A Young Seedling Stripe2 phenotype in rice is caused by mutation of a chloroplast-localized nucleoside diphosphate kinase 2 required for chloroplast biogenesis

Abstract

Chloroplast development and chlorophyll (Chl) biosynthesis in plants are regulated by many genes, but the underlying molecular mechanisms remain largely elusive. We isolated a rice mutant named yss2 (young seedling stripe2) with a striated seedling phenotype beginning from leaf 2 of delayed plant growth. The mutant developed normal green leaves from leaf 5, but reduced tillering and chlorotic leaves and panicles appeared later. Chlorotic yss2 seedlings have decreased pigment contents and impaired chloroplast development. Genetic analysis showed that the mutant phenotype was due to a single recessive gene. Positional cloning and sequence analysis identified a single nucleotide substitution in YSS2 gene causing an amino acid change from Gly to Asp. The YSS2 allele encodes a NDPK2 (nucleoside diphosphate kinase 2) protein showing high similarity to other types of NDPKs. Real-time RT-PCR analysis demonstrated that YSS2 transcripts accumulated highly in L4 sections at the early leaf development stage. Expression levels of genes associated with Chl biosynthesis and photosynthesis in yss2 were mostly decreased, but genes involved in chloroplast biogenesis were up-regulated compared to the wild type. The YSS2 protein was associated with punctate structures in the chloroplasts of rice protoplasts. Our overall data suggest that YSS2 has important roles in chloroplast biogenesis.

Keywords:
Chloroplast biogenesis; NDPK; Oryza sativa; positional cloning; YSS2 gene

Introduction

Chloroplasts are essential organelles in higher plants. The formation of a mature chloroplast from a proplastid during plant development involves many steps: first, the development of the chloroplast itself followed by the development of a functional photosynthetic apparatus (Mullet, 1993; Sakamoto et al., 2008). There are about 3,000 nuclear-encoded and nearly 120 plastid-encoded chloroplast proteins in higher plants (Timmis et al., 2004; Reumann et al., 2005; Pfalz and Pfannschmidt, 2013). These proteins play important roles in chloroplast development, photosynthesis and plastid transcription (Sakamoto et al., 2008; Dong et al., 2013; Pfalz and Pfannschmidt, 2013; Zhou et al., 2013, 2017). Chloroplast biogenesis from proplastids to mature chloroplast goes through three steps (Kusumi et al., 2010): first, plastid DNA synthesis and plastid division, second, establishment of the plastid transcription/translation apparatus, a key to chloroplast formation, and third, activation of the photosynthetic apparatus. At the molecular level, transcript accumulations from both nuclear and plastid genes are necessary for all three steps (Kusumi et al., 2010). FtsZ (encoding a component of the plastid division machinery) is required for the first step (TerBush et al., 2013); RpoTp, rpoA and rpoB, separately encoding NEP, and PEP α and β subunits, respectively, are highly expressed during the second step (Hricová et al., 2006; Steiner et al., 2011; Börner et al., 2015), and rbcS (encoding the small subunit of ribulose-1,5-bisphosphate carboxylase), rbcL (encoding the large subunit of ribulose-1,5-bisphosphate carboxylase) and psbA (encoding the D1 subunit of the PSII complex) are abundant in the third step, which functions in activation of the photosynthetic apparatus (Hwang and Tabita, 1989; Nelson and Yocum, 2006). Chloroplast development is affected by alterations in expression levels of these genes. Similarly, V1, V2, V3, St1 and VYL transcripts were reported to accumulate highly in the first or second steps of chloroplast differentiation and to be required for chloroplast biogenesis (Sugimoto et al., 2004, 2007; Yoo et al., 2009; Kusumi et al., 2011; Dong et al., 2013).

Chl-deficient mutants are ideal materials to study Chl biosynthesis, chloroplast development, and chloroplast RNA editing. OsYGL1 encodes a Chl synthase that catalyzes esterification of chlorophyllide, the last step of Chl biosynthesis (Wu et al., 2007). Knockdown of the YGL2 gene, which encodes heme oxygenase 1, hinders Chl biosynthesis in rice (Chen et al., 2013; Li et al., 2013). A chloroplast PPR protein was encoded by the WSL gene, which regulated the splicing of rpl2 transcript. In the wsl mutant, PEP-dependent plastid gene expression was obviously down-regulated, and plastid rRNAs synthesis and plastid translation efficiency were reduced. These led to the aberrant chloroplast development and sensitive response of the mutant to abiotic stress (Tan et al., 2014). YSS1 encodes a chloroplast nucleoid protein, which was characterized as an important regulator of PEP activity. Decreased accumulation of YSS1 transcripts disrupted Chl biosynthesis and chloroplast differentiation (Zhou et al., 2017). OsWLP1 (encoding a chloroplast ribosome L13 protein) and OsWP1 (encoding Val-tRNA synthetase) play essential roles in chloroplast development of leaf and panicle. Weak allele mutation in WLP1 caused albino seedling phenotype and bleached panicles, especially severe under lower temperature. Chloroplast development could be affected in the seedlings and young panicles of wlp1 mutant, although data are not available (Song et al., 2013). Single nucleotide transitions in OsWP1 lead to a severe albino phenotype (wp1 died after the L4 stage) or a virescent phenotype (wp1 showed striated leaf in seedlings and white panicles at heading). The wp1 mutant arrested plastidic protein synthesis and biogenesis of chloroplast ribosomes and was defective in early chloroplast development (Wang et al., 2016). In addition, YSA, YLC1, and AM1 were also implicated in Chl biosynthesis and chloroplast formation in different ways (Su et al., 2012; Zhou et al., 2013; Sheng et al., 2014).

NDPKs, which are among the oldest proteins and widely present in various prokaryotes and eukaryotes, mainly function in maintaining the metabolic balance between NTPs and NDPs in cells (Hasunuma et al., 2003). They also have essential roles in cell growth and division, signal transduction and plant stress response (Zimmermann et al., 1999; Moon et al., 2003; Ryu et al., 2005; Dorion et al., 2006). Three kinds of NDPKs predominate in higher plants. NDPK1 is a cytoplasm-associated protein whereas NDPK2 and NDPK3 are separately localized in plastids and mitochondria (Bolter et al., 2007; Kihara et al., 2011). Different localizations suggest that NDPKs play important roles in different cell compartments. Previous studies demonstrated that NDPK2 is associated with embryo and seed development and involved in response to external stress (Yano et al., 1995; Nato et al., 1997; Kawasaki et al., 2001). However, there is little reported evidence that NDPK2 participates in chloroplast development and Chl biosynthesis.

In this study, we aimed to characterize a young seedling stripe mutant, yss2. The mutant showed a striated phenotype from leaf 2 to leaf 4 and a normal leaf phenotype thereafter. Plant growth was also delayed and there were fewer tillers per plant than in the wild type. The chlorotic leaf phenotype is associated with decreased pigment levels and aberrant chloroplasts. At heading stage, the uppermost leaves are slightly chlorotic and immature panicles display a degree of whitening. We showed that the symptoms were caused by a mutation in a single gene locus that was fine-mapped to a 62.4 kb region in chromosome 12. Sequence analysis demonstrated that a single base mutation had occurred in the gene we named as YSS2 and subsequently showed to encode a nucleoside diphosphate kinase 2 (NDPK2) with high similarity to NDPKs in other species. Expression analysis showed that YSS2 was highly expressed in L4 tissues, the key time of chloroplast biogenesis. Subcellular localization showed that YSS2 is a chloroplast-associated protein. These results implied that YSS2 plays important roles in chloroplast biogenesis.

Materials and Methods

Plant materials and growth conditions

The white leaf and panicle mutant yss2 was identified in an MNU-mutagenized population of japonica cultivar Nongyuan 238. Plants were grown in a growth chamber or paddy fields. Crosses between the yss2 mutant and Nongyuan 238 or Nanjing 11 were separately used for genetic analysis and gene mapping. Seeds of cultivars Nongyuan 238 and Nanjing 11 were obtained from the Chinese National Key Facility for Crop Gene Resources and Genetic Improvement in Beijing.

Determination of pigment contents

Chls and Car were assayed spectrophotometrically according to methods described previously (Zhou et al., 2013). Leaf samples were collected from second, third, fourth or fifth leaves at the L4 or L6 growth stages and separately marinated in 95% ethanol for 48 h in darkness. Absorbance of supernatants was measured with a DU 800 UV/Vis Spectrophotometer (Beckman Coulter) at 665, 649 and 470 nm.

Transmission electron microscopy (TEM)

Leaf samples were prepared for TEM from green and white sections of third leaves in yss2 mutant and from similar positions of wild type at the fully expanded L3 stage. Transverse sections of leaves were fixed in a solution of 2.5% glutaraldehyde and then incubated in 1% OsO₄ overnight at 4 °C. After staining with uranyl acetate, tissues were dehydrated through an ethanol series, and embedded in Spurr's medium before ultrathin sectioning. Samples were air-dried, stained again and observed with a Hitachi H-7650 transmission electron microscope.

Mapping of YSS2

Following initial mapping of the YSS2 locus between Indel/SSR markers ID12-8 and RM3331 on chromosome 12 using 35 F₂ mutant segregants, an additional 1,216 F₂ plants with striated leaf phenotype were used for fine-mapping. High-density Indel markers were developed based on sequence differences between cv. Nipponbare (japonica) and 93-11 (indica). Primer pairs designed with Primer Premier 5.0 are listed in Table 1. Full-length cDNA and genomic DNA of the predicted ORFs in wild type and yss2 mutant were amplified and sequenced.

Table 1
Primer sequences used in this study.

Mapping primers
Name	Forward sequence (5′-3′)	Reverse sequence (5′-3′)
ID12-7	GTGGCTGTTTAGGAGCGTTT	CAACCAAACAGCAATGCAAC
ID12-8	CCTAGTTCAGCTCCTGCTTACC	GCAGAAGAGAAGTTGTGTGTCG
F41-5	TGCTCGAAATAATTGCTTGTTGG	CATGGGCGGAAGGTAGGGA
F41-18	AGAGCAGGTAACATAAGCAAAC	ATCCGAATACTTCCCTCACA
F41-22	GAAGATTTCGCTCGCCTGTT	TCCATGTCGAACCATTAGCA
F41-25	CGATCATGGTGGTTGGTCA	CTGGGTTCAAATCTCAAAATTAGT
F41-35	TCTCCTCCTAGCCCTGTC	GGTGCGGATTAACCTATT
F41-37	CCGTATGCAAGGTTGGATAG	TATGACTTTGACCCTTTGCC
F41-44	AGCCAACTCCCAAGAACAA	CCCACGCTGAGTAGATGGT
F41-48	CCAAAGGGTGCTTATTATTTAGTC	GCTGCCTGTCTGCTTCCAT
F41-55	AAATCGTGGGAGGGAATAAACA	GCGCCGCCATCATTGACC
Primers for quantitative RT-PCR and subcellular localization
Name	Forward sequence (5′-3′)	Reverse sequence (5′-3′)
YSS2-RT1	GCGTCGTCGGTTGAGCAAT	AGTGCTCCTGTGCCAAGTCC
PORA	ATCACCAAGGGCTACGTCTC	GAGTTGTTGTTCCAGCTCCA
HEMA1	CACCAGTCTGAATCATAT	CTACCACTTCTCTAATCC
YGL1	TGGACAGTTGAAGATGTT	GAATAGGACGGTAAGGTT
CHLI	AGTAACCTTGGTGCTGTG	AATCCATCAACATTCAACTCTG
CHLH	CTATACATTCGCCACACT	TATCACACAACTCCCAAG
CHLD	GGAAAGAGAGGGCATTAG	CAATACGATCAAGTAAGTGTT
rbcL	GTTGAAAGGGATAAGTTGA	AATGGTTGTGAGTTTACG
rbcS	TCATCAGCTTCATCGCCTAC	ACTGGGAACACACGAAACAA
psbA	AAGTTTCTCTGATGGTATG	ATAGCACTGAATAGGGAA
LHCP	GTTCTCCATGTTCGGCTTCT	GACGAAGTTGGTGGCGTAG
psaB	TTGGTATTGCTACCGCACAT	CCGGACGTCCATAGAAAGAT
psbB	TCATATTGCTGCGGGTACAT	AGTTGCTGACCCATACCACA
psbC	TACAACCTTGGCAAGAACGA	TACGCCACCCACAGAATTTA
FtsZ	GTTGGTGTTTCTTCCAGCAA	CCTCAATAGACGACCCGATT
RpoTp	AAGTCTGGCTTACGCTGGTT	AGGATCCTCAGCATTCATCC
rpoA	AAATCGTTGATACGGCACAA	ATTCACATTTCGAACAGGCA
rpoB	GCATTGTTGGAACTGGATTG	GCCGATGGGTAACTAAAGGA
Ubq	GCTCCGTGGCGGTATCAT	CGGCAGTTGACAGCCCTAG
YSS2-GFP	TTTCTAGAATGGACGCCATGGCCGT	CGGGATCCCTCTACAAGCCATGGTGT

Quantitative real-time RT-PCR

Total RNA was extracted from wild-type and yss2 seedlings using an RNA Prep Pure Plant kit (Tiangen) and reverse-transcribed using a SuperScript II kit (TaKaRa). Real-time RT-PCR was performed using a SYBR^® Premix Ex Taq^TM kit (TaKaRa) on a LightCycler 480 Real-Time PCR System (Roche). The 2^-ΔΔCT method was used to analyze relative gene expression (Livak and Schmittgen, 2001). Primers for real-time RT-PCR (YSS2-RT1, PORA, HEMA1, YGL1, CHLI, CHLH, CHLD, rbcL, rbcS, psbA, LHCP, psaB, psbB, psbC, FtsZ, RpoTP, rpoA and rpoB), listed in Table 1, were designed by GenScript (https://www.genscript.com/ssl-bin/app/primer). The ubiquitin gene (LOC_Os03g13170) (Ubq) was used as a reference control.

Sequence and phylogenetic analysis

Candidate genes were predicted by the RGAP database (http://rice.plantbiology.msu.edu/cgi-bin/gbrowse/rice/). Homologous sequences of YSS2 were identified using the blastp search mode at NCBI (http://www.ncbi.nlm.nih.gov/) and sequences were aligned with BioEdit software. A neighbor-joining tree based on 1,000 bootstrap replicates was generated using MEGA v4.1 software. Expression profiles of YSS2, OsNDPK1 (LOC_Os07g30970) and OsNDPK3 (LOC_Os05g51700) were obtained from the RiceXPro database (http://ricexpro.dna.affrc.go.jp/). Subcellular localization of YSS2 was predicted using the ChloroP (Emanuelsson et al., 1999) and TargetP (Emanuelsson et al., 2000) programs.

Subcellular localization

The coding sequence of YSS2 was amplified and cloned to the N-terminus of GFP in the transient expression vector pA7-GFP (primer pairs shown in Table 1). Fusion plasmid YSS2-GFP and free GFP were separately transformed into rice protoplasts and incubated in darkness at 28 °C for 16 h before examination (Chiu et al., 1996; Chen et al., 2006; Zhou et al., 2013, 2017). GFP fluorescence was observed with a confocal laser scanning microscope (Carl Zeiss LSM700).

Results

Phenotypic characterization of the yss2 mutant

The yss2 mutant was originated from an N-methyl-N-nitrosourea (MNU) mutagenized population of japonica cultivar (cv.) Nongyuan 238. The mutant seedlings displayed a striated leaf phenotype in seedling leaves 2 to 4 under paddy field conditions (Figure 1A,B). However, the fifth and later leaves had normal green phenotype (Figure 1C,D). The yss2 mutant showed delayed seedling growth compared to wild type (Figure 1A-D). To further characterize the mutant, we determined the pigment levels of chlorotic leaves at the four- and six-leaf stages. These leaves had reduced Chl a, Chl b and Car contents relative to the wild type (Figure 1E,F). However, from leaf 5 there was no obvious difference from wild type (Figure 1F). The height of yss2 seedlings was less than the wild type (Figure 1A-D, G). At the maximum tillering stage, the yss2 mutant was phenotypically similar to wild type except for reduced height (Figure 1H). The yss2 mutant later developed a slight chlorotic leaf phenotype and white panicles at heading, but plant height was restored to the wild-type level (Figure 1I-L).

Figure 1
Phenotypic characteristics of the yss2 mutant. Wild type and yss2 mutant plants at the four-leaf (A, B) and six-leaf (C, D) stages in a paddy field. Bars, 5 cm. Pigment contents of the wild-type and yss2 mutant plants in different leaf sections at the four-leaf (E) and six-leaf (F) stages (e.g., L4-2, L4-3 separately represent the second and third leaves at the L4 growth stage). Values are means ± SD from three independent determinations. (G) Heights of wild type and yss2 mutant at the six-leaf stage. Values are means ± SD from five independent repeats. (H) Phenotypes of wild type and yss2 mutant at the maximum tillering stage. Bar, 10 cm. (I, J) The yss2 mutant exhibiting striated leaves and white panicles after heading. (K, L) Tiller numbers and plant heights of wild type and yss2 mutant after heading. Electron micrographs showing ultrastructures of chloroplasts from leaf 3 of wild type (M) as well as the green (N) and chlorotic sections (O, P) of leaf 3 in the yss2 mutant at the three-leaf stage. Cp, chloroplast; TM, thylakoid membrane

To investigate the effect of yss2 on chloroplast development we compared the ultrastructures of chloroplasts in yss2 mutant and wild type seedlings using TEM. The chloroplasts of green sections (basal section) of yss2 leaves had well-developed lamellar structures with normally stacked grana and thylakoid membranes similar to wild type plants (Figure 1M,N); however, chloroplasts in the white segments were undifferentiated (Figure 1O,P). Collectively, our data showed that the yss2 mutation caused a chlorotic defect that disrupted chloroplast development and delayed seedling growth.

Cloning of the YSS2 gene

For genetic analysis of the YSS2 locus, reciprocal crosses between yss2 mutant and Nongyuan 238 were made to determine the mode of inheritance of the yss2 phenotype. F₁ plants showed the wild type phenotype, and the F₂ populations segregated 3 green : 1 stripe (Table 2). Thus the yss2 phenotype was caused by a single recessive nuclear gene.

Table 2
Segregation of green and striated seedlings in F₂ populations from two crosses.

Cross	No. green plants	No. stripe plants	χ2 3:1a
yss2/ Nongyuan238	455	140	0.686
Nongyuan238/ yss2	336	104	0.436
Pooled	791	244	0.446

• ^a
  Value for significance at p = 0.05 and 1 df is 3.84

A mapping population was generated from cross yss2/ Nanjing 11. Thirty-five F₂ individuals with typical yss2 striated characteristics were used to map the YSS2 locus to a 5.4 Mb region between markers ID12-8 and RM3331 on chromosome 12L (Figure 2A). With 1,216 homozygous F₂ mutant individuals we narrowed the region to a 62.4 kb interval between Indel markers F41-37 and F41-55 (Figure 2B). The interval contained ten ORFs and the genes within it were predicted using the RGAP database (http://rice.plantbiology.msu.edu/) (Figure 2C, Table 3). Sequence analysis showed that the eighth ORF (designated nucleoside diphosphate kinase; LOC_Os12g36194) in the yss2 mutant carried a single nucleotide change (G to A) in the second exon relative to wild type, resulting in an amino acid change from Gly to Asp at position 83 (Figure 2D,E). To verify the mutation in the YSS2 gene, 15 green and five striated seedlings from the yss2/ Nanjing11 F₂ population were sequenced and examined for presence of Gly or Asp at position 83. All five striated individuals carried only Asp, the four green seedlings carried only Gly, and the other 11 green seedlings were heterozygous, carrying both Gly and Asp. This provided evidence that the amino acid change was responsible for the mutant phenotype.

Figure 2
Positional cloning of the YSS2 gene. (A) The yss2 locus was mapped to a 5.4 Mb region between Indel/SSR markers ID12-8 and RM3331 on chromosome 12L. (B) The yss2 locus was narrowed to a 62.4 kb interval between Indel markers F41-37 and F41-55 using 1,216 F₂ homozygous mutant plants. (C) Ten ORFs were predicted in the region. (D) Schematic of ORF8 structure. ATG and TAA represent the start and stop codons, respectively. Gray boxes indicate 5' and 3' UTR. Black boxes and lines between them separately indicate exons and introns. The NDPK domain is indicated. The yss2 mutant has a single G to D change in the eighth ORF. The mutation site is indicated by a red arrowhead. The single nucleotide change led to a Gly (G) to Asp (D) substitution. (E) Chromatograms from sequencing of wild type and yss2 genomic DNA. Black frame indicates the mutation site

Table 3
Gene prediction within the 62.4 kb region delimited by markers.

Gene	Orientation	Annotation
LOC_Os12g36120	Forward	Retrotransposon protein, putative
LOC_Os12g36130	Forward	Expressed protein
LOC_Os12g36140	Reverse	Retrotransposon protein, putative
LOC_Os12g36150	Reverse	Retrotransposon protein, putative
LOC_Os12g36160	Reverse	Expressed protein
LOC_Os12g36170	Reverse	HEAT repeat family protein, putative
LOC_Os12g36180	Reverse	Auxilin, putative
LOC_Os12g36194	Forward	Nucleoside diphosphate kinase, putative
LOC_Os12g36210	Reverse	Inhibitor I family protein, putative
LOC_Os12g36220	Reverse	Inhibitor I family protein, putative

YSS2 encodes nucleoside diphosphate kinase 2

The YSS2 allele with seven exons and six introns encodes a polypeptide of 220 amino acid residues with a predicted molecular mass of 23.5 kDa (Figure 2D). The predicted structure indicated that the YSS2 protein contained an NDPK domain covering amino acid residues 73–207 (Figure 3). The YSS2 protein exhibited high similarity to NDPK superfamily proteins in other species across a region of nearly 150 amino acids in the C-terminus. Sequence alignment showed that the Gly⁸³ site is highly conserved in NDPK proteins (Figure 3), suggesting that the site has an essential role.

Figure 3
Amino acid sequence alignment of YSS2-related proteins. Conserved residues are shaded. Sequences are for OsNDPK2/YSS2 (Oryza sativa, LOC_Os12g36194), Osyss2 (the mutated YSS2 protein), AtNDPK2 (Arabidopsis thaliana, At5g63310), OsNDPK1 (Oryza sativa, LOC_Os07g30970), AtNDPK1 (Arabidopsis thaliana, NP_567346.1), OsNDPK3 (Oryza sativa, LOC_Os05g51700), AtNDPK3 (Arabidopsis thaliana, At4g11010), Zea mays NP_001150161.1, Nicotiana tabacum NP_001311894.1, Glycine max NP_001241517.1, Picea sitchensis ADE77887.1, Physcomitrella patens XP_001752612.1. Blue underlining represents the NDPK domain of NDPK-related proteins. A red arrow indicates the substituted amino acid in yss2.

Phylogenetic analysis revealed that YSS2-like proteins broadly exist in many photosynthetic organisms and likely evolved from the cyanobacteria to angiosperms, thereby forming a large subclade, in which orthologs from monocots and dicots are clearly separated (Figure 4). This suggests that YSS2 is an evolutionarily conserved protein evolved from prokaryotic to eukaryotic genomes.

Figure 4
Phylogenetic analysis of YSS2 and its related proteins. OsYSS2 is indicated by an asterisk. Ptr, Populus trichocarpa; Rc, Ricinus communis; Tc, Theobroma cacao; Cs, Camelina sativa; At, Arabidopsis thaliana; Lj, Lotus japonicas; Gm, Glycine max; Vv, Vitis vinifera; Eg, Elaeis guineensis; Pd, Phoenix dactylifera; Nn, Nelumbo nucifera; Dh, Dorcoceras hygrometricum; Nt, Nicotiana tabacum; St, Solanum tuberosum; Sp, Solanum pennellii; Ca, Capsicum annuum; Ns, Nicotiana sylvestris; Os, Oryza sativa, Ob, Oryza brachyantha; Bd, Brachypodium distachyon; Tu, Triticum urartu; Zm, Zea mays; Sb, Sorghum bicolor; Si, Setaria italic; Ps, Picea sitchensis; Pp, Physcomitrella patens

Gene expression analysis

The expression profiles of OsYSS2, OsNDPK1 and OsNDPK3 were predicted using the Rice Expression Profile Database. YSS2 was expressed in various organs at different growth stages with higher levels in leaf sheaths, stems and ovaries. Overall expression levels were lower than for other NDPKs (Figure 5). OsNDPK1 was mostly expressed in flag leaves, leaf sheaths and roots at the vegetative stage and in stems and ovaries at flowering. OsNDPK3 was highly expressed in all tissues at different developmental stages (Figure 5).

Figure 5
Expression analysis of YSS2, OsNDPK1 and OsNDPK3 at various growth stages. Data were collected from the rice expression profile database, RiceXPro.

To investigate the expression profile of YSS2 during the process of chloroplast biogenesis, we detected the YSS2 transcripts in different sections of wild type seedlings at the L3 stage. The YSS2 accumulated more in L4 tissues than in leaf 3 and shoot base, and the expression levels were gradually increased with the elongation of leaf 4 (Figure 6A,B). The data revealed that YSS2 was highly expressed in the second step of chloroplast biogenesis.

Figure 6
Expression analysis of YSS2 and genes associated with Chl biosynthesis, photosynthesis and chloroplast biogenesis. (A) Diagram of rice seedling at the L3 stage in which the leaf 3 was fully expanded. SB (shoot base) indicates a 2 mm piece from the bottom of shoot. L2, L3 and L4 (inside L3 sheath) respectively indicate the second, third, and fourth leaf at the L3 stage. (B) Expression analysis of YSS2 in SB, L4-2cm, L4-4cm, L4-6cm, L4-8cm, and L3 of wild type seedlings at the L3 stage grown in a paddy field. L4-2cm, L4-4cm, L4-6cm, and L4-8cm represent 2cm, 4cm, 6cm, and 8cm pieces from the bottom of shoot, respectively. (C, D and E) Real-time RT-PCR analysis of genes involved in Chl biosynthesis, photosynthesis and chloroplast biogenesis. Total RNA was extracted from leaf 3 of wild type and yss2 mutant at the three-leaf stage in a paddy field. The ubiquitin gene was used as an internal control. Data are means ± SD of three replicates. **p = 0.01 and *p = 0.05, by Student's t test.

Given the phenotypic difference between the yss2 mutant and wild type seedlings, we compared the expression levels of genes associated with Chl biosynthesis, photosynthesis and chloroplast biogenesis. Expression levels of Chl biosynthesis-related genes, such as PORA (encoding NADPH-dependent protochlorophyllide oxidoreductase), HEMA1 (encoding glutamyl tRNA reductase), YGL1 (encoding Chl synthetase), CHLI and CHLD (encoding Mg-chelatase I and D subunits) were clearly decreased in yss2 seedlings compared to wild type. However, there was no difference in expression of CHLH (encoding Mg-chelatase H subunit) (Figure 6C). Expression of genes involved in photosynthesis, such as rbcL and rbcS (encoding large and small subunits of Rubisco), psbA, psbB and psbC (encoding PSII subunits), LHCP (encoding PSII-associated light-harvesting chlorophyll protein) and psaB (encoding PSI subunit) was distinctly down-regulated in the mutant (Figure 6D). Genes required for the first (FtsZ, encoding a component of the plastid division machinery) and second (RpoTP, rpoA and rpoB, separately encoding NEP, and PEP α and β subunits) steps of chloroplast biosynthesis were up-regulated in the yss2 mutant compared to wild type (Figure 6E). These data suggested that the YSS2 is involved in the regulatory network of Chl biosynthesis and photosynthesis as well as chloroplast formation.

Subcellular localization of YSS2

TargetP (Emanuelsson et al., 2000) and ChloroP (Emanuelsson et al., 1999) softwares predicted that YSS2 localizes to chloroplasts and contains a chloroplast-targeting signal of 68 amino acid residues. To detect the actual localization of YSS2, free GFP and YSS2-GFP fusion proteins were each transiently expressed in rice protoplasts. Confocal microscopy confirmed that free GFP was dispersed in the cytoplasm (Figure 7A), whereas YSS2-GFP co-localized with Chl autofluorescence and displayed punctate structures (Figure 7B). The data showed that YSS2 is a chloroplast-associated protein.

Figure 7
Subcellular location of YSS2. (A) Free GFP signals in rice protoplasts. (B) Transient expression of YSS2-GFP fusion proteins in rice protoplasts. GFP: GFP signals of free GFP and YSS2; Bright: bright field; Auto: chlorophyll autofluorescence; Merged: merged image.

Discussion

A number of Chl-deficient and chloroplast development-associated mutants were recently identified in rice. Some of them show chlorotic phenotypes in young seedlings or young leaves and later develop normally, such as ysa, ylc1, yss1 and wsl (Su et al., 2012; Zhou et al., 2013, 2017; Tan et al., 2014). However, some mutants (ygl1 and vyl) display the mutant phenotype and delayed plant growth throughout the entire life cycle (Wu et al., 2007; Dong et al., 2013). This contrasted with the am1 mutant that also exhibited a chlorotic leaf phenotype throughout the life cycle but with little effect on plant development (Sheng et al., 2014). The ygl2 or grc1 mutants showed yellow-green seedling leaf phenotypes but gradually reverted to almost normal green leaves from the tillering stage; both mutants showed delayed plant growth (Chen et al., 2013; Li et al., 2013). wp1 and wlp1 mutants both displayed chlorotic leaves accompanied by white panicles. The relatively weak wp1 mutant had a virescent phenotype and developed white panicles (Wang et al., 2016). The wlp1 mutant produced albinic leaves until the four-leaf stage but became green at L4 and thereafter; a white panicle appeared at heading (Song et al., 2013). The present white leaf and panicle mutant yss2 showed a striated/chlorotic phenotype at L2, L3 and L4, but normal green leaves at leaf 5 and thereafter. The normal leaf phenotype in yss2 persisted until maximum tillering, somewhat like wlp1 mutant, a slight chlorotic leaf phenotype developed along with white panicles (Figure 1H-K). The chlorotic phenotype presented in young seedlings and panicles suggested that YSS2 might play key roles in young tissues. Genes associated with plastid transcription/translation were largely regulated in wlp1 mutant (Song et al., 2013). Similarly, wp1 impaired chloroplast ribosome biogenesis and reduced plastidic protein synthesis (Wang et al., 2016). We observed that yss2 mutant has phenotypes in seedlings and panicles similar to wp1 and wlp1, suggesting that YSS2 might function at the plastid transcription and translation stages, but further studies are needed for confirmation.

YSS2 was mapped to a 62.4 kb interval on chromosome 12L and 10 ORFs were predicted in the region (Figure 2A-C). Genomic sequence analysis revealed that the only change in the mutant was in the 8^th ORF of YSS2 and was a single base mutation causing an amino acid substitution of Gly by Asp at position 83 (Figure 2D,E). YSS2 was highly expressed in the second step of chloroplast biogenesis, indicating that YSS2 might directly participate in chloroplast formation. Subcellular localization showed that YSS2 is a chloroplast-associated protein (Figure 7B). These data implied that the yss2 mutation might hinder chloroplast biogenesis during early leaf and panicle development, leading to the chlorotic phenotype in young seedlings and panicles. However, we cannot rule out the possibility that YSS2 also has important roles in development of other types of plastids. This is supported by the fact that YSS2 is expressed in non-green tissues (Figure 5). Although there was delayed plant growth and reduced height at the seedling stage the eventual plant height at maturity was similar to the wild type (Figure 1G,L), suggesting that YSS2 paralogs sufficiently compensate for YSS2 function at some growth stages. Expression analysis showed that the housekeeping genes (rpoA and rpoB) and photosynthetic genes (such as rbcL, psbA and psaB) were separately up- and down-regulated in yss2 mutant (Figure 6B,C), suggesting that yss2 might decrease PEP activity and suppress plastid transcription. The dramatically elevated levels of rpo genes and decreased expression of photosynthetic genes indicated that the mutants lacked chloroplast ribosomes or reduced plastid DNA contents (Hess et al., 1993; Udy et al., 2012). We also observed that genes involved in Chl biosynthesis and chloroplast biogenesis were differently regulated (Figure 6C-E), implying that YSS2 might have important roles in the regulatory network of both. Nevertheless, the reduced expression of genes for Chl biosynthesis is not strong and could be an indirect effect such as retrograde plastid-to-nucleus signaling that disturbs the expression of nuclear-encoded chloroplast genes (Mochizuki et al., 2001; Nott et al., 2006).

It has been reported that NDPKs regulate the metabolic balance between NTPs and NDPs by catalyzing the transfer of phosphate groups and are involved in cell growth and division, embryo and seed development, signal transduction and plant stress response (Yano et al., 1995; Nato et al., 1997; Zimmermann et al., 1999; Moon et al., 2003; Ryu et al., 2005; Dorion et al., 2006). Guanylate kinase (GK) functions in guanine nucleotide metabolism pathways by catalyzing the phosphorylation of (d)GMP to (d)GDP. GK is involved in maintenance of guanine nucleotide pools required for many metabolic processes. A rice GK gene, V2, was found to participate in chloroplast biogenesis (Sugimoto et al., 2007). This provides the possibility that YSS2 is involved in chloroplast biogenesis and that the yss2 mutation disrupts the metabolic balance between NTPs and NDPs, a consequence of which is impaired photosynthesis and hindered plant growth. Sequence alignment and phylogenetic analysis revealed that YSS2 is an evolutionarily conserved protein with a NDPK domain. The amino acid Gly in the NDPK domain is highly conserved in all NDPK proteins (Figures 3 and 4). It seems that the amino acid change disrupts the integrity of the NDPK domain thereby affecting YSS2 function. OsNDPK1, OsNDPK2 and OsNDPK3 were reported to localize in cytoplasm, chloroplasts and mitochondria, respectively (Bolter et al., 2007; Kihara et al., 2011). These proteins share highly similar amino acid sequences in the NDPK domain, implying that NDPK proteins possess similar functions in different cell compartments. This is the first report that a NDPK protein participates in regulation of Chl biosynthesis and chloroplast biogenesis. Further research on the YSS2 protein could provide new insights into understanding how it participates in these functions, as well as in plant growth.

Acknowledgments

This work was supported by grants from the Natural Science Foundation of Anhui Province (1408085MKL62), the Youth Innovation Fund of Anhui Academy of Agricultural Sciences (16B0101), the 863 Program of China (2014AA10A604-17), and the Key Research and Development Program of China (2016YFD0100101-06). We thank Dr. Bing Hu (Nanjing Agricultural University) for assistance with transmission electron microscopy.

References

• Bolter B, Sharma R and Soll J (2007) Localisation of Arabidopsis NDPK2 - Revisited. Planta 226:1059-1065.
• Börner T, Aleynikova AY, Zubo YO and Kusnetsov VV (2015) Chloroplast RNA polymerases: Role in chloroplast biogenesis. BBA-Bioenergetics 1847:761-769.
• Chen H, Cheng ZJ, Ma XD, Wu H, Liu YL, Zhou KN, Chen YL, Ma WW, Bi JC, Zhang X, et al. (2013) A knockdown mutation of YELLOW-GREEN LEAF2 blocks chlorophyll biosynthesis in rice. Plant Cell Rep 32:1855-1867.
• Chen S, Tao L, Zeng L, Vega-Sanchez ME, Umemura K and Wang GL (2006) A highly efficient transient protoplast system for analyzing defence gene expression and protein-protein interactions in rice. Mol Plant Pathol 7:417-427.
• Chiu W, Niwa Y, Zeng W, Hirano T, Kobayashi H and Sheen J (1996) Engineered GFP as a vital reporter in plants. Curr Biol 6:325-330.
• Dong H, Fei GL, Wu CY, Wu FQ, Sun YY, Chen MJ, Ren YL, Zhou KN, Cheng ZJ, Wang JL, et al. (2013) A rice virescent-yellow leaf mutant reveals new insights into the role and assembly of plastid caseinolytic protease in higher plants. Plant Physiol 162:1867-1880.
• Dorion S, Matton DP and Rivoal J (2006) Characterization of a cytosolic nucleoside diphosphate kinase associated with cell division and growth in potato. Planta 224:108-124.
• Emanuelsson O, Nielsen H and von Heijne G (1999) ChloroP, a neural network-based method for predicting chloroplast transit peptides and their cleavage sites. Protein Sci 8:978-984.
• Emanuelsson O, Nielsen H, Brunak S and von Heijne G (2000) Predicting subcellular localization of proteins based on their N-terminal amino acid sequence. J Mol Biol 300:1005-1016.
• Hasunuma K, Yabe N, Yoshida Y, Ogura Y and Hamada T (2003) Putative functions of nucleoside diphosphate kinase in plants and fungi. J Bioenerg Biomembr 35:57-65.
• Hess WR, Prombona A, Fieder B, Subramanian AR and Börner T (1993) Chloroplast rps15 and the rpoB/C1/C2 gene cluster are strongly transcribed in ribosome-deficient plastids: Evidence for a functioning non-chloroplast-encoded RNA polymerase. EMBO J 12:563-571.
• Hricová A, Quesada V and Micol JL (2006) The SCABRA3 nuclear gene encodes the plastid RpoTp RNA polymerase, which is required for chloroplast biogenesis and mesophyll cell proliferation in Arabidopsis. Plant Physiol 141:942-956.
• Hwang SR and Tabita FR (1989) Cloning and expression of the chloroplast-encoded rbcL and rbcS genes from the marine diatom Cylindrotheca sp. strain N1. Plant Mol Biol 13:69-79.
• Kawasaki S, Borchert C, Deyholos M, Wang H, Brazille S, Kawai K, Galbraith D and Bohnert HJ (2001) Gene expression profiles during the initial phase of salt stress in rice. Plant Cell 13:889-905.
• Kihara A, Saburi W, Wakuta S, Kim M-H, Hamada S, Ito H, Imai R and Matsui H (2011) Physiological and biochemical characterization of three nucleoside diphosphate kinase isozymes from rice (Oryza sativa L.) Biosci Biotechnol Biochem 75:1740-1745.
• Kusumi K, Chono Y, Shimada H, Gotoh E, Tsuyama M and Iba K (2010) Chloroplast biogenesis during the early stage of leaf development in rice. Plant Biotechnol 27:85-90.
• Kusumi K, Sakata C, Nakamura T, Kawasaki S, Yoshimura A and Iba K (2011) A plastid protein NUS1 is essential for build-up of the genetic system for early chloroplast development under cold stress conditions. Plant J 68:1039-1050.
• Li JQ, Wang YH, Chai JT, Wang LH, Wang CM, Long WH, Wang D, Wang YH, Zheng M, Peng C, et al. (2013) Green-revertible chlorina 1 (grc1) is required for the biosynthesis of chlorophyll and the early development of chloroplasts in rice. J Plant Biol 56:326-335.
• Livak KJ and Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2^-ΔΔCT method. Methods 25:402-408.
• Mochizuki N, Brusslan JA, Larkin R, Nagatani A and Chory J (2001) Arabidopsis genomes uncoupled 5 (GUN5) mutant reveals the involvement of Mg-chelatase H subunit in plastid-to-nucleus signal transduction. Proc Natl Acad Sci U S A 98:2053-2058.
• Moon H, Lee B, Choi G, Shin D, Prasad T, Lee O, Kwak S-S, Kim DH, Nam J, Bahk J, et al. (2003) NDP kinase 2 interacts with two oxidative stress-activated MAPKs to regulate cellular redox state and enhances multiple stress tolerance in transgenic plants. Proc Natl Acad Sci U S A 100:358-363.
• Mullet JE (1993) Dynamic regulation of chloroplast transcription. Plant Physiol 103:309-313.
• Nato A, Mirshahi A, Tichtinsky G, Mirshahi M, Faure JP, Lavergne D, De Buyser J, Jean C, Ducreux G and Henry Y (1997) Immunological detection of potential signal-transduction proteins expressed during wheat somatic tissue culture. Plant Physiol 113:801-807.
• Nelson N and Yocum CF (2006) Structure and function of photosystems I and II. Annu Rev Plant Biol 57:521-565.
• Nott A, Jung HS, Koussevitzky S and Chory J (2006) Plastid-to-nucleus retrograde signaling. Annu Rev Plant Biol 57:739-759.
• Pfalz J and Pfannschmidt T (2013) Essential nucleoid proteins in early chloroplast development. Trends Plant Sci 18:186-194.
• Reumann S, Inoue K and Keegstra K (2005) Evolution of the general protein import pathway of plastids (review). Mol Membr Biol 22:73-86.
• Ryu JS, Kim JI, Kunkel T, Kim BC, Cho DS, Hong SH, Kim S-H, Fernandez AP, Kim Y, Alonso JM, et al. (2005) Phytochrome-specific type 5 phosphatase controls light signal flux by enhancing phytochrome stability and affinity for a signal transducer. Cell 120:395-406.
• Sakamoto W, Miyagishima S and Jarvis P (2008) Chloroplast biogenesis: Control of plastid development, protein import, division and inheritance. The Arabidopsis Book 6:e0110.
• Sheng PK, Tan JJ, Jin MN, Wu FQ, Zhou KN, Ma WW, Heng YQ, Wang JL, Guo XP, Zhang X, et al. (2014) Albino midrib 1, encoding a putative potassium efflux antiporter, affects chloroplast development and drought tolerance in rice. Plant Cell Rep 33:1581-1594.
• Song J, Wei XJ, Shao GN, Sheng ZH, Chen DB, Liu CL, Jiao GA, Xie LH, Tang SQ and Hu PS (2013) The rice nuclear gene WLP1 encoding a chloroplast ribosome L13 protein is needed for chloroplast development in rice grown under low temperature conditions. Plant Mol Biol 84:301-314.
• Steiner S, Schroter Y, Pfalz J and Pfannschmidt T (2011) Identification of essential subunits in the plastid-encoded RNA polymerase complex reveals building blocks for proper plastid development. Plant Physiol 157:1043-1055.
• Su N, Hu ML, Wu DX, Wu FQ, Fei GL, Lan Y, Chen XL, Shu XL, Zhang X, Guo XP, et al. (2012) Disruption of a rice pentatricopeptide repeat protein causes a seedling-specific albino phenotype and its utilization to enhance seed purity in hybrid rice production. Plant Physiol 159:227-238.
• Sugimoto H, Kusumi K, Tozawa Y, Yazaki J, Kishimoto N, Kikuchi S and Iba K (2004) The virescent-2 mutation inhibits translation of plastid transcripts for the plastid genetic system at an early stage of chloroplast differentiation. Plant Cell Physiol 45:985-996.
• Sugimoto H, Kusumi K, Noguchi K, Yano M, Yoshimura A and Iba K (2007) The rice nuclear gene, VIRESCENT 2, is essential for chloroplast development and encodes a novel type of guanylate kinase targeted to plastids and mitochondria. Plant J 52:512-527.
• Tan J, Tan Z, Wu F, Sheng P, Heng Y, Wang X, Ren Y, Wang J, Guo X, Zhang X, et al. (2014) A novel chloroplast-localized pentatricopeptide repeat protein involved in splicing affects chloroplast development and abiotic stress response in rice. Mol Plant 7:1329-1349.
• TerBush AD, Yoshida Y and Osteryoung KW (2013) FtsZ in chloroplast division: Structure, function and evolution. Curr Opin Cell Biol 25:461-470.
• Timmis JN, Ayliffe MA, Huang CY and Martin W (2004) Endosymbiotic gene transfer: Organelle genomes forge eukaryotic chromosomes. Nat Rev Genet 5:123-135.
• Udy DB, Belcher S, Williams-Carrier R, Gualberto JM and Barkan A (2012) Effects of reduced chloroplast gene copy number on chloroplast gene expression in maize. Plant Physiol 160:1420-1431.
• Wang YL, Wang CM, Zheng M, Lyu J, Xu Y, Li XH, Niu M, Long WH, Wang D, Wang HY, et al. (2016) WHITE PANICLE1, a Val-tRNA synthetase regulating chloroplast ribosome biogenesis in rice, is essential for early chloroplast development. Plant Physiol 170:2120-2123.
• Wu Z, Zhang X, He B, Diao L, Sheng S, Wang J, Guo X, Su N, Wang L, Jiang L, et al. (2007) A chlorophyll deficient rice mutant with impaired chlorophyllide esterification in chlorophyll biosynthesis. Plant Physiol 145:29-40.
• Yano A, Umeda M and Uchimiya H (1995) Expression of functional proteins of cDNA encoding rice nucleoside diphosphate kinase (NDK) in Escherichia coli and organ-related alteration of NDK activities during rice seed germination (Oryza sativa L.). Plant Mol Biol 27:1053-1058.
• Yoo SC, Cho SH, Sugimoto H, Li J, Kusumi K, Koh HJ, Iba K and Paek NC (2009) Rice Virescent3 and Stripe1 encoding the large and small subunits of ribonucleotide reductase are required for chloroplast biogenesis during early leaf development. Plant Physiol 150:388-401.
• Zhou KN, Ren YL, Lv J, Wang YH, Liu F, Zhou F, Zhao SL, Chen SH, Peng C, Zhang X, et al. (2013) Young Leaf Chlorosis 1, a chloroplast-localized gene required for chlorophyll and lutein accumulation during early leaf development in rice. Planta 237:279-292.
• Zhou KN, Ren YL, Zhou F, Wang Y, Zhang L, Lyu J, Wang YH, Zhao SL, Ma WW, Zhang H, et al. (2017) Young Seedling Stripe1 encodes a chloroplast nucleoid-associated protein required for chloroplast development in rice seedlings. Planta 245:45-60.
• Zimmermann S, Baumann A, Jaekel K, Marbach I, Engelberg D and Frohnmeyer H (1999) UV-responsive genes of Arabidopsis revealed by similarity to the Gcn4-mediated UV response in yeast. J Biol Chem 274:17017-17024.

• Associate Editor: Marcio de Castro Silva Filho

Publication Dates

• Publication in this collection
  31 Aug 2017
• Date of issue
  Jul-Sep 2017

History

• Received
  12 Oct 2016
• Accepted
  30 Mar 2017