiotics in an order of EGCG > EGC > ECG > EC > C. Tea extracts and standard flavanols had no antibacterial activity against Escherichia coli (MTCC-443) but, in combination with probiotic culture supernatants, this activity was seen. The Kangra tea thus, exerts antibacterial effect on bacterial pathogens through EGCG, ECG and EGC constituents while stimulatory effect on growth of indigenous potential probiotics.

Resumo em Inglês:

This study aimed to isolate and identify Lactobacillus in the honey stomach of honeybee Apis dorsata. Samples of honeybee were collected from A. dorsata colonies in different bee trees and Lactobacillus bacteria isolated from honey stomachs. Ninety two isolates were Gram-stained and tested for catalase reaction. By using bacterial universal primers, the 16S rDNA gene from DNA of bacterial colonies amplified with polymerase chain reaction (PCR). Forty-nine bacterial 16S rDNA gene were sequenced and entrusted in GenBank. Phylogenetic analysis showed they were different phylotypes of Lactobacillus. Two of them were most closely relevant to the previously described species Lactobacillus plantarum. Other two phylotypes were identified to be closely related to Lactobacillus pentosus. However, only one phylotype was found to be distantly linked to the Lactobacillus fermentum. The outcomes of the present study indicated that L. plantarum, L. pentosus, and L. fermentum were the dominant lactobacilli in the honey stomach of honeybee A. dorsata collected during the dry season from Malaysia forest area - specifically "Melaleuca in Terengganu".

Resumo em Inglês:

Salmonella has been identified as the main aetiological agent responsible for foodborne diseases in several countries worldwide, including Brazil. In the State of Rio Grande do Sul (RS), southern Brazil, previews studies analysed official foodborne illnesses data, identifying Salmonella as the main bacterial agent of foodborne diseases during the period of 1997 to 2001. The present study aimed to analyse the official epidemiological data on salmonelloses occurred in the State of RS, during the period of 2002 to 2004. Even though data on recent salmonelloses were available, only data concerning the period comprising in 2002 to 2004 were analysed because the official worksheet records presented more consistent information about the salmonellosis outbreaks. Results indicated that, among the 624 foodborne outbreaks officially investigated, 202 (32.37%) were confirmed as salmonellosis. Among them 23,725 people were involved, 4,148 became sick, 1,878 were hospitalized and one person died. The season with the highest incidence of salmonelloses was spring, and the most affected age group was composed of people aged between 20 to 49 years old (56.66%). Animal origin foods -especially eggs and meat products -were very often involved with the outbreaks, however homemade mayonnaise was identified as the main food vehicle for salmonelloses (53.51%). The majority of the cases occurred inside private homes (55.81%) and food services (12.1%), and the main factors contributing to the occurrence of the outbreaks were the consumption of products without sanitary inspection (26.7%) and exposure of food at room temperature for more than two hours (18.58%). Similarly to what was previously reported for the period of 1997 to 2001, Salmonella spp. was the most prevalent foodborne disease agent in the State of RS during the years of 2002 to 2004.

Resumo em Inglês:

Thirty one out of 153 strains of Shigella sonnei isolated from Thai patients with diarrhoea showed antibacterial activity against S. sonnei by agar well diffusion method. All of them harbor plasmids with the genetic determination of colicin type 7 (Js) gene but without colicin E and colicin U gene. The PCR product obtained from strain 35/44 was shown to be the gene for colicin type 7 lytic protein (cja). The partially purified bacteriocin (PPB) containing colicin type 7 of strain 35/44 was prepared and used for characterization. The antibacterial activity of PPB against a total of 17 selected Gram-positive and Gram-negative bacteria was tested. It was found that PPB of strain 35/44 was active against E. coli O157, S. sonnei and S. boydii. The sensitivity of PPB from this strain to proteinase K, trypsin and α-chymotrypsin suggests the proteinaceous nature of these antimicrobial substances. Therefore, this isolated bacterium can be regarded as bacteriocin producing bacteria. The bacteriocin produced by this isolated S. sonnei was heat stable as evidenced by its ability to maintain the activity at 80 °C for 60 min. In addition, it was stable within a wide range of pH (3-9). The molecular weight of colicin type 7 from isolated S. sonnei strain 35/44 analyzed by SDS-PAGE was 54.4 kDa composing of at least five subunits. It is to our knowledge; the first report of Thai patients with diarrhoea that S. sonnei isolated from them contained colicin type 7.

Resumo em Inglês:

Although many rapid and high throughput molecular methods have been developed in the recent years for the multiplex detection of foodborne pathogens, the simultaneous recovery and enrichment of sublethally injured cells is still a problem that needs to be considered. Combined with previous established multiplex real-time PCR assay, the capability of simultaneous recovery and enrichment of sublethally injured Salmonella, E. coli O157:H7 and L. monocytogenes cells was evaluated in a multiplex selective enrichment broth SEL. The injured cells were obtained by heat shock. After evaluation of different procedures, 1 h of recovery period prior to 20 h of enrichment was proved to be necessary for the detection of less than 10 CFU/5 mL broth of injured L. monocytogenes. When the detection method was applied to artificially contaminated ground beef, all the three injured pathogens could be simultaneously detected without discrimination by real-time PCR combined with SEL broth, the detection limit was < 5 CFU/10 g ground beef. Comparatively, when BPW was employed as the enrichment broth in the same detection procedure, injured L. monocytogenes could not be detected if the initially spiked level was below 10² CFU/10 g ground beef. Considering the capability of co-enrichment and high detection effectiveness, the real-time PCR assay combined with SEL broth herein appears to be a promising tool for high-throughput screening of a large number of processed food samples, which require either single or multiple pathogen detection. More important, the sublethally injured foodborne pathogen cells were also detectable.

Resumo em Inglês:

The ripening process of Serro Minas cheese, one of the most popular cheeses produced with raw milk in Brazil, was studied over the course of 60 days of ripening during dry and rainy seasons. Brazilian legislation prohibits the production of cheese from raw milk unless it was submitted to a maturation period greater than 60 days. However Minas Serro cheese is sold within a few days of ripening. A total of 100 samples of Serro cheese were obtained from five farms; 50 samples were collected during the dry season (winter in Brazil) and 50 samples were collected during the rainy season (summer in Brazil). From each farm, ten cheeses were collected during each season after two days of ripening. Our results showed high levels of total and fecal coliforms at the beginning of the ripening period (approximately 4 Log MPN/g with 3 days of ripening) that decreased with 60 days of ripening reaching almost 1.5 Log MPN/g. Contamination by coagulase-positive staphylococci was reduced by the end of the ripening period. Salmonella spp. was not detected. The staphylococcal enterotoxins B and C were detected in 1% and 4% of the cheeses, respectively, after 30 days of ripening. These results suggest that the ripening process was not effective in eliminating staphylococcal enterotoxins from the cheese. However, none of the investigated strains of Staphylococcus spp. isolated from Serro cheese produced enterotoxins A, B, C or D. The high pathogen and coliform levels at the beginning of the ripening process for the cheese produced during both seasons indicate the need for improvement of the sanitation of the manufacturing conditions.

Resumo em Inglês:

Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes) rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction) has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO). A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB) followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT) complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR). PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%), followed by fish meat (4.0%), and then beef (2.5%). Among various milk and milk products, curd (2.0%) showed the highest prevalence, followed by raw milk (1.3%). The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS) examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro) resulted positive in twenty four strong haemolysin producing L. monocytogenes isolates. The vero cytotoxicity assay could be suggested as a further step towards an alternative assay for detection of haemolytic strains of L. monocytogenes.

Resumo em Inglês:

Staphylococcal food poisoning is one of the most frequent foodborne illnesses worldwide and it is caused by the ingestion of food contaminated with enterotoxins produced by some strains of Staphylococcus (S.) aureus. In the State of Rio Grande do Sul (RS), Southern Brazil, S. aureus has been identified as the second most frequent agent of foodborne illnesses in the last two decades. The aim of the present study was to assess and analyse the epidemiological data of S. aureus food poisoning occurred in the State of RS during the years of 2000 to 2002. The official records of epidemiological investigations carried out by the Sanitary Surveillance Services of the State of RS were analysed. Among foodborne outbreaks for which aetiology was determined, S. aureus was identified as the responsible agent of 57 foodborne outbreaks, being 42 (74%) confirmed by microbiological analyses and 15 (26%) confirmed by clinical symptoms and/or epidemiological data. Staphylococcal outbreaks were responsible for the exposition of 5,991 persons, of which 1,940 (32%) were interviewed by the Sanitary Surveillance officers. The most affected age group corresponded to people with 20 to 49 years old (48%), where men (48%) and women (52%) were affected similarly. The main involved food vehicles were meats servings (35%), followed by pastries (25%), cheese (23%), pasta (11%) and potato salad with homemade mayonnaise (11%). The majority of the outbreaks occurred inside private homes (33%) followed by commercial food establishments (28%). Inadequate control of temperature and failures in general hygiene practices were identified as the main factors responsible for the outbreaks. In conclusion, S. aureus was an important food poisoning etiological agent in the State of RS during 2000 to 2002 and its prevention depends on control measures involving different parts of the food chain.

Resumo em Inglês:

In the State of Rio Grande do Sul (RS), Southern Brazil, a good manufacturing practices regulation was published recommending two disinfection methods for cleaning cloths used in food services. The aim of the present study was to evaluate the efficacy of those methods. Cleaning cloths were sampled without prior notice at food services, on common working days. For the analyses, the cloths were divided in two sub-samples, being one of them microbiologically analyzed. The second sub-sample was further divided in two pieces and submitted to hand washing for two minutes. After that, one piece was boiled in water for 15 min and the other one was soaked in a 200 ppm sodium hypochlorite solution for 15 min. Both pieces of cloth were submitted to microbiological analyses. Cleaning cloths presented total aerobic mean counts of 6.9 ± 6.7 log/cm². All cleaning cloths presented coliform contamination, and 40% demonstrated mean counts of 6.2 ± 5.6 log/cm². Presumptive S. aureus mean counts of 5.5 ± 4.9 log/cm² were found. No statistic correlation was observed among the number of meals served daily in the food services and the microbiological contamination levels. After washing and disinfection, microbiological counts were significantly (p < 0.05) reduced by both methods, achieving an approximately 5 log reduction. The reductions achieved by the sodium hypochlorite soaking method and the boiling method were not significantly different. Thus, it was possible to conclude that both recommended methods were suitable to disinfect cleaning cloths used in food services.

Resumo em Inglês:

The development of alternative microbiological techniques is driven by the necessity to meet the current needs to deliver rapid results in the manufacturing process of foods, but it is important that these methods be evaluated for each application. The objective of the present study was to assess the PetrifilmTM EB and the TEMPO® EB systems with ISO 21528-2:2004 for the count of Enterobacteriaceae in pasteurized and UHT milk samples. We analyzed the microflora of 141 pasteurized milk samples, 15 samples of artificially contaminated pasteurized milk and 15 samples of artificially contaminated UHT milk. Investigation of the method PetrifilmTM EB and ISO 21528:2 regression analysis showed a high correlation in the samples, r = 0.90 for the microflora of pasteurized milk, r = 0.98 for artificially contaminated pasteurized milk and r = 0.99 for the artificially contaminated UHT milk. In evaluating the system TEMPO EB ® method and ISO 21528:2 correlation was also significant in the analyzed samples, with r = 0.86 for the microflora of pasteurized milk, r = 0.96 for artificially contaminated pasteurized milk and r = 0.99 for artificially contaminated UHT milk. No statistically significant differences were observed between the three methods conducted to analyze artificially contaminated pasteurized and UHT milk at three inoculum levels. In conclusion, the PetrifilmTM EB system and the TEMPO® EB system may be an alternative to the ISO 21528-2:2004 for the Enterobacteriaceae assay for milk as because of the ease-of-operation and the time reduction achieved for conducting the microbiological assay using these systems.

Resumo em Inglês:

In the present study, the cells of Bifidobacterium animalis subsp. lactis (BI-01) and Lactobacillus acidophilus (LAC-04) were encapsulated in cocoa butter using spray-chilling technology. Survival assays were conducted to evaluate the resistance of the probiotics to the spray-chilling process, their resistance to the simulated gastric and intestinal fluids (SGF and SIF), and their stability during 90 days of storage. The viability of the cells was not affected by microencapsulation. The free and encapsulated cells of B. animalis subsp. lactis were resistant to both SGF and SIF. The micro-encapsulated cells of L. acidophilus were more resistant to SGF and SIF than the free cells; the viability of the encapsulated cells was enhanced by 67%, while the free cells reached the detection limit of the method (10³ CFU/g). The encapsulated probiotics were unstable when they were stored at 20 °C. The population of encapsulated L. acidophilus decreased drastically when they were stored at 7 °C; only 20% of cells were viable after 90 days of storage. The percentage of viable cells of the encapsulated B. animalis subsp.lactis, however, was 72% after the same period of storage. Promising results were obtained when the microparticles were stored at -18 °C; the freeze granted 90 days of shelf life to the encapsulated cells. These results suggest that the spray-chilling process using cocoa butter as carrier protects L. acidophilus from gastrointestinal fluids. However, the viability of the cells during storage must be improved.

Resumo em Inglês:

The objective of the present study was to assess the growth and the recovery of Salmonella (S.) Enteritidis SE86 in different diluents, culture media and using different plating methods after the exposure to 200 mg/kg sodium dichloroisocyanurate (NaDCC). Before and after NaDCC exposure, SE86 was cultured at 30 °C and 7 °C in the following diluents: Peptone water (P), Saline solution (SaS), Peptone water+Saline solution (P+SaS), Peptone water+Tween 80+Lecithin+Sodium thiosulfate (P+N) and Saline solution+Tween 80+Lecithin+Sodium thiosulfate (SaS+N). The SaS diluent was chosen because it was able to maintain cells viable without growth and was further used for plating SE86 on non selective medium (Tryptic Soy Agar-TSA) and on selective media (Mannitol Lysine Crystal Violet Brilliant Green Agar-MLCB; Brilliant Green Agar-BGA; Salmonella Shigella Agar-SS and Xylose Lysine Dextrose-XLD). The Thin Agar Layer method (TAL) i.e., selective media overlayed with non selective TSA was also evaluated. Results indicated that SE86 not exposed to NaDCC was able to grow in P, P+N, SaS+N and P+SaS, but not in SaS, that was able to maintain cells viable. SE86 exposed to NaDCC demonstrated similar counts after dilution in SaS and the plating on non selective TSA, selective media MLCB, BGA, SS and XLD and on TAL media. SE86, S. Typhimurium and S. Bredeney, exposed or not exposed to NaDCC, showed no significant differences in counts on TSA, XLD and XLD overlayed with TSA, suggesting that all those media may be used to quantify NaDCC-exposed Salmonella by plating method.

Resumo em Inglês:

This study was carried out comparing the conventional methods (ISO 11290-1 and BAM method, 2008) and system mini-Vidas® (Biomerieux), for detection of Listeria sp. and Salmonella sp. in cooled sausage. The immunoenzymatic method has shown to be effective for the detection of target pathogens, it has presented itself as an excellent screening method.

Resumo em Inglês:

Although several invasive and noninvasive tests have been developed for the diagnosis of Helicobacter pylori infection, all of the tests have their limitations. We conducted a study to investigate and compare the suitability of rapid urease test (RUT), serology, histopathology and stool antigen tests with polymerase chain reaction (PCR) for detection of H. pylori, and correlate the diagnostic methods with PCR. Eighty nine patients (61 adults, 28 children) referred to the Firoozgar Hospital and Children Medical Center Hospital for diagnostic upper gastrointestinal endoscopy entered to the study and noninvasive tests such as immunoassay for serological antibodies against H. pylori and detection of its antigen in feces were measured. The biopsies were utilized for histological examination, RUT and PCR. The H. pylori statuses were evaluated by the positivity of ureC PCR in biopsy specimens and 53 subjects had H. pylori positive result. Histopathology showed high overall performance in adults and children with sensitivity and specificity 100% and 90%, respectively. Sensitivity, specificity, and accuracy for stool antigen test were 87.8%, 75% and 82%, respectively. Correlation of RUT, serology (IgG), histopathology and stool antigen tests with PCR were 0.82, 0.32, 0.91 and 0.63, respectively. In conclusion, the RUT and histopathology are as accurate as the PCR of biopsy and stool antigen test can consider as appropriate noninvasive test for detection of H. pylori infection.

Resumo em Inglês:

This study reports the occurrence of antibiotic resistance and production of β-lactamases including extended spectrum beta-lactamases (ESβL) in enteric bacteria isolated from hospital wastewater. Among sixty-nine isolates, tested for antibiotic sensitivity, 73.9% strains were resistant to ampicillin followed by nalidixic acid (72.5%), penicillin (63.8%), co-trimoxazole (55.1%), norfloxacin (53.6%), methicillin (52.7%), cefuroxime (39.1%), cefotaxime (23.2%) and cefixime (20.3%). Resistance to streptomycin, chloramphenicol, nitrofurantoin, tetracycline, and doxycycline was recorded in less than 13% of the strains. The minimum inhibitory concentration (MIC) showed a high level of resistance (800-1600 µg/mL) to one or more antibiotics. Sixty three (91%) isolates produced β-lactamases as determined by rapid iodometric test. Multiple antibiotic resistances were noted in both among ESβL and non-ESβL producers. The β-lactamases hydrolyzed multiple substrates including penicillin (78.8% isolates), ampicillin (62.3%), cefodroxil (52.2%), cefotoxime (21.7%) and cefuroxime (18.8%). Fifteen isolates producing ESβLs were found multidrug resistant. Four ESβL producing isolates could transfer their R-plasmid to the recipient strain E. coli K-12 with conjugation frequency ranging from 7.0 x 10-3 to 8.8 x 10-4. The findings indicated that ESβL producing enteric bacteria are common in the waste water. Such isolates may disseminate the multiple antibiotic resistance traits among bacterial community through genetic exchange mechanisms and thus requires immediate attention.

Resumo em Inglês:

Fifty one strains of the Bacteroides fragilis group were isolated from 45 fecal samples. Classical phenotypic identification showed that 16 isolates were B. thetaiotaomicron, 12 B. uniformis, 9 B. eggerthii,7 B. vulgatus,3 B. caccae,2 Parabacteroides distasonis with 1 identified B. ovatus and 1 B. fragilis. The 51 strains were tested for susceptibility against 16 antimicrobial agents and the MICs for metronidazole were determined. The tests showed that imipenem, meropenem and chloram-phenicol were the most effective antibiotics (98%, 98% and 92.16% of susceptibility, respectively) followed by ticarcillin/clavulanic acid, piperacillin/tazobactam, rifampin (88.24% susceptibility), moxifloxacin 86.27% and tigecycline 84.31%. Ofloxacin and cefotaxime were the least effective antibiotics with 27.45% and 0% of activity respectively. Only six of the 51 isolated strains were resistant to metronidazole with MICs = 64 mg/L (1 strain) and > 256 mg/L (5 strains).

Resumo em Inglês:

Scanning electron microscope (SEM) observations were used to analyze particular morphologies of Candida albicans clinical isolate (strain 82) and mutants defective in hyphae-promoting genes EFG1 (strain HLC52) and/ or CPH1 (strains HLC54 and Can16). Transcription factors Efg1 and Cph1 play role in regulating filamentation and adhesion of C. albicans' morphologies. Comparative analysis of such mutants and clinical isolate showed that Efg1 is required for human serum-induced cell growth and morphological switching. In the study, distinct differences between ultrastructural patterns of clinical strain's and null mutants' morphologies were observed (spherical vs tube-like blastoconidia, or solid and fragile constricted septa vs only the latter observed in strains with EFG1 deleted). In addition, wild type strain displayed smooth colonies of cells in comparison to mutants which exhibited wrinkled phenotype. It was observed that blastoconidia of clinical strain exhibited either polarly or randomly located budding. Contrariwise, morphotypes of mutants showed either multiple polar budding or a centrally located single bud scar (mother-daughter cell junction) distinguishing tube-like yeast/ pseudohyphal growth (the length-to-width ratios larger than 1.5). In their planktonic form of growth, blastoconidia of clinical bloodstream isolate formed constitutively true hyphae under undiluted human serum inducing conditions. It was found that true hyphae are essential elements for developing structural integrity of conglomerate, as mutants displaying defects in their flocculation and conglomerate-forming abilities in serum. While filamentation is an important virulence trait in C. albicans the true hyphae are the morphologies which may be expected to play a role in bloodstream infections.

Resumo em Inglês:

In this study, the discriminatory power of pulsed field gel electrophoresis (PFGE) and random amplified polymorphic DNA (RAPD) methods for subtyping of 54 clinical isolates of Klebsiella pneumoniae were compared. All isolates were typeable by RAPD, while 3.6% of them were not typeable by PFGE. The repeatability of both typing methods were 100% with satisfying reproducibility (≥ 95%). Although the discriminatory power of PFGE was greater than RAPD, both methods showed sufficient discriminatory power (DI > 0.95) which reflects the heterogeneity among the K. pneumoniae isolates. An optimized RAPD protocol is less technically demanding and time consuming that makes it a reliable typing method and competitive with PFGE.

Resumo em Inglês:

In this study we evaluated the antibacterial activity of the crude hydroalcoholic extracts, fractions, and compounds of two plant species, namely Rosmarinus officinalis and Petroselinum crispum, against the bacteria that cause urinary tract infection. The microdilution method was used for determination of the minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC). The crude hydroalcoholic extract of R. officinalis displayed in vitro activity against Gram-positive bacteria, with satisfactory MBC for the clinical isolate S. saprophyticus. The fractions and the pure compound rosmarinic acid did not furnish promising results for Gram-negative bacteria, whereas fractions 2, 3, and 4 gave encouraging results for Gram-positive bacteria and acted as bactericide against S. epidermidis as well as E. faecalis (ATCC 29212) and its clinical isolate. R. officinalis led to promising results in the case of Gram-positive bacteria, resulting in a considerable interest in the development of reliable alternatives for the treatment of urinary infections.

Resumo em Inglês:

This study isolated and quantified intestinal bacteria of children with cleft palate before and after palatoplasty. A prospective study was conducted from May 2007 to September 2008 on 18 children with cleft palate, aged one to four years, of both genders, attending a tertiary cleft center in Brazil for palatoplasty, to analyze the effect of surgical palate repair on the concentration of anaerobes Bacteroides sp, Bifidobacterium sp and microaerophiles Lactobacillus sp in feces of infants with cleft palate before and 24 hours after treatment with cefazolin for palatoplasty. There was significant reduction of Lactobacillus sp (p < 0.002), Bacteroides sp (p < 0.001) and Bifidobacterium sp (p = 0.021) after palatoplasty, revealing that surgery and utilization of cefazolin significantly influenced the fecal microbiota comparing collections before and after surgery. However, due to study limitations, it was not possible to conclude that other isolated factors, such as surgical stress, anesthetics and other medications used in palatoplasty might have a significant influence on the microbiota. Considering the important participation of the intestinal microbiota on both local and systemic metabolic and immunological activities of the host, professionals should be attentive to the possible influence of these changes in patients submitted to cleft repair.

Resumo em Inglês:

Ethanolic crude extracts prepared from the arils and seeds, pericarp, peels and from the whole fruit of Punica granatum, known as pomegranate, had their antifungal activity tested against Candida spp. The ethanolic crude extracts were analyzed by Mass Spectrometry and yielded many compounds such as punicalagin and galladydilacton. The extracts from the pericarp and peel showed activity against Candida spp., with MICs of 125 µg/mL. The effect of pericarp and peel extracts upon the morphological and structure of C. albicans and C. krusei were examined by scanning and transmission electron microscopy, with the visualization of an irregular membrane and hyphae, formation of vacuoles and thickening of the cell wall. The data obtained revealed potential antimicrobial activity against yeasts cells of the Candida genus, and the bioactive compounds could be responsible for changes in cell morphology and structure. The data obtained open new perspectives for future research in continuation to this study, where information such as determination of the site of action of the compounds could contribute to an alternative therapy against these organisms.

Resumo em Inglês:

The present study describes integron mediated multiple antibiotic resistance in extended-spectrum β-lactamase producing clinical isolates of Klebsiella pneumoniae. One hundred and four clinical isolates of K. pneumoniae from two Iranian hospitals were screened for extended-spectrum β-lactamase production and susceptibility of the extended-spectrum β-lactamase producing isolates was determined to 17 antibiotics by disc diffusion. Presence of integron classes 1, 2 and 3 was detected by PCR and integrase specific primers. Isolates harboring class 1 integron were then screened for variable regions using PCR. Fifty isolates (48%) produced extended-spectrum β-lactamases among which, 22 (44%) harbored class 1, 3 (6%) carried class 2 and none contained class 3 integons. Integron carriage was significantly associated with higher rates of multiple antibiotic resistance in extended-spectrum β-lactamase producing clinical isolates of K. pneumoniae. Integron harboring isolates were more resistant to aztreonam (51.3%), ceftazidime (42.6%), cefotaxime (43.3%), cefepime (24.6%), kanamycin (43.2%), tobramycin (30.7%), norfloxcacin (32%) and spectinomycin (25.6%) compared to the organisms without integrons. On the other hand, resistance to nitrofurantoin and streptomycin was significantly higher among the integron negative isolates. PCR amplification of class1 integron variable regions revealed 9 different sized DNA fragments and isolates with similar profiles for class 1 integron variable regions showed the same antibiotic resistance phenotypes.

Resumo em Inglês:

Candida infections are very common in cancer patients and it is a common practice to prescribe antifungal antibiotics along with anticancer drugs. Yeast to hyphal form switching is considered to be important in invasive candidiasis. Targeting morphogenetic switching may be useful against invasive candidiasis. In this study, we report the antimorphogenetic properties of thirty cancer drugs.

Resumo em Inglês:

Thirty nine isolates of Flavobacterium columnare from Brazilian fish farms had their carbohydrate composition of EPS evaluated by high efficiency liquid chromatography, using the phenol-sulfuric acid method of EPS. The occurrence of capsules on F. columnare cells was not directly related to biofilm formation, and the predominant monosaccharide is glucose.

Resumo em Inglês:

Hospital associated methicillin-resist Staphylococcus aureus has long been associated to outbreaks in the hospital environment. In this work, we investigated an outbreak of Hospital associated methicillin-resist Staphylococcus aureus carrying the Panton-Valentine leukocidin gene, which occurred in a large community hospital in Rio de Janeiro, Brazil.

Resumo em Inglês:

GBS serotypes III and V were the most prevalent in pregnant women and exhibited resistance to tetracycline, clindamycin and sulfamethoxazole/trimethoprim. Serotype III showed high sialic acid content and PFGE analysis discerned 33 heterogeneous profiles. Phenotypic and genotypic characterization could be relevant to control GBS infections unaffected by intra-partum chemoprophylaxis.

Resumo em Inglês:

This study was evaluated the clonal diversity of Streptococcus mutans in caries-free and caries-active subjects using MLEE. Strains from caries-free subjects were grouped in a single taxon. Unrooted dendrogram showed that different strains clustered in four different clades, also showed that more than one clonal type can be found in a same individual.

Resumo em Inglês:

Rabies is a zoonotic disease that affects all mammals and leads to more than 55,000 human deaths every year, caused by rabies virus (RABV) (Mononegavirales: Rhabdoviridae: Lyssavirus). Currently, human rabies treatment is based on the Milwaukee Protocol which consists on the induction of coma and massive antiviral therapy. The aim of this study was to assess the decrease in the titer of rabies virus both in vitro and in vivo using short-interfering RNAs. To this end, three siRNAs were used with antisense strands complementary to rabies virus nucleoprotein (N) mRNA. BHK-21 cells monolayers were infected with 1000 to 0.1 TCID50 of PV and after 2 hours the cells were transfected with each of tree RNAs in separate using Lipofectamine-2000. All three siRNAs reduced the titer of PV strain in a least 0.72 logTCID50/mL and no cytotoxic effect was observed in the monolayers treated with Lipofectamine-2000. Swiss albino mice infected with 10.000 to 1 LD of PV strain by the intracerebral route were also transfected after two hours of infection with a pool 3 siRNAs with Lipofectamine-2000 by the intracerebral route, resulting in a survival rate of 30% in mice inoculated with 100 LD50, while the same dose led to 100% mortality in untreated animals. Lipofectamine-2000 showed no toxic effect in control mice. These results suggest that intracerebral administration of siRNAs might be an effective antiviral strategy for rabies.

Resumo em Inglês:

The aim of this study was to investigate the presence of DNA of Borrelia burgdorferi sensu lato (s.l.) in ticks that feed on horses used for animal traction in rural Jataizinho, Parana, Brazil. Between February and June 2008, a total of 224 ticks was collected of which 75% were identified as Dermacentor nitens and 25% as Amblyomma cajenense. To amplify B. burgdorferi s.l. DNA, the intergenic space region (ISR) between the 5S (rrf) 23S (rrl) rRNA genes was used as targets for nested-PCR. Two ticks of the D. nitens species were positive for B. burgdorferi s.l. Both species showed a fragment of 184 bp, but the sequencing revealed 99.9% homology with the B. burgdorferi sensu stricto (s.s.) strain B31. These results showed, for the first time, the presence of spirochete DNA infecting ticks that parasitize horses used for animal traction, in the rural municipality mentioned. In conclusion, this study opens up promising prospects for determining the infection rate of B. burgdorferi s.s. genospecies or other species in the equine population, as well as the impact of the infection rate on Lyme disease in the state of Parana.

Resumo em Inglês:

Listeriosis is a disease primarily of ruminants caused by the Gram-positive bacterium Listeria monocytogenes. Ruminants either demonstrate manifestations of the encephalitic, septicemic, or reproductive form of listeriosis. The pathological and molecular findings with encephalitic listeriosis in a 5.5-month-old, male, mixed-breed goat and a 3-year-old Texel-crossed sheep from northern Paraná, Brazil are described. Clinically, the kid demonstrated circling, lateral protrusion of the tongue, head tilt, and convulsions; the ewe presented ataxia, motor incoordination, and lateral decumbency. Brainstem dysfunctions were diagnosed clinically and listeriosis was suspected. Necropsy performed on both animals did not reveal remarkable gross lesions; significant histopathological alterations were restricted to the brainstem (medulla oblongata; rhombencephalitis) and were characterized as meningoencephalitis that consisted of extensive mononuclear perivascular cuffings, neutrophilic and macrophagic microabscesses, and neuroparenchymal necrosis. PCR assay and direct sequencing, using genomic bacterial DNA derived from the brainstem of both animals, amplified the desired 174 base pairs length amplicon of the listeriolysin O gene of L. monocytogenes. Phylogenetic analyses demonstrated that the strains associated with rhombencephalitis during this study clustered with known strains of L. monocytogenes lineage I from diverse geographical locations and from cattle of the state of Paraná with encephalitic listeriosis. Consequently, these strains should be classified as L. monocytogenes lineage I. These results confirm the active participation of lineage I strains of L. monocytogenes in the etiopathogenesis of the brainstem dysfunctions observed during this study, probably represent the first characterization of small ruminant listeriosis by molecular techniques in Latin America, and suggest that ruminants within the state of Paraná were infected by the strains of the same lineage of L. monocytogenes.

Resumo em Inglês:

We here identified for the first time the presence of Mycobacterium avium paratuberculosis (MAP) sheep (S) strain in Argentina. IS900 polymerase chain reaction (PCR) was positive. The S strain was compared with MAP cattle (C) strains by using IS1311 PCR-restriction endonuclease analysis (PCR-REA), multiplex PCR and restriction fragment length polymorphism (RFLP) analysis.

Resumo em Inglês:

The aims of this study were to standard and optimize a qPCR protocol with FAM-BHQ1 probe, and to compare its sensitivity against TaqMan qPCR and PCR methods to diagnose shrimp WSD. The FAM-BHQ1 qPCR presented higher clinical sensitivity and showed to be a robust alternative to detect WSSV in clinical samples.

Resumo em Inglês:

This study describes the clinical, histopathological, and virological characterization of teat papillomatosis from Brazilian dairy cattle herds. Four types of bovine papillomavirus were identified (BPV6, 7, 9, and 10); one of these (BPV7) is being detected for the first time in Brazilian cattle.

Resumo em Inglês:

A study was conducted to verify the presence of mycoplasmas and ureaplasmas DNA in sheep semen samples from the State of Pernambuco. The PCR assay was conducted of according with standard protocols with generic primers. Mollicutes DNA was detected in 26.0% and Ureaplasma spp. in 12.0% of semen samples.

Resumo em Inglês:

Mustard oil cake (Brassica napus), the residue obtained after extraction of mustard oil from mustard oil seeds, was investigated for the production of lipase under solid state fermentation (SSF) using the marine yeast Yarrowia lipolytica NCIM 3589. Process parameters such as incubation time, biomass concentration, initial moisture content, carbon source concentration and nitrogen source concentration of the medium were optimized. Screening of ten nitrogen and five carbon sources has been accomplished with the help of Plackett-Burman design. The highest lipase activity of 57.89 units per gram of dry fermented substrate (U/gds) was observed with the substrate of mustard oil cake in four days of fermentation.

Resumo em Inglês:

A sensitive and efficient colorimetric method was optimized for detection of esterase enzymes produced by endophytic fungi for development of High-Throughput Screening (HTS). The fungi were isolated and obtained previously from plant species of Cerrado and Atlantic Forest located in areas of environmental preservation in the State of Sao Paulo / Brazil, as part of the project "Chemical and biological prospecting endophytic fungi associated to plant species of Cerrado and Atlantic Forest". The compounds ethyl butyrate, ethyl acetate and methyl propionate were used as standards esters which were hydrolyzed by extracellular enzyme from endophytic fungi (EC. 3.1.1.1 -carboxylesterases) for production of carboxylic acids. Thus, the reduction of the pH increases the protonated indicator concentration (bromothymol blue), changing the color of the reaction medium (from blue to yellow), that can be observed and measured by spectrophotometry at 616 nm. The methodology with acid-base indicator was performed on 13 microorganisms, aiming Periconia atropurpurea asapotential source of esterase for biotransformation of short chain esters. The results also evidenced that this methodology showed to be efficient, fast, cheap, having low consumption of reagents and easy development, and can be applied to screen carboxylic-ester hydrolases in a large number of microorganisms.

Resumo em Inglês:

In order to overproduce bioinsecticides production by a sporeless Bacillus thuringiensis strain, an optimal composition of a cheap medium was defined using a response surface methodology. In a first step, a Plackett-Burman design used to evaluate the effects of eight medium components on delta-endotoxin production showed that starch, soya bean and sodium chloride exhibited significant effects on bioinsecticides production. In a second step, these parameters were selected for further optimisation by central composite design. The obtained results revealed that the optimum culture medium for delta-endotoxin production consists of 30 g L-1 starch, 30 g L-1 soya bean and 9g L-1 sodium chloride. When compared to the basal production medium, an improvement in delta-endotoxin production up to 50% was noted. Moreover, relative toxin yield of sporeless Bacillus thuringiensis S22 was improved markedly by using optimised cheap medium (148.5 mg delta-endotoxins per g starch) when compared to the yield obtained in the basal medium (94.46 mg delta-endotoxins per g starch). Therefore, the use of optimised culture cheap medium appeared to be a good alternative for a low cost production of sporeless Bacillus thuringiensis bioinsecticides at industrial scale which is of great importance in practical point of view.

Resumo em Inglês:

Sixty six indigenous Saccharomyces cerevisiae strains were evaluated in stressful conditions (temperature, osmolarity, sulphite and ethanol tolerance) and also ability to flocculate. Eighteen strains showed tolerant characteristics to these stressful conditions, growing at 42 ºC, in 0.04% sulphite, 1 mol L-1 NaCl and 12% ethanol. No flocculent characteristics were observed. These strains were evaluated according to their fermentative performance in sugar cane juice. The conversion factors of substrates into ethanol (Yp/s), glycerol (Yg/s) and acetic acid (Yac/s), were calculated. The highest values of Yp/s in sugar cane juice fermentation were obtained by four strains, one isolated from fruit (0.46) and the others from sugar cane (0.45, 0.44 and 0.43). These values were higher than the value obtained using traditional yeast (0.38) currently employed in the Brazilian bioethanol industry. The parameters Yg/s and Yac/s were low for all strains. The UFLA FW221 presented the higher values for parameter related to bioethanol production. Thus, it was tested in co-culture with Lactobacillus fermentum. Besides this, a 20-L vessel for five consecutive batches of fermentation was performed. This strain was genetically stable and remained viable during all batches, producing high amounts of ethanol. The UFLA FW221 isolated from fruit was suitable to produce bioethanol in sugar cane juice. Therefore, the study of the biodiversity of yeasts from different environmental can reveal strains with desired characteristics to industrial applications.

Resumo em Inglês:

It is well known that the type III secretion system (T3SS) and type III (T3) effectors are essential for the pathogenicity of most bacterial phytopathogens and that the expression of T3SS and T3 effectors is suppressed in rich media but induced in minimal media and plants. To facilitate in-depth studies on T3SS and T3 effectors, it is crucial to establish a medium for T3 effector expression and secretion. Xanthomonas campestris pv. campestris (Xcc) is a model bacterium for studying plant-pathogen interactions. To date no medium for Xcc T3 effector secretion has been defined. Here, we compared four minimal media (MME, MMX, XVM2, and XOM2) which are reported for T3 expression induction in Xanthomonas spp. and found that MME is most efficient for expression and secretion of Xcc T3 effectors. By optimization of carbon and nitrogen sources and pH value based on MME, we established XCM1 medium, which is about 3 times stronger than MME for Xcc T3 effectors secretion. We further optimized the concentration of phosphate, calcium, and magnesium in XCM1 and found that XCM1 with a lower concentration of magnesium (renamed as XCM2) is about 10 times as efficient as XCM1 (meanwhile, about 30 times stronger than MME). Thus, we established an inducing medium XCM2 which is preferred for T3 effector secretion in Xcc.

Resumo em Inglês:

Viral gastroenteritis and other waterborne diseases are a major concern for health in Brazil. A number of studies were conducted about the presence of viruses on water samples from Brazilian areas. However, the knowledge about the occurrence of viral contamination of drinking water sources in rural settings of the country is insufficient. On the present work, 15 samples from 5 dairy farms located at the municipality of Tenente Portela were collected and analysed for the presence of human adenoviruses (HAdV), as well as human enteroviruses (EV) and rotaviruses (RV). HAdV was present on 66.66% of the water samples, and have been found in all samples from artesian wells and springs, which are used as sources of drinking water for the individuals inhabiting those farms. EV and RV found only in one sample each. The detection rates of HAdV on the water from these dairy farms are alarming and point towards a situation of elevated environmental contamination by fecal microorganisms of human origin and poor basic sanitation conditions.

Resumo em Inglês:

Crown disease (CD) is infecting oil palm in the early stages of the crop development. Previous studies showed that Fusarium species were commonly associated with CD. However, the identity of the species has not been resolved. This study was carried out to identify and characterize through morphological approaches and to determine the genetic diversity of the Fusarium species. 51 isolates (39%) of Fusarium solani and 40 isolates (31%) of Fusarium oxysporum were recovered from oil palm with typical CD symptoms collected from nine states in Malaysia, together with samples from Padang and Medan, Indonesia. Based on morphological characteristics, isolates in both Fusarium species were classified into two distinct morphotypes; Morphotypes I and II. Molecular characterization based on IGS-RFLP analysis produced 27 haplotypes among the F. solani isolates and 33 haplotypes for F. oxysporum isolates, which indicated high levels of intraspecific variations. From UPGMA cluster analysis, the isolates in both Fusarium species were divided into two main clusters with the percentage of similarity from 87% to 100% for F. solani, and 89% to 100% for F. oxysporum isolates, which was in accordance with the Morphotypes I and II. The results of the present study indicated that F. solani and F. oxysporum associated with CD of oil palm in Malaysia and Indonesia were highly variable.

Resumo em Inglês:

The mangrove ecosystem is an unexplored source for biotechnological applications. In this unique environment, endemic bacteria have the ability to thrive in the harsh environmental conditions (salinity and anaerobiosis), and act in the degradation of organic matter, promoting nutrient cycles. Thus, this study aimed to assess the cellulolytic activities of bacterial groups present in the sediment from a mangrove located in Ilha do Cardoso (SP, Brazil). To optimize the isolation of cellulolytic bacteria, enrichments in two types of culture media (tryptone broth and minimum salt medium), both supplemented with 5% NaCl and 1% of cellulose, were performed. Tests conducted with the obtained colonies showed a higher occurrence of endoglycolytic activity (33 isolates) than exoglycolytic (19 isolates), and the degradation activity was shown to be modulated by the presence of NaCl. The isolated bacteria were clustered by BOX-PCR and further classified on the basis of partial 16S rRNA sequences as Alphaproteobacteria, Gammaproteobacteria, Actinobacteria, Firmicutes or Bacteroidetes. Therefore, this study highlights the importance of studies focusing on the endemic species found in mangroves to exploit them as novel biotechnological tools for the degradation of cellulose.

Resumo em Inglês:

Studies on dental units (DUs) are conducted either for the prevention or the reduction of the density of bacterial contamination in dental unit waterlines (DUWLs). However, the existence of fungi in the these systems requires more attention. During dental treatment, direct contact with water contaminated with fungi such as Candida, Aspergillus, or inhalation of aerosols from high-speed drill may cause various respiratory infections, such as asthma, allergies, and wounds on mucose membranes, especially on immunocompromised patients and dentists. The aims of this study are to investigate the number and colonization of fungi in DUWLs in the city of Istanbul, Turkey. Water samples were collected from air-water syringes, high-speed drills, and inlet waters from 41 DUs. The aerobic mesophilic fungi count in highspeed drills was higher than inlet waters and air-water syringes. Non-sporulating fungi were found in 7 DUs. The isolated fungi were identified as Penicillium waksmanii, Cladosporium spp., Penicillium spp., Candida famata, Cryptococcus laurentii, Candida guilliermondii, Penicillium verrucosum, Aspergillus pseudoglaucus, Penicillium decumbens, and Acremonium sp. Some of these fungal genera are known as opportunistic pathogens that led to respiratory diseases such as allergic rhinits. This study shows the importance of regular control of mycological contamination on water at DUs.

Resumo em Inglês:

A field experiment established in 1980 was conducted to evaluate the effects of open drainage ditch applied for water removal on bacterial and fungal communities of cold waterlogged paddy soils in 2011. In this experiment, traditional plate counting and temperature gradient gel electrophoresis were employed to characterize the abundance and diversity of soil bacterial and fungal communities. Four different distances from the open drainage ditch, 5, 15, 25 and 75 m with different degrees of drainage were designed for this study. Maximum populations of culturable aerobic bacteria and fungi were at 15-m distance while minimum populations were at 75-m distance. Significant differences (p < 0.05) in fungal populations were observed at all distances from open drainage ditch. The highest diversity of the bacterial community was found at a distance of 25 m, while that of the fungal community was observed at a distance of 5 m. Sequencing of excised TGGE bands indicated that the dominant bacteria at 75-m distance belonged to anaerobic or microaerobic bacteria. Relationships between microbial characteristics and soil physicochemical properties indicated that soil pH and available nitrogen contents were key factors controlling the abundance of culturable aerobic bacteria and fungi, while soil water capacity also affected the diversity of fungal community. These findings can provide the references for better design and advanced management of the drainage ditches in cold waterlogged paddy soils.

Resumo em Inglês:

Propolis is a natural product widely used for humans. Due to its complex composition, a number of applications (antimicrobial, antiinflammatory, anesthetic, cytostatic and antioxidant) have been attributed to this substance. Using Saccharomyces cerevisiae as a eukaryotic model we investigated the mechanisms underlying the antioxidant effect of propolis from Guarapari against oxidative stress. Submitting a wild type (BY4741) and antioxidant deficient strains (ctt1∆, sod1∆, gsh1∆, gtt1∆ and gtt2∆) either to 15 mM menadione or to 2 mM hydrogen peroxide during 60 min, we observed that all strains, except the mutant sod1∆, acquired tolerance when previously treated with 25 µg/mL of alcoholic propolis extract. Such a treatment reduced the levels of ROS generation and of lipid peroxidation, after oxidative stress. The increase in Cu/Zn-Sod activity by propolis suggests that the protection might be acting synergistically with Cu/Zn-Sod.