ABSTRACT
Introduction:
Cancer is considered a genetic disease. For this reason, identification and characterization of the genes involved in its origin and progression are of fundamental importance in understanding its molecular basis.
Objective:
Our objective was to determine whether people from Macapá with a diagnosis of cancer have genetic polymorphisms related to the XRCC1 gene.
Materials and methods:
We analyzed 30 samples of deoxyribonucleic acid (DNA) of cases with cancer and 30 control samples. All samples were amplified and analyzed by the polymerase chain reaction-restriction fragment length polymorphisms (PCR-RFLP) method, with the use of restriction enzyme MspI.
Results:
Regarding the 194T polymorphism, we found that all samples of the cases presented the polymorphic allele Trp (Arg/Trp). In control samples, 96.6% also identify the polymorphic allele Trp and, among these, one was homozygous for the same allele (Trp/Trp). Regarding the 399A polymorphism, 83.3% of the cases and 23.3% of the controls had the Arg/ Gln genotype, respectively. We found that 73.3% of controls and 16.6% of cases had the Arg/Arg genotype. Among the controls, we found only a sample that was homozygous for the polymorphic allele Trp/Trp.
Conclusion:
Our results demonstrated the allele frequency of 194Trp polymorphism in both sample groups analyzed. We also found a significant number of polymorphic allele 399A in people with cancer. Thus, we can highlight 399Gln polymorphism as a genetic marker of cancer risk in this population.
Key words:
gene XRCC1; cancer; Macapá
RESUMO
Introdução:
O câncer é considerado uma doença genética, por isso identificar e caracterizar os genes envolvidos em sua origem e progressão é fundamental para compreender suas bases moleculares.
Objetivos:
Nosso objetivo foi verificar se os indivíduos de Macapá com diagnóstico de câncer apresentavam os polimorfismos genéticos relacionados com o gene XRCC1.
Materiais e métodos:
Foram analisadas 30 amostras de ácido desoxirribonucleico (DNA) de indivíduos com câncer e 30 amostras controle. Todas elas foram amplificadas e analisadas pela técnica de reação em cadeia da polimerase (PCR)-polimorfismo de tamanho de fragmentos de restrição (RFLP), com a utilização da enzima de restrição MspI.
Resultados:
Com relação ao polimorfismo 194T, observamos que todas as amostras dos casos apresentaram o alelo polimórfico Trp (Arg/Trp). Nas amostras controle, em 96,6% também identificamos o alelo polimórfico Trp e, entre essas, uma foi homozigota para o mesmo alelo (Trp/Trp). Quanto ao polimorfismo 399A, 83,3% das amostras dos indivíduos com câncer e 23,3% das amostras controle apresentaram o genótipo Arg/Gln. Verificamos que 73,3% dos controles e 16,6% dos casos apresentaram genótipo Arg/Arg. Encontramos apenas uma amostra, entre os controles, homozigota para o alelo polimórfico Trp/Trp.
Conclusão:
Nossos resultados demonstraram a frequência do alelo polimórfico 194Trp nos dois grupos amostrais analisados. Encontramos também um número significativo do alelo polimórfico 399A em indivíduos com câncer. Desse modo, podemos destacar o polimorfismo 399Gln como possível marcador genético para ser usado no prognóstico do câncer nessa população.
Unitermos:
gene XRCC1; câncer; Macapá
INTRODUCTION
The deoxyribonucleic acid (DNA) repair gene XRCC1 (X-ray repair cross complementing family) has an important function in the repair of DNA single-strand breaks induced by oxidation in human cells(11 Alves PM, Canalle R, Martins PRJ, Antunes LMG. Identificação dos polimorfismos do gene XRCC1 em pacientes com anemia falciforme. Rev Bras Hematol Hemoter. 2007; 29(2): 198-9.). The deficiencies in DNA repair capacity due to mutations or polymorphisms of repair genes, including XRCC1, can lead to genomic instability, which results in chromosomal instability syndromes and increased risk of various tumor types(11 Alves PM, Canalle R, Martins PRJ, Antunes LMG. Identificação dos polimorfismos do gene XRCC1 em pacientes com anemia falciforme. Rev Bras Hematol Hemoter. 2007; 29(2): 198-9., 22 Brem R, Hall J. XRCC1 is required for DNA single-strand repair in human cell. Nucleic Acids Res. 2005; 33(8): 2512-20.). These polymorphisms involving an amino acid change in evolutionarily conserved regions can alter the function of XRCC1 protein. Previous studies have reported that allele 399Gln of XRCC1 was significantly associated with high levels of DNA adducts and glycophorin. Mutations in erythrocytes, increased frequency of sister-chromatid exchange and higher sensitivity to the immune response are also associated with this polymorphism(11 Alves PM, Canalle R, Martins PRJ, Antunes LMG. Identificação dos polimorfismos do gene XRCC1 em pacientes com anemia falciforme. Rev Bras Hematol Hemoter. 2007; 29(2): 198-9.).
Polymorphisms in DNA repair genes are common events, and some studies have shown the significant effect of many of these polymorphisms in the ability to repair DNA damage, thus influencing individual susceptibility to carcinogenesis(33 Jelonek K, Gdowicz-Klosok A, Pietrowska M, et al. Association between single-nucleotide polymorphisms of selected genes involved in the response to DNA damage and risk of colon, head and neck, and breast cancers in a Polish population. J Appl Genet. 2010; 51(3): 343-52., 44 Mandal RK, Kapoor R, Mittal RD. Polymorphic variants of DNA repair gene XRCC3 and XRCC7 and risk of prostate cancer: a study from North Indian population. DNA Cell Biol. 2010; 29(11): 669-74.).
Cancer may be regarded as a genetic disorder triggered by changes in the cell's DNA. However, unlike other human genetic diseases, it is not necessarily a hereditary disease. Human cancers are mostly of somatic origin, resulting from the interaction of genetic and environmental factors(44 Mandal RK, Kapoor R, Mittal RD. Polymorphic variants of DNA repair gene XRCC3 and XRCC7 and risk of prostate cancer: a study from North Indian population. DNA Cell Biol. 2010; 29(11): 669-74.).
Many changes in DNA are caused by endogenous mutagens, including reactive oxygen species
(ROS) and errors during the processes of replication, recombination and repair. At the
same time, several changes are the result of DNA interaction with a variety of physical,
chemical and biological compounds, many of which are present in the environment, where
man can remain in continuous exposure(44 Mandal RK, Kapoor R, Mittal RD. Polymorphic variants of DNA repair gene
XRCC3 and XRCC7 and risk of prostate cancer: a study from North Indian population.
DNA Cell Biol. 2010; 29(11): 669-74.
5 Lindhal T. Suppression of spontaneous mutagenesis in human cells by DNA
base excision-repair. Mutat Res. 2000; 462(2-3): 129-35.
6 Lunn MR, Langlois RG, Hsieh LL, et al. XRCC1 polymorphism: effects on
aflatoxin B1-DNA adducts and glycophorin A variant frequency. Cancer Res. 1999;
59(11): 2557-61.-
77 Viera PCM. Identificação de polimorfismos de nucleotídeo único (SNPs)
nos genes de reparo XRCC1 e XRCC3 como possíveis marcadores de suscetibilidade ao
câncer, na População de Belém-PA. [trabalho de conclusão de curso]. Curso de
Biomedicina, Universidade Federal do Pará; 2010.).
Among the endogenous factors that influence carcinogenesis one may cite the individual variations in the defense mechanisms, including DNA repair and the detoxification system, and elimination of carcinogens(77 Viera PCM. Identificação de polimorfismos de nucleotídeo único (SNPs) nos genes de reparo XRCC1 e XRCC3 como possíveis marcadores de suscetibilidade ao câncer, na População de Belém-PA. [trabalho de conclusão de curso]. Curso de Biomedicina, Universidade Federal do Pará; 2010.).
Because cancer is a genetic disease, identification and characterization of the genes involved in its origin and progression are of fundamental importance in understanding its molecular basis(33 Jelonek K, Gdowicz-Klosok A, Pietrowska M, et al. Association between single-nucleotide polymorphisms of selected genes involved in the response to DNA damage and risk of colon, head and neck, and breast cancers in a Polish population. J Appl Genet. 2010; 51(3): 343-52.,44 Mandal RK, Kapoor R, Mittal RD. Polymorphic variants of DNA repair gene XRCC3 and XRCC7 and risk of prostate cancer: a study from North Indian population. DNA Cell Biol. 2010; 29(11): 669-74.,77 Viera PCM. Identificação de polimorfismos de nucleotídeo único (SNPs) nos genes de reparo XRCC1 e XRCC3 como possíveis marcadores de suscetibilidade ao câncer, na População de Belém-PA. [trabalho de conclusão de curso]. Curso de Biomedicina, Universidade Federal do Pará; 2010.). This better understanding of the disease contributes to new ways to diagnose it early, thus facilitating treatment(33 Jelonek K, Gdowicz-Klosok A, Pietrowska M, et al. Association between single-nucleotide polymorphisms of selected genes involved in the response to DNA damage and risk of colon, head and neck, and breast cancers in a Polish population. J Appl Genet. 2010; 51(3): 343-52.,44 Mandal RK, Kapoor R, Mittal RD. Polymorphic variants of DNA repair gene XRCC3 and XRCC7 and risk of prostate cancer: a study from North Indian population. DNA Cell Biol. 2010; 29(11): 669-74.,77 Viera PCM. Identificação de polimorfismos de nucleotídeo único (SNPs) nos genes de reparo XRCC1 e XRCC3 como possíveis marcadores de suscetibilidade ao câncer, na População de Belém-PA. [trabalho de conclusão de curso]. Curso de Biomedicina, Universidade Federal do Pará; 2010.).
Our proposal was to determine whether people in Macapá with a diagnosis of cancer have genetic polymorphisms related to the XRCC1 gene.
MATERIAL AND METHODS
Studied samples
Sixty peripheral blood samples were selected: 30 samples from patients (cases) with clinical diagnosis of various cancer types, seen at Hospital de Clínicas Dr. Alberto Lima (HCAL); and 30 blood samples used as control from donors of Instituto de Hematologia e Hemoterapia do Amapá (Hemoap), after informed consent.
Methodological procedure
The DNA of the participants' samples was isolated by GeneJET Genomic DNA Purification Kit (Synapse Biotechnology), following the manufacturer's recommended protocol. All samples were amplified and analyzed by polymerase chain reaction-restriction fragment length polymorphisms (PCR-RFLP) technique, with the use of restriction enzyme MspI(11 Alves PM, Canalle R, Martins PRJ, Antunes LMG. Identificação dos polimorfismos do gene XRCC1 em pacientes com anemia falciforme. Rev Bras Hematol Hemoter. 2007; 29(2): 198-9., 66 Lunn MR, Langlois RG, Hsieh LL, et al. XRCC1 polymorphism: effects on aflatoxin B1-DNA adducts and glycophorin A variant frequency. Cancer Res. 1999; 59(11): 2557-61., 77 Viera PCM. Identificação de polimorfismos de nucleotídeo único (SNPs) nos genes de reparo XRCC1 e XRCC3 como possíveis marcadores de suscetibilidade ao câncer, na População de Belém-PA. [trabalho de conclusão de curso]. Curso de Biomedicina, Universidade Federal do Pará; 2010.). The primers used were: 194F: 5'GCCCCGTCCCAGGTA3', 194R: 5'AGCCCCAAGACCCTTTCACT 3', 399F: 5'TTGTGCTTTCTCTGTGTCCA3', and 399R: 5'TCCTCCAGCCTTTTCTGATA 3', amplifying the fragments of 491 and 615 bp, respectively (Figure 1). The PCR conditions (25 µl) were 0.5 l of each primer; 300 ng of genomic DNA; 11.5 µl of 2X PCR Taq Master Mix (Molecular Brazil); 11.5 µl H2O. The amplification cycle consisted of 94ºC for five minutes, thirty cycles of 94ºC for 30 seconds, 65ºC for one minute and 30 seconds, and 72ºC for one minute, followed by five minutes at 72ºC. After the amplification reaction, 10 µl of the PCR product were digested with MspI enzyme (New England BioLabs, Beverly, MA) at 37ºC for one night, and then underwent electrophoresis for identification of the fragment (Figure 2).
DETERMINATION OF GENOTYPE
After amplification and digestion with MspI enzyme, genotyping was characterized by the following fragments: for the 194T polymorphism, the presence of the 292 bp fragment represents the wild-type allele (Arg), while the 313 bp fragment represents the polymorphic allele (Trp), indicating absence of the restriction site of MspI enzyme (Figure 2).
Regarding the polymorphism 399A, Arg/Arg genotype, Arg/Gln and Gln/Gln fragments were identified by 374/221, 615/374/221 and 615 bp, respectively (Figure 2).
RESULTS
The results of the XRCC1 gene frequency in cases and control samples are shown in Table.
Analysis of genetic polymorphisms
In our analysis, we observed that all case samples showed the Trp polymorphic allele (Arg/Trp), as well as 96.6% of the control sample, and one control sample was identified as homozygous for the same Trp allele (Table).
Regarding the polymorphism 399A; 83.3% of the case samples and 23.3% of controls had the Arg/Gln genotype. We found that 73.3% of controls and 16.6% of cases had Arg/Arg genotype. Among the controls, we found only a sample that was homozygous for the polymorphic allele Trp/Trp (Table, Figure 1 and Figure 2).
DISCUSSION
Polymorphisms in DNA repair genes are common events, and some studies have shown the significant effect of many of these polymorphisms in the ability to repair DNA damage, thereby contributing to the difference between individuals(88 Pachkowski GF, Winkel S, Kubota Y, Swenberg JA, Millikan RC, Nakamura J. XRCC1 genotype and breast cancer: functional studies and epidemiologic data show interactions between XRCC1 codon 280 His and smoking. Cancer Res. 2006; 66(5): 2860-8.).
The XRCC1 protein, encoded by the gene of the same name, is involved in the base excision repair (BER) pathway. This pathway is responsible for identifying and removing the DNA damage (e.g. oxidized, deaminated or alkylated bases) spontaneously arising in the cell or from exposure to exogenous agents, such as ionizing radiation and ultraviolet (UV) light(11 Alves PM, Canalle R, Martins PRJ, Antunes LMG. Identificação dos polimorfismos do gene XRCC1 em pacientes com anemia falciforme. Rev Bras Hematol Hemoter. 2007; 29(2): 198-9., 77 Viera PCM. Identificação de polimorfismos de nucleotídeo único (SNPs) nos genes de reparo XRCC1 e XRCC3 como possíveis marcadores de suscetibilidade ao câncer, na População de Belém-PA. [trabalho de conclusão de curso]. Curso de Biomedicina, Universidade Federal do Pará; 2010.).
It is suggested that polymorphisms in the XRCC1 gene, which cause amino acid changes, would prevent the XRCC1 protein to perform its function effectively and consequently alter the activity of the BER(77 Viera PCM. Identificação de polimorfismos de nucleotídeo único (SNPs) nos genes de reparo XRCC1 e XRCC3 como possíveis marcadores de suscetibilidade ao câncer, na População de Belém-PA. [trabalho de conclusão de curso]. Curso de Biomedicina, Universidade Federal do Pará; 2010., 99 Santos NPC, Ribeiro-Rodrigues EM, Ribeiro-dos-Santos AKC, et al. Assessing individual interethnic admixture and population substructure using a 48 insertion-deletion ancestry informative markers panel. Hum Mutat. 2009; 31(2): 184-90.). It has been reported that polymorphisms in repair genes may increase or reduce the susceptibility to the development of cancer and also to treatment with chemotherapeutic agents(11 Alves PM, Canalle R, Martins PRJ, Antunes LMG. Identificação dos polimorfismos do gene XRCC1 em pacientes com anemia falciforme. Rev Bras Hematol Hemoter. 2007; 29(2): 198-9., 44 Mandal RK, Kapoor R, Mittal RD. Polymorphic variants of DNA repair gene XRCC3 and XRCC7 and risk of prostate cancer: a study from North Indian population. DNA Cell Biol. 2010; 29(11): 669-74., 55 Lindhal T. Suppression of spontaneous mutagenesis in human cells by DNA base excision-repair. Mutat Res. 2000; 462(2-3): 129-35., 77 Viera PCM. Identificação de polimorfismos de nucleotídeo único (SNPs) nos genes de reparo XRCC1 e XRCC3 como possíveis marcadores de suscetibilidade ao câncer, na População de Belém-PA. [trabalho de conclusão de curso]. Curso de Biomedicina, Universidade Federal do Pará; 2010., 1010 Skjelbred CF, Svendsen M, Haugen V. Influence of DNA repair gene polymorphisms of hOGG1, XRCC1, XRCC3, ERCC2 and the folate metabolism gene MTHFR on chromosomal aberration frequencies. Mutat Res. 2006; 602(1-2): 151-62.).
One goal of this study was to analyze the frequency of two polymorphisms of XRCC1 DNA repair gene (194T and 399A), and to investigate their relationship with susceptibility to cancer in people from the city of Macapá.
The single-nucleotide polymorphism (SNP) Arg194Trp is one of the two most frequently observed polymorphisms in the XRCC1 gene. The variant CT and TT genotypes are associated with a risk more than five times higher in female children. Several authors have also identified association of this allele (194T) with the risk of colorectal cancer, nasopharyngeal carcinoma, oral cancer and thyroid cancer(77 Viera PCM. Identificação de polimorfismos de nucleotídeo único (SNPs) nos genes de reparo XRCC1 e XRCC3 como possíveis marcadores de suscetibilidade ao câncer, na População de Belém-PA. [trabalho de conclusão de curso]. Curso de Biomedicina, Universidade Federal do Pará; 2010., 1010 Skjelbred CF, Svendsen M, Haugen V. Influence of DNA repair gene polymorphisms of hOGG1, XRCC1, XRCC3, ERCC2 and the folate metabolism gene MTHFR on chromosomal aberration frequencies. Mutat Res. 2006; 602(1-2): 151-62.).
Our results demonstrated the frequent presence of polymorphic allele 194Trp in both sample groups analyzed. Literature data report that the presence of the variant allele 194Trp is associated with several malignancies(1010 Skjelbred CF, Svendsen M, Haugen V. Influence of DNA repair gene polymorphisms of hOGG1, XRCC1, XRCC3, ERCC2 and the folate metabolism gene MTHFR on chromosomal aberration frequencies. Mutat Res. 2006; 602(1-2): 151-62.). Skjelbred et al. (2006)(1010 Skjelbred CF, Svendsen M, Haugen V. Influence of DNA repair gene polymorphisms of hOGG1, XRCC1, XRCC3, ERCC2 and the folate metabolism gene MTHFR on chromosomal aberration frequencies. Mutat Res. 2006; 602(1-2): 151-62.) studied 530 samples of Caucasian subjects analyzed by the project Cancer Risk Biomarkers in Norway: only one had the Trp/Trp genotype at codon 194 of the XRCC1 gene, and the majority had the Arg/Arg genotype. In this study we found only a sample of the Trp/Trp genotype among the control samples, and did not identify any with Arg/Arg genotype.
A meta-analysis by Hu et al. (2005)(1111 Hu Z, Ma H, Chen F, Wei Q, Shen H. XRCC1 polymorphisms and cancer risk: a meta-analysis of 38 case-control studies. Cancer Epidemiol Biomarkers Prev. 2005; 14(7): 1810-8.) assessed the polymorphism in XRCC1 gene (Arg194Trp) susceptibility to various cancer types. In the study, one may observe the existence of conflicting results regarding the Arg194Trp polymorphism for the different ethnic groups investigated. A high frequency of 194T allele was detected in Asians (31.2%; 95% CI 29.6-32.8) and lower frequencies in Europeans (6.6%, 95% CI 5.9-7.4) and Africans (7.3%, 95% CI 5.7-9.2, p < 0.0001).
We observed in this molecular analysis that the 194Trp allele is
frequent in people from the city of Macapá, for the Trp allele is
present in both cancer cases and controls. The literature reports that the
Trp allele shows low frequency among people of African and European
descent(1111 Hu Z, Ma H, Chen F, Wei Q, Shen H. XRCC1 polymorphisms and cancer risk:
a meta-analysis of 38 case-control studies. Cancer Epidemiol Biomarkers Prev. 2005;
14(7): 1810-8.
12 Canalle R, Andrade V, Scrideli RG, et al. Polymorphisms in the
thymidylate synthase promoter and the DNA repair genes XRCC1 and XPD in a Brazilian
population. Environ Mol Mutagen. 2006; 47(9): 725-32.-
1313 Duarte FL, Colombo J, Rossit ARB, Silva AE. Polymorphism of the DNA
repair genes XRCC1 and XRCC3 in a Brazilian population. Genet Mol Biol. 2005; 28(3):
397-401.), however, the population of Amapá
descends from Africans, Europeans and Indians, what differs from other data reported in
the literature. Santos et al. (2009)(99 Santos NPC, Ribeiro-Rodrigues EM, Ribeiro-dos-Santos AKC, et al.
Assessing individual interethnic admixture and population substructure using a 48
insertion-deletion ancestry informative markers panel. Hum Mutat. 2009; 31(2):
184-90.), in a study in northern Brazil, identified an
increasing degree of population substructuring and evidence that this polymorphism
differs with respect to ethnic groups. Thus, based on ancestry studies, it is possible
that in a particular generation of Amapá population, the Trp allele was
maintained and became part of the genetic makeup of these people.
In the present study, we found no correlation between the 194Trp polymorphism and the development of cancer, as all DNA samples from cases and controls had this allele. Another polymorphism of XRCC1 gene analyzed in the present study was the 399A; 73.3% of the control samples and 16.6% of cases were identified with the wild genotype Arg/Arg. However, we found that 83.3% of the samples of cancer cases had the Arg/Gln genotype, a high frequency compared to the frequency of 23.3% of the controls.
Au et al. (2003)(1414 Au WW, Salama AS, Sierra-Torres CH. Functional characterization of polymorphism in DNA repair genes using cytogenetic challenge assays. Environ Health. 2003; 111(15): 1843-50.) reported the interaction of 399Gln XRCC1 gene polymorphism with large deletions in human chromosomes induced by X-ray. Angelini et al. (2005)(1515 Angelini S, Kumar R, Carbone F, et al. Micronuclei in humans induced by exposure to low level of ionizing radiation: influence of polymorphism in DNA repair gene. Mutat Res. 2005; 570(1): 105-17.) demonstrated that the gene polymorphism of XRCC1 was positively correlated with the increase in the number of chromosomal abnormalities found in peripheral blood lymphocytes of individuals occupationally exposed to low doses of ionizing radiation.
Studies have reported that individuals with at least one allele 399Gln have increased tendency for chromosomal aberrations(11 Alves PM, Canalle R, Martins PRJ, Antunes LMG. Identificação dos polimorfismos do gene XRCC1 em pacientes com anemia falciforme. Rev Bras Hematol Hemoter. 2007; 29(2): 198-9.). In the present study, we found a correlation between cases of cancer and the 399Gln polymorphism. Our results show that probably people with the Arg/Gln genotype show greater susceptibility to the development of some form of cancer. Thus, we can also consider the 399Gln polymorphism a possible genetic marker for use in cancer prognosis, yet it is undoubtedly necessary to increase the number of cases and controls.
For the first time in Macapá, a genetic study was conducted associating a gene polymorphism with the development of cancer. We intend to continue the study, increasing the number of samples. We are in the early stages of a more specific study, which will analyze samples of developed cancer, as well as associate each patient's genetic results to clinical practice.
REFERENCES
-
1Alves PM, Canalle R, Martins PRJ, Antunes LMG. Identificação dos polimorfismos do gene XRCC1 em pacientes com anemia falciforme. Rev Bras Hematol Hemoter. 2007; 29(2): 198-9.
-
2Brem R, Hall J. XRCC1 is required for DNA single-strand repair in human cell. Nucleic Acids Res. 2005; 33(8): 2512-20.
-
3Jelonek K, Gdowicz-Klosok A, Pietrowska M, et al. Association between single-nucleotide polymorphisms of selected genes involved in the response to DNA damage and risk of colon, head and neck, and breast cancers in a Polish population. J Appl Genet. 2010; 51(3): 343-52.
-
4Mandal RK, Kapoor R, Mittal RD. Polymorphic variants of DNA repair gene XRCC3 and XRCC7 and risk of prostate cancer: a study from North Indian population. DNA Cell Biol. 2010; 29(11): 669-74.
-
5Lindhal T. Suppression of spontaneous mutagenesis in human cells by DNA base excision-repair. Mutat Res. 2000; 462(2-3): 129-35.
-
6Lunn MR, Langlois RG, Hsieh LL, et al. XRCC1 polymorphism: effects on aflatoxin B1-DNA adducts and glycophorin A variant frequency. Cancer Res. 1999; 59(11): 2557-61.
-
7Viera PCM. Identificação de polimorfismos de nucleotídeo único (SNPs) nos genes de reparo XRCC1 e XRCC3 como possíveis marcadores de suscetibilidade ao câncer, na População de Belém-PA. [trabalho de conclusão de curso]. Curso de Biomedicina, Universidade Federal do Pará; 2010.
-
8Pachkowski GF, Winkel S, Kubota Y, Swenberg JA, Millikan RC, Nakamura J. XRCC1 genotype and breast cancer: functional studies and epidemiologic data show interactions between XRCC1 codon 280 His and smoking. Cancer Res. 2006; 66(5): 2860-8.
-
9Santos NPC, Ribeiro-Rodrigues EM, Ribeiro-dos-Santos AKC, et al. Assessing individual interethnic admixture and population substructure using a 48 insertion-deletion ancestry informative markers panel. Hum Mutat. 2009; 31(2): 184-90.
-
10Skjelbred CF, Svendsen M, Haugen V. Influence of DNA repair gene polymorphisms of hOGG1, XRCC1, XRCC3, ERCC2 and the folate metabolism gene MTHFR on chromosomal aberration frequencies. Mutat Res. 2006; 602(1-2): 151-62.
-
11Hu Z, Ma H, Chen F, Wei Q, Shen H. XRCC1 polymorphisms and cancer risk: a meta-analysis of 38 case-control studies. Cancer Epidemiol Biomarkers Prev. 2005; 14(7): 1810-8.
-
12Canalle R, Andrade V, Scrideli RG, et al. Polymorphisms in the thymidylate synthase promoter and the DNA repair genes XRCC1 and XPD in a Brazilian population. Environ Mol Mutagen. 2006; 47(9): 725-32.
-
13Duarte FL, Colombo J, Rossit ARB, Silva AE. Polymorphism of the DNA repair genes XRCC1 and XRCC3 in a Brazilian population. Genet Mol Biol. 2005; 28(3): 397-401.
-
14Au WW, Salama AS, Sierra-Torres CH. Functional characterization of polymorphism in DNA repair genes using cytogenetic challenge assays. Environ Health. 2003; 111(15): 1843-50.
-
15Angelini S, Kumar R, Carbone F, et al. Micronuclei in humans induced by exposure to low level of ionizing radiation: influence of polymorphism in DNA repair gene. Mutat Res. 2005; 570(1): 105-17.
Publication Dates
-
Publication in this collection
May-Jun 2015
History
-
Received
13 Jan 2015 -
Accepted
23 Mar 2015