Open-access Freqüência da mutação deltaF508 em 108 pacientes com fibrose cística de São Paulo: comparação com dados de estudos brasileiros

clin Clinics Clinics 1807-5932 1980-5322 Faculdade de Medicina / USP São Paulo, SP, Brazil OBJETIVO: Analisar a freqüência da mutação delta F508 (deltaF508) em 108 pacientes não aparentados, com fibrose cística e comparou os resultados com os dados de outros estudos brasileiros. A fibrose cística (CF) constitui a doença genética mais comum em populações caucasianas, sendo a deltaF508 a mais freqüente dentre as mutações relacionadas à doença. MÉTODO: A freqüência da deltaF508 foi analisada por meio da Reação em Cadeia da Polimerase (PCR) seguida de detecção em géis de poliacrilamida a 8%. RESULTADOS: Vinte e três dos 108 pacientes foram homozigotos para a mutação (21,3%), 50 foram heterozigotos (46,3%) e os 35 restantes não eram portadores da deltaF508 (32,4%). Em termos de alelos, foram observados 96 mutados (44,45%) e 120 do tipo selvagem (55,55%), ou seja, não portadores da mutação. CONCLUSÃO: A freqüência de 44,45% de alelos mutados encontrada no estudo é mais elevada que os 33,0% descritos em pesquisa realizada em São Paulo em 1993, e ligeiramente mais baixa que os 48,0% encontrados em relatos mais recentes. Além disso, nossos resultados corroboraram a idéia de que a freqüência da mutação deltaF508 é mais baixa no Brasil em comparação a países europeus e nos Estados Unidos da América (cerca de 70,0%), provavelmente devido a maior miscigenação racial. Estas observações terão que ser consideradas antes da implementação de testes genéticos de triagem no Brasil. ORIGINAL RESEARCH Frequency of the DF508 mutation in 108 cystic fibrosis patients in São Paulo: comparison with reported Brazilian data Freqüência da mutação DF508 em 108 pacientes com fibrose cística de São Paulo: comparação com dados de estudos brasileiros Thelma Suely Okay; Wagner Paes Oliveira; Roberto Raiz-Júnior * ; Joaquim Carlos Rodrigues; Gilda Maria Bárbaro Del Negro Laboratory of Medical Investigation (LIM/36) of the Department of Paediatrics, Hospital das Clínicas, Faculty of Medicine, University of São Paulo – São Paulo/SP, Brazil, and the Pneumology Unit of the Child Institute, Hospital das Clínicas, Faculty of Medicine, University of São Paulo – São Paulo/SP, Brazil. E-mail: tsokay@icr.hcnet.usp.br ABSTRACT PURPOSE: To analyze the frequency of the delta F508 (DF508) deletion mutation in 108 unrelated cystic fibrosis patients and compare the results with the previously reported data for Brazilian patients. Cystic fibrosis is the leading cause of genetic disease in Caucasians, and the DF508 deletion is the most common mutation associated with the disease. METHOD: The frequency of the DF508 mutation was assessed by means of a polymerase chain reaction (PCR) followed by detection in 8% silver-stained polyacrylamide gels. RESULTS: Twenty-three of 108 patients (21.3%) were homozygous for the DF508 deletion, 50 were heterozygous (46.3%), and the remaining 35 (32.4%) were non-carriers. In terms of alleles, there were 96 mutated (96/216 or 44.45%) and 120 wild-type ones (120/216 or 55.5%). CONCLUSION: The 44.45% of affected alleles that were found is higher than the 33% first described in 1993, but slightly lower than the 48% recently reported. Moreover, our data corroborated the idea that the frequency of the DF508 mutation is lower in Brazil in comparison to that found in studies carried out in Europe and North American (circa 70.0%), probably due to increased racial miscegenation. These findings must be taken into account before any genetic screening of the population is proposed in Brazil. Keywords: CFTR. DF508. Mutation. Deletion. Cystic fibrosis. RESUMO OBJETIVO: Analisar a freqüência da mutação delta F508 (DF508) em 108 pacientes não aparentados, com fibrose cística e comparou os resultados com os dados de outros estudos brasileiros. A fibrose cística (CF) constitui a doença genética mais comum em populações caucasianas, sendo a DF508 a mais freqüente dentre as mutações relacionadas à doença. MÉTODO: A freqüência da DF508 foi analisada por meio da Reação em Cadeia da Polimerase (PCR) seguida de detecção em géis de poliacrilamida a 8%. RESULTADOS: Vinte e três dos 108 pacientes foram homozigotos para a mutação (21,3%), 50 foram heterozigotos (46,3%) e os 35 restantes não eram portadores da DF508 (32,4%). Em termos de alelos, foram observados 96 mutados (44,45%) e 120 do tipo selvagem (55,55%), ou seja, não portadores da mutação. CONCLUSÃO: A freqüência de 44,45% de alelos mutados encontrada no estudo é mais elevada que os 33,0% descritos em pesquisa realizada em São Paulo em 1993, e ligeiramente mais baixa que os 48,0% encontrados em relatos mais recentes. Além disso, nossos resultados corroboraram a idéia de que a freqüência da mutação DF508 é mais baixa no Brasil em comparação a países europeus e nos Estados Unidos da América (cerca de 70,0%), provavelmente devido a maior miscigenação racial. Estas observações terão que ser consideradas antes da implementação de testes genéticos de triagem no Brasil. Unitermos: CFTR. DF508. Mutação. Deleção. Fibrose cística. Cystic fibrosis (CF) is the most common potentially lethal autosomal recessive disease of Caucasians. The affected gene, CFTR (cystic fibrosis transmembrane conductance receptor), has been determined to code for a chloride channel. Laboratory diagnosis is based on the finding of abnormally high concentrations of chloride in sweat.1 The clinical features of CF are dominated by involvement of the respiratory tract, where obstruction of the airways by thick, sticky mucus and subsequent infection, especially with Pseudomonas species, predominate. In most patients, there is also involvement of the intestinal tract leading to pancreatic insufficiency as a result of obstruction of the pancreatic ducts and subsequent scarring and destruction of exocrine function.2 The CFTR gene is composed of 250,000 base pairs and 27 exons and encodes a protein of 1,480 amino acids. The finding that one particular mutation, the delta F508 (DF508), which is a 3 base-pair deletion in exon 10 of the CFTR gene corresponding to codon 508 (phenylalanine) of the protein, is responsible for up to 70.0% of all mutations found in CF patients tested so far has made its molecular detection a very attractive diagnostic tool.3 However, it has been shown that the frequency of this mutation varies significantly among ethnic groups, ranging from 26.0% in Turkey to 88.0% in Denmark.4 A few Brazilian studies carried out in the south and southeast regions of Brazil found differences with respect to the frequency of the DF508 mutation among CF patients and also in comparison to those reported in European countries and in the USA.5 In 24 patients in São Paulo, 33.0% of alleles were affected;6 In 17 patients in Rio de Janeiro, a frequency of 35.0% of affected alleles was found.7 In 190 patients from São Paulo, Paraná, and Rio Grande do Sul, 47.0% had the DF508 mutation.8 In another study of 120 chromosomes of 60 patients in São Paulo, a frequency of 31.7% of alleles with the DF508 mutation was found.9 In 61 patients from the South of Brazil, 50.8 % of the alleles had the mutation.10 Of 44 patients from Rio de Janeiro, 47.7% were affected, with a frequency of 30.7% affected alleles11 More recently, among 160 Brazilian patients in a study conducted in São Paulo, 48.4% of alleles were affected,12 and in 77 patients from the south of Brazil, 48.7% of alleles had the DF508 mutation.13 Raskin et al. (2004) concluded that the frequency of the DF508 mutation varies remarkably according to geographic and ethnic origin of patients (Euro-Brazilians or Afro-Brazilians).14 PATIENTS AND METHODS This study was approved by the Ethics Committee of the Faculty of Medicine, University of São Paulo, Brazil. One-hundred and eight unrelated clinically and laboratory diagnosed CF patients were enrolled in this study to determine the frequency of DF508-mutated alleles in this population. We aimed at comparing our data with those previously reported with respect to Brazilian CF patients.5-13 Two milliliters of whole blood samples (EDTA, Becton Dickinson) were drawn from patients after informed consent. DNA extraction was performed according to a previously described salting out protocol.15 The presence of the DF508 mutation was determined by means of a classical PCR followed by detection of amplification products in silver-stained polyacrylamide gel electrophoresis according to a previously described protocol,16,17 which was modified to fit our laboratory conditions. DNA samples of non-carrier subjects (having 2 wild-type alleles) yielded a unique 98 bp (base-pair) fragment, whereas samples from heterozygous patients had 2 amplified fragments, 1 of 98 bp and 1 of 95 bp (lacking 3 base-pairs), and finally DNA from homozygous individuals had only 1 amplified fragment of 95 bp. Amplifications were performed as follows: 10 ng of genomic DNA, 0.4 mM of each of the primers "sense" C16B (5'- GTTTTCCTGGATTATGCCTGGGCA-3' and "anti-sense" C16D (5'- GTTGGCATGCTTTGATGACGTTTC); 1.5 mM of MgCl2 , 2.5 U of Taq DNA polymerase (Amersham-Pharmacia Biotech). After an initial denaturation step of 5 min. at 95°C, 40 cycles of amplification were performed in a Minicycler PT-150, (MJ Research). Cycles consisted of 1 min. at 95°C, 1 min. at 55°C and 1 min. at 72°C, and were followed by a final extension step of 5 min. at 72°C. Ten microliters of amplification products were analyzed by means of vertical electrophoresis in 8% polyacrylamide gels under non-denaturing conditions for 4 h and 30 min. (25 mA, 450 V, 20 W) in a refrigerated electrophoresis apparatus (Höefer SE 660, Amersham-Pharmacia Biotech). Then, gels were silver-stained, washed, and fixed according a previously described protocol18 and afterwards were dried in a gel dryer (BioRad, USA), at 80°C for 2 h and 30 min. RESULTS Among the 108 patients studied, we found 23 (21.3%) homozygous for the DF508 deletion mutation, 50 heterozygous (46.3%), and 35 (32.4%) non-carriers. In terms of alleles, there were 96 mutated (96/216 or 44.45%) and 120 wild-type ones (120/216 or 55.5%). Table 1 summarizes the data of 14 Brazilian studies performed in cystic fibrosis patients according to the number of alleles studied, the region of the country, and the frequency of DF508-mutated alleles. Briefly, the data show that the totality of reports included south or southeast regions patients, with a great variability of either DF508 mutation frequency as well as other CF-associated mutations (21.0 to 81.0%). Figure 1 shows the detection of PCR products in 8% polyacrylamide gels. Homozygous patients (ho) have two 95 bp products, indicating 2 alleles with the DF508 mutation; heterozygous ones (he) have one 95 bp product one 98 bp product, indicating one DF508-mutated allele and one non-carrier (wild type) allele; and finally non-affected individuals or non-carriers (nc) have two 98 bp products, indicating 2 non-mutated alleles. The molecular weight marker used is the 25 bp marker from Invitrogen (USA). DISCUSSION The frequency of DF508-mutated alleles in the present study was 44.5%. This frequency is higher than the 33.0% and the 35.0% described by Martins et al. (1993)6 and De Miranda et al. (1993)7, respectively, but it is noteworthy that they studied a limited number of patients (24 in São Paulo and 17 in Rio de Janeiro). However, Parizotto et al. (1997)9 studied 120 chromosomes from 60 CF patients of the State of São Paulo and reported that only 31.7% of them had DF508-mutated alleles. Similarly, Cabello et al. (1999) described a frequency of 30.68% of alleles with the DF508 mutation in 88 patients from the State of Rio de Janeiro.11 On the contrary, Raskin et al. (1993)8 studied 190 patients from the south and the southeast of Brazil: 60 from Rio Grande do Sul, 24 from Santa Catarina, 17 from Paraná, 58 from São Paulo and 31 from Minas Gerais. They found an overall frequency of 47.0% of alleles with the DF508 mutation. However, when the frequencies were considered according to the state of origin of patients, they found 49.0% in Rio Grande do Sul, 27.0% in Santa Catarina, 44.0% in Paraná, 52.0% in São Paulo and 53.0% in Minas Gerais. In addition, Bernardino et al. (2000)12 and Streit et al. (2003)13 found higher frequencies of alleles with the DF508 mutation that were very similar (48.4% and 48.7%, respectively), but the former study did not mention whether the patients were all from the State of São Paulo, and the latter was carried out in the State of Rio Grande do Sul, in the south region of Brazil. Raskin et al. in a series of articles that analyzed the frequency of the DF508 mutation as well as other common mutations associated with CF in Brazilian patients19,20,14 initially cited a frequency of 47.0% in Brazilian patients of European origin,19 then a frequency ranging from 30.7 to 50.8%,20 and finally a striking difference in a screening for the 70 most common CF mutations (including DF508) between Euro-Brazilians (75.0%) and Afro-Brazilians (21.0%).14 It is interesting to point out that in all polyacrylamide gels that were performed on heterozygous samples, 2 fragments of molecular weights between 100 bp and 125 bp were present. This phenomenon has already been observed and reported,21 but the relevance of these DNA fragments has still to be investigated. Nevertheless, these spurious fragments act as DNA markers for alleles that are heterozygous for the DF508 mutation. The present study added 216 chromosomes to the list of 1,652 already investigated in Brazilian CF patients with respect to the DF508 mutation, of which only 284 alleles are certain to belong to patients of the State of São Paulo. The 44.45% of DF508-mutated alleles cited in the present study is within the range of frequencies already reported. Furthermore, all performed Brazilian studies (including ours) tend to indicate a lower frequency of DF508-mutated alleles in Brazil in comparison to European and North American studies (around 70.0%). This is probably due to the higher genetic heterogeneity of our population. These results emphasize the need to re-evaluate the cost vs. benefit ration regarding DNA-based tests for genetic screening in highly heterogeneous populations such as the Brazilian because they will be surely less effective in detecting DF508 mutations as well as in other common CF mutations. Received for publication on December 02, 2004. Accepted for publication on January 01, 2005. * In memorian 1. Welsh M, Smith AE. Molecular mechanisms of CFTR: chloride channel dysfunction in cystic fibrosis. Cell 1993;73:1251-4. Molecular mechanisms of CFTR: chloride channel dysfunction in cystic fibrosis Cell 1993 1251 4 73 Welsh M Smith AE 2. Noone PG, Olivier KN, Knowles MR. Modulation of the ionic milieu of the airway in health and disease. Annu Rev Med 1994;45:421-34. Modulation of the ionic milieu of the airway in health and disease Annu Rev Med 1994 421 34 45 Noone PG Olivier KN Knowles MR 3. Riordan JR, Rommens JM, Kerem B, Alon N, Rozmahel K, Grzelczak Z, et al. Identification of the cystic fibrosis gene: cloning and characterization of complementary DNA. Science 1989;245:1066-73. Identification of the cystic fibrosis gene: cloning and characterization of complementary DNA Science 1989 1066 73 245 Riordan JR Rommens JM Kerem B Alon N Rozmahel K Grzelczak Z 4. Tsui LC, Buchwald M. Cystic fibrosis. Ann Med Genet 1992;24:192-245. Cystic fibrosis Ann Med Genet 1992 192 245 24 Tsui LC Buchwald M 5. Tsui LC. The spectrum of cystic fibrosis mutations. Trends Genet 1992;8:392-8. The spectrum of cystic fibrosis mutations Trends Genet 1992 392 8 8 Tsui LC 6. Martins CS, Ribeiro F, Costa FF. Frequency of the cystic fibrosis delta F508 mutation in a population from the State of São Paulo, Brazil. Braz J Med Biol Res 1993;26:1037-40. Frequency of the cystic fibrosis delta F508 mutation in a population from the State of São Paulo, Brazil Braz J Med Biol Res 1993 1037 40 26 Martins CS Ribeiro F Costa FF 7. De Miranda AB, Llerena Júnior J, Dallalana LT, Moura-Neto RS, Suffys PN, Degrave WM. Use of PCR for the determination of the frequency of the delta F508 mutation in Brazilian cystic fibrosis patients. Mem Inst Oswaldo Cruz 1993;88:309-12. Use of PCR for the determination of the frequency of the delta F508 mutation in Brazilian cystic fibrosis patients Mem Inst Oswaldo Cruz 1993 309 12 88 De Miranda AB Llerena Júnior J Dallalana LT Moura-Neto RS Suffys PN Degrave WM 8. Raskin S, Philllips JA, Krishnamani MR, Unencak-Jones C, Parker RA, Dewsen E, et al. Regional distribution of cystic fibrosis-linked DNA haplotypes in Brazil: Multicenter Study. Hum Biol 1997;69:75-88. Regional distribution of cystic fibrosis-linked DNA haplotypes in Brazil: Multicenter Study Hum Biol 1997 75 88 69 Raskin S Philllips JA Krishnamani MR Unencak-Jones C Parker RA Dewsen E 9. Parizotto EA, Bertuzzo CS, Ribeiro AF. Molecular characterization of cystic fibrosis patients in the state of São Paulo. J Med Genet 1997;34:877-81. Molecular characterization of cystic fibrosis patients in the state of São Paulo J Med Genet 1997 877 81 34 Parizotto EA Bertuzzo CS Ribeiro AF 10. Maróstica PJ, Raskin S & Abreu-e-Silva FA. Analysis of the delta F508 mutation in a Brazilian cystic fibrosis population: comparison of pulmonary status of homozygotes with other patients. Braz J Med Biol Res 1998;31:529-32. Analysis of the delta F508 mutation in a Brazilian cystic fibrosis population: comparison of pulmonary status of homozygotes with other patients Braz J Med Biol Res 1998 529 32 31 Maróstica PJ Raskin S Abreu-e-Silva FA 11. Cabello GM, Moreira AF, Horovitz D, Correia P, Santa Rosa A, Llerena Jr, et al. Cystic fibrosis: low frequency of DF508 mutation in 2 population samples from Rio de Janeiro, Brazil. Hum Biol 1999;71:189-96. Cystic fibrosis: low frequency of DF508 mutation in 2 population samples from Rio de Janeiro, Brazil Hum Biol 1999 189 96 71 Cabello GM Moreira AF Horovitz D Correia P Santa Rosa A Llerena Jr 12. Bernardino AL, Ferri A, Passos-Bueno MR, KIM CE, Nakaie CM, Gomes CE, et al. Molecular analysis in Brazilian cystic fibrosis patients reveals five novel mutations. Genet Test 2000;4:69-74. Molecular analysis in Brazilian cystic fibrosis patients reveals five novel mutations Genet Test 2000 69 74 4 Bernardino AL Ferri A Passos-Bueno MR KIM CE Nakaie CM Gomes CE 13. Streit C, Burlamaque-Neto AC, De Abreu e Silva F, Giugliani R, Saraiva Pereira ML. CFTR gene: molecular analysis in patients from the South Brazil. Mol Genet Metabol 2003;78:259-64. CFTR gene: molecular analysis in patients from the South Brazil Mol Genet Metabol 2003 259 64 78 Streit C Burlamaque-Neto AC De Abreu e Silva F Giugliani R Saraiva Pereira ML 14. Raskin S, Pereira L, Reis F, Rosario NA, Ludwig N, Valentim L, et al. High allelic heterogeneity between Afro-Brazilians and Euro-Brazilians impacts cystic fibrosis genetic testing. Genetic Testing 2003;7(3):213-8. High allelic heterogeneity between Afro-Brazilians and Euro-Brazilians impacts cystic fibrosis genetic testing Genetic Testing 2003 213 8 3 7 Raskin S Pereira L Reis F Rosario NA Ludwig N Valentim L 15. Miller AS, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 1988;16:1215. A simple salting out procedure for extracting DNA from human nucleated cells Nucleic Acids Res 1988 1215 16 Miller AS Dykes DD Polesky HF 16. Saiki Rk, Scharf S, Faloona F, Mullis Kb, Horn Gt, Erlich HA, et al. Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 1985;230:1350-54. Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia Science 1985 1350 54 230 Saiki Rk Scharf S Faloona F Mullis Kb Horn Gt Erlich HA 17. Saiki RK, Gelfand DH, Stoffel S, Scharf SJ, Higuchi R, Horn GT, et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 1988;239:487-91. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase Science 1988 487 91 239 Saiki RK Gelfand DH Stoffel S Scharf SJ Higuchi R Horn GT 18. Bassam BJ, Caetano-Anollés G, Gresshoff PM. Fast and sensitive silver staining of DNA in polyacrylamide gels. Anal Biochem 1991;196:80-3. Fast and sensitive silver staining of DNA in polyacrylamide gels Anal Biochem 1991 80 3 196 Bassam BJ Caetano-Anollés G Gresshoff PM 19. Raskin S, Phillips JA, Kaplan G, McClure M, Vnencak-Jones C, Rozov T, et al. Geographic heterogeneity of 4 common worldwide cystic fibrosis non-DF508 mutations in Brazil. Hum Biol 1999;71(1):111-121. Geographic heterogeneity of 4 common worldwide cystic fibrosis non-DF508 mutations in Brazil Hum Biol 1999 111 121 1 71 Raskin S Phillips JA Kaplan G McClure M Vnencak-Jones C Rozov T 20. Goloni-Bertollo EM, Rossit AR, Junior JB, Fett-Conte AC, Raskin S. CFTR molecular analysis reveals infrequent allele frequencies in nine cystic fibrosis patients from São Paulo State, Brazil. Hum Biol 2003; 75(3):393-8. CFTR molecular analysis reveals infrequent allele frequencies in nine cystic fibrosis patients from São Paulo State, Brazil Hum Biol 2003 393 8 3 75 Goloni-Bertollo EM Rossit AR Junior JB Fett-Conte AC Raskin S 21. Chong GL, Thibodeau SN. A simple assay for the screening of the cystic fibrosis allele in carriers of the Phe508 deletion mutation. Mayo Clin Proc 1990;65:1072-6. A simple assay for the screening of the cystic fibrosis allele in carriers of the Phe508 deletion mutation Mayo Clin Proc 1990 1072 6 65 Chong GL Thibodeau SN
location_on
Faculdade de Medicina / USP Rua Dr Ovídio Pires de Campos, 225 - 6 and., 05403-010 São Paulo SP - Brazil, Tel.: (55 11) 2661-6235 - São Paulo - SP - Brazil
E-mail: clinics@hc.fm.usp.br
rss_feed Acompanhe os números deste periódico no seu leitor de RSS
Acessibilidade / Reportar erro