Studies in <i>Aspidosperma</i> Mart. &amp; Zucc. (Apocynaceae): Integrating morphology and phylogeny

Teixeira, Carlos Alexandre dos Santos; Castello, Ana Carolina Devides; Pereira, Andreza Stephanie de Souza; Farinaccio, Maria Ana

Acessibilidade / Reportar erro

Brasil

Español English

sumário « anterior atual seguinte »

Sumário

Artigos • Hoehnea 51 • 2024 • https://doi.org/10.1590/2236-8906e812023 copy

Studies in Aspidosperma Mart. & Zucc. (Apocynaceae): Integrating morphology and phylogeny

Authorship SCIMAGO INSTITUTIONS RANKINGS

ABSTRACT

One of the most important genera of Apocynaceae, Aspidosperma presents challenges in species delimitation due to overlapping morphological characters and the large number of synonyms. Thus, we seek to understand the most relevant morphological characters in the delimitation of two sections of the genus (Aspidosperma sect. Aspidosperma and A. sect. Pungentia), confronting hypotheses of primary homology with a molecular phylogenetic study. Character data were obtained from the literature of the genus and confronted in a phylogenetic tree to verify the presence of diagnostic characteristics for sections and species. Our results showed: (1) confirmation of diagnostic characteristics for both sections; (2) the possibility of segregating the typical section into three new sections based on morphological characteristics; (3) the distinction of species traditionally treated as synonyms; (4) the importance of using wood characteristics for the delimitation of genera with wide morphological variation, as is the case of Aspidosperma.

Keywords:
Aspidospermateae; morphological characters; xylem

Tabela 1. Listas dos marcadores moleculares e primers utilizados neste estudo.

Região	Primer	Sequência (5’-3’)	Referências
rpl16	71F 1516R	GCTATGCTTAGTGTGTGACTCGTTG CCCTTCATTCTTCCTCTATGTTG	*Jordan et al., 1996Jordan, W.C., Courtney, M.W. & Neigel, J.E. 1996. Low levels of intraspecific genetic variation at a rapidly evolving chloroplast DNA locus in North American duckweeds (Lemnaceae). American Journal of Botany 83(4): 430-439. Kelchner et Clark, 1997Kelchner, A.S. & Clark, L.G. 1997. Molecular evolution and phylogenetic utility of the chloroplast rpl16 intron in Chusquea and the Bambusoideae (Poaceae). Molecular Phylogenetics and Evolution, 8(3): 385-397. Simões et al., 2006*Simões, A.O. Endress, M.E., van der Niet, T., Kinoshita, L.S. & Conti, E. 2006. Is Mandevilla (Apocynaceae, Mesechiteae) monophyletic? Evidence from five plastid DNA loci and morphology. Annals of the Missouri Botanical Garden 93(4): 565-591.
trnS-G	trnSF trnGR	GCCGCTTTAGTCCACTCAGC GAACGAATCACACTTTTACCAC	Hamilton, 1999Hamilton, M.B. 1999. Four primer pairs for the amplification of chloroplast intergenic regions with intraspecific variation. Molecular Ecology 8(3): 513-525.
nrETS	ETS_2F ETS_451R	CAAATATCCTTGCTTTGTGCAACG GAGACAAGCATATGACTACTGGC	Pereira et al., dados não publicados
nrITS	18S_25F 26S_21R	AAGTCGTAACAAGGTTTCCGT TGCTTAAACTCAGCGGGTAGT	Pereira et al., dados não publicados

Tabela 2. Matriz de caracteres qualitativos das espécies de Aspidosperma Mart. & Zucc. (Apocynaceae). A. Consistência do ritidoma. B. Lenticelas do ritidoma. C. Fissuras no ritidoma. D. Cristas do Ritidoma. E. Forma das cristas. F Posição das cristas. G. Cor do látex. H. Disposição dos râmulos. I. Consistência dos râmulos. J. Lenticelas dos râmulos. K. Fissuras dos râmulos. L. Filotaxia. M. Presença de pecíolo. N. Forma da lâmina. O. Folha espinescente. P. Venação. Q. Tipo de inflorescência. R. Posição da inflorescência. S. Posição da fenda no tubo. T. Formas dos lobos da corola. U. Forma do ovário. V. Indumento do ovário. W. Forma da cabeça estilar. X. Indumento da cabeça estilar. Y. Cor dos folículos. Z. Forma dos folículos. A’. Costas medianas dos folículos. B’. Nervuras costais dos folículos. C’. Lenticelas dos folículos. D’. Mucro dos folículos. E’. Cor das sementes. F’. Forma das sementes. G’. Forma do núcleo seminífero. H’. Posição do núcleo seminífero. I’. Distinção cerne-alburno. J’. Cor da madeira. K’. Textura da madeira. L’. Brilho da madeira. M’. Porosidade do Xilema. N’. Agrupamento dos vasos. O’. Distribuição do parênquima axial. P’. Visibilidade dos anéis de crescimento. Q’. Presença de parênquima marginal. R’. Continuidade da linha de parênquima marginal. S’. Semianel poroso na linha de parênquima marginal.
Table 2. Matrix of qualitative characters of Aspidosperma Mart. & Zucc. (Apocynaceae) species. A. Consistency of the rhytidome. B. Rhytidome lenticels. C. Fissures in the rhytidome. D Rhytidome crests. E. Shape of the ridges. F Position of ridges. G Latex color. H. Arrangement of branches. I. Consistency of branches. J. Branch lenticels. K. Fissures of the branches. L. phyllotaxis. M. Presence of petiole. N. Blade shape. O. Spinescent leaf. P. Venation. Q. Type of inflorescence. R. Inflorescence position. S. Position of the slit in the tube. T. Shapes of the corolla lobes. U. Shape of the ovary. V. Indumentum of the ovary. W. Shape of the stylar head. X. Indument of the stylar head. Y. Color of the follicles. Z. Shape of the follicles. A’. Median sides of the follicles. B’. Costal veins of the follicles. C’. Follicle lenticels. D’. Mucro of the follicles. E’. Seed color. F’. Seed shape. G’. Shape of the seminiferous nucleus. H’. Position of the seminiferous nucleus. I’. Heartwood-sapwood distinction. J’. Wood color. K’. Wood texture. L’. Wood Shine. M’. Xylem porosity. N. Vessel grouping. O’. Distribution of the axial parenchyma. P’. Visibility of growth rings. Q’. Presence of marginal parenchyma. R’. Continuity of the marginal parenchyma line. S’. Porous half-ring at the marginal parenchyma line.

Tabela 2. Matriz de caracteres qualitativos das espécies de Aspidosperma Mart. & Zucc. (Apocynaceae). A. Consistência do ritidoma. B. Lenticelas do ritidoma. C. Fissuras no ritidoma. D. Cristas do Ritidoma. E. Forma das cristas. F Posição das cristas. G. Cor do látex. H. Disposição dos râmulos. I. Consistência dos râmulos. J. Lenticelas dos râmulos. K. Fissuras dos râmulos. L. Filotaxia. M. Presença de pecíolo. N. Forma da lâmina. O. Folha espinescente. P. Venação. Q. Tipo de inflorescência. R. Posição da inflorescência. S. Posição da fenda no tubo. T. Formas dos lobos da corola. U. Forma do ovário. V. Indumento do ovário. W. Forma da cabeça estilar. X. Indumento da cabeça estilar. Y. Cor dos folículos. Z. Forma dos folículos. A’. Costas medianas dos folículos. B’. Nervuras costais dos folículos. C’. Lenticelas dos folículos. D’. Mucro dos folículos. E’. Cor das sementes. F’. Forma das sementes. G’. Forma do núcleo seminífero. H’. Posição do núcleo seminífero. I’. Distinção cerne-alburno. J’. Cor da madeira. K’. Textura da madeira. L’. Brilho da madeira. M’. Porosidade do Xilema. N’. Agrupamento dos vasos. O’. Distribuição do parênquima axial. P’. Visibilidade dos anéis de crescimento. Q’. Presença de parênquima marginal. R’. Continuidade da linha de parênquima marginal. S’. Semianel poroso na linha de parênquima marginal.

Caráter	Estado	A. australe	A. macrocarpon	A. pyrifolium	A. Quebrachobianco	A. quirandy	A. subincanum	A. tomentosum	A. triternatum	A. verbascifolium
A	0 suberous, 1 not suberous	1	0	1	0	0	1	0	1	0
B	0 present, 1 absent	0	1	0	1	1	1	1	1	1
C	0 present, 1 absent	0&1	0	1	0	0	0	0	1	0
D	0 present, 1 absent	1	0	1	0	0	0	0	1	0
E	0 convex, 1 sharp, 2 flat, 3 absent	3	0	3	1&2	0	2	0	3	0&1
F	0 longitudinal, 1 transverse	?	0	?	1	0	1	0	?	?
G	0 white, 1 colorless	0	0	0	1	0	0	0	1	0
H	0 alternate, 1 opposite	0	0	1	0	0	0	0	0	0
I	0 suberous, 1 not suberous	1	1	1	1	1	1	0	1	0
J	0 conspicuous, 1 inconspicuous	0	1	0	0	0	0	1	1	1
K	0 present, 1 absent	1	1	1	1	1	1	0	1	0
L	0 alternate, 1 whorled	0	0	0	1	0	0	0	1	0
M	0 present, 1 absent	0	0	0	0	1	0	1	0	0
N	0 broadly elliptical, 1 oboval, 2 oval, 3 narrowly elliptical	0	0&1	1	3	0	0	0	3	0&2
O	0 present, 1 absent	1	1	1	0	1	1	1	0	1
P	0 brochidodroma, 1 craspedodroma, 2 semi craspedodroma	0	1	0	1	2	0	1	1	1
Q	0 pleiocasio, 1 dicasio, 2 pleiotirso	0	1	1	1	2	1	2	1	0
R	0 terminal, 1 subterminal, 2 axillary	0&1	0&1	1	0&2	0	0	1	0&2	0&1
S	0 lower third, 1 upper third, 2 half	1	0	2	1	1	0	0	0	0
T	0 ovate, 1 oblong, 2 lanceolate	0	1	2	1	1	0	1	1	0&1
U	0 ovoid, 1 oblong	0	1	0	0	0	0	0	0	0
V	0 glabrous, 1 tomentose	1	0	0	0	1	1	0	0	0
W	0 oblong, 1 globose, 2 elliptical	0&1	0	2	0	1	1	0	0	0
X	0 glabrous, 1 pubescent	0	0	1	0	0	0	0	0	0
Y	0 green, 1 gray, 2 brown, 3 yellow	0&2	1	2	1	1&2	2	2&3	2	1&2
Z	0 obovoid, 1 broadly obovoid, 2 flattened, 3 ellipsoid	1	0&2	0	3	0	0&2	0	3	0&2
A’	0 present, 1 absent	1	1	0	0	0	0	0	0	1
B’	0 present, 1 absent	1	1	?	1	1	?	0	0	1
C’	0 conspicuous, 1 inconspicuous	0	1	0	0	0	0	0&1	1	1
D’	0 present, 1 absent	1	0	1	1	1	0	1	0	0
E’	0 brown, 1 cream	0	0	0	1	0	0	0	0	1
F’	0 elliptical, 1 ovate, 2 circular, 3 obovate	0&1	2	3	0	0&1	0	0&2	0	0&2
G’	0 elliptical, 1 circular, 2 oblate, 3 oval	0	1	0&1	2	0&3	0	0&1	2	0&1
H’	0 eccentric, 1 concentric	0	1	1	0	1	1	0	0	0
I’	0 distinct, 1 indistinct	1	1	1	1	0	1	1	1	1
J’	0 yellow, 1 dark brown, 2 brown, 3 light brown, 4 light red	0&1	3	2&4	3	1	2	3	2	2
K’	0 medium, 1 fine	0&1	1	1	0	0	1	1	1	1
L’	0 opaque, 1 waxy	0	0	0	0	1	1	0	0	0
M’	0 porous diffuse, 1 porous semi-ring	0	0	1	0	0	0	0	0	1
N’	0 radial, 1 solitary, 2 up to two cells, 3 two to three cells	0	3	0	1	1	2	1	1	3
O’	0 diffuse, 1 irregular with narrow bands	0	0	0	1	0	0	0	1	0
P’	0 little distinct, 1 distinct limits	0	1	1	0	1	1	1	0	1
Q’	0 present, 1 absent	0	0	0	1	1	0	0	1	?
R’	0 diffuse, 1 continuous	0	0	1	?	?	1	0	?	?
S’	0 present, 1 absent	1	1	0	1	1	1	1	1	0

Instituto de Pesquisas Ambientais Av. Miguel Stefano, 3687 , 04301-902 São Paulo SP / Brasil, Tel.: 55 11 5067-6057, Fax; 55 11 5073-3678 - São Paulo - SP - Brazil
E-mail: hoehneaibt@gmail.com

Acompanhe os números deste periódico no seu leitor de RSS

[1] 5 Autor para correspondência: maria.farinaccio@ufms.br