Cystic fibrosis transmembrane conductance regulator
               mutations at a referral center for cystic fibrosis

Coutinho, Cyntia Arivabeni de Araújo Correia; Marson, Fernando Augusto de Lima; Ribeiro, Antônio Fernando; Ribeiro, José Dirceu; Bertuzzo, Carmen Silvia

doi:10.1590/S1806-37132013000500005

Acessibilidade / Reportar erro

Brasil

Jornal Brasileiro de Pneumologia

Español English

Brasil

Español English

sumário « anterior atual seguinte »

Sumário

Original Articles • J. bras. pneumol. 39 (05) • Sep-Oct 2013 • https://doi.org/10.1590/S1806-37132013000500005 copy

Cystic fibrosis transmembrane conductance regulator mutations at a referral center for cystic fibrosis^* * Study carried out in the Departments of Medical Genetics and Pediatrics, State University at Campinas School of Medical Sciences, Campinas, Brazil.

Authorship SCIMAGO INSTITUTIONS RANKINGS

OBJECTIVE:

To determine the frequency of six mutations (F508del, G542X, G551D, R553X, R1162X, and N1303K) in patients with cystic fibrosis (CF) diagnosed, at a referral center, on the basis of abnormal results in two determinations of sweat sodium and chloride concentrations.

METHODS:

This was a cross-sectional study involving 70 patients with CF. The mean age of the patients was 12.38 ± 9.00 years, 51.43% were female, and 94.29% were White. Mutation screening was performed with polymerase chain reaction (for F508del), followed by enzymatic digestion (for other mutations). Clinical analysis was performed on the basis of gender, age, ethnicity, pulmonary/gastrointestinal symptoms, and Shwachman-Kulczycki (SK) score.

RESULTS:

All of the patients showed pulmonary symptoms, and 8 had no gastrointestinal symptoms. On the basis of the SK scores, CF was determined to be mild, moderate, and severe in 22 (42.3%), 17 (32.7%), and 13 (25.0%) of the patients, respectively. There was no association between F508del mutation and disease severity by SK score. Of the 140 alleles analyzed, F508del mutation was identified in 70 (50%). Other mutations (G542X, G551D, R553X, R1162X, and N1303K) were identified in 12 (7.93%) of the alleles studied. In F508del homozygous patients with severe disease, the OR was 0.124 (95% CI: 0.005-0.826).

CONCLUSIONS:

In 50% of the alleles studied, the molecular diagnosis of CF was confirmed by identifying a single mutation (F508del). If we consider the analysis of the six most common mutations in the Brazilian population (including F508del), the molecular diagnosis was confirmed in 58.57% of the alleles studied.

Cystic fibrosis; Cystic fibrosis transmembrane conductance regulator; Mutation

Reagents	Exon 10	Exon 11	Exon 19	Exon 21
	F508del	G542X, G551D, and R553X	R1162X	N1303K
DNA, µL	1.0	1.0	1.0	1.0
Tris-HCl (pH 8.4), 10.0 mM	2.5	2.5	2.5	2.5
KCl, 25.0 mM	2.5	2.5	2.5	2.5
MgCl₂, 1.0 mM	2.0	4.0	1.0	2.0
dNTP, 0.025 mM (each)	1.0	1.0	0.8	2.0
Primers, 0.2 pmol (each)	1.0	1.0	0.8	1.0
Taq polymerase, 5 IU	1.0	1.0	1.0	1.0
Water q.s., mL	25.0	50.0	50.0	50.0
Programs, temperature/time
1	94°C/5'	95°C/1'	94°C/3'	94°C/5'
2	94°C/1'	50°C/1'	94°C/1'	94°C/30''
3	52.5°C/1'	74°C/2'	56°C/1'	53°C/30''
4	72°C/2'	74°C/9'	72°C/2'	72°C/30''
5	72°C/7'	72°C/7´	72°C/7´	72°C/7'
Cycles, n	35	35	35	35

Exon	Mutation	Sequence 5' - 3'	Fragment, pb	First digestion				Second digestion
				Restriction enzyme	Temperature, °C	Normal fragment, pb	Mutant fragment, pb	Restriction enzyme	Temperature, °C	Mutant fragment, pb
11	G542X	S: CAGAGAAAGACAATATAGTTCC	112	BstnI	60	90, 22	112
	G551D			HincII	37	58, 54	112	MboI	37	62, 50
	R553X	AS: AAATGCTTGCTAGACCAAT		HincII	37	58, 54	112	MboI	37	112
19	R1162X	S: GCCCGACAAATAACCAAGTGA	454	DdeI	37	275, 179	179, 143, 132
19	R1162X	AS: GCTAACACATTGCTTCAGGCT	454
21	N1303K	S: CCACTGTTCATAGGGATCCAG	59	BstnI	60	40, 19	59
21	N1303K	AS: AGAAAGTATTTATTTTTTCTGGAAC	59
10	F508del	S: GGC ACC ATT AAA GAA AAT ATC	50, 47
10	F508del	AS: CTA TAT TCA TCA TAG GAA AC	50, 47

Genotype for the F508del mutation	Gastrointestinal clinical signs			OR	95% CI
	Yes^a	No^a	Total, n
F508del/F508del	21 (33.87)	0 (-)	21	-	-
F508del/another mutation	26 (41.94)	2 (25)	28	2.145	0.417-16.50
Another mutation/another mutation	15 (24.19)	6 (75)	21	0.111	0.014-0.581

Genotype	Patients
F508del/F508del	21 (30.00)
F508del/another mutation	20 (28.57)
F508del/G542X	3 (4.29)
G542X/R1162X	1 (1.43)
G542X/another mutation	2 (2.86)
F508del/R553X	1 (1.43)
F508del/R1162X	2 (2.86)
F508del/N1303K	2 (2.86)
Another mutation/another mutation	18 (25.71)
Allele	Frequency
F508del	70 (50.00)
G542X	6 (4.29)
R1162X	3 (2.14)
N1303K	2 (1.43)
R553X	1 (0.07)
Not determined	58 (41.43)

Mutation	Disease severity						Total
	Severe^a	OR (95% CI)	Moderate^a	OR (95% CI)	Mild^a	OR (95% CI)
F508del/F508del	1 (7.69)	0.124 (0.005-0.826)	9 (40.91)	1.88 (0.57-6.33)	7 (41.18)	1.731 (0.495-5.995)	17
F508del/another mutation	8 (61.54)	2.512 (0.684-9.926)	9 (40.91)	0.795 (0.253-2.453)	6 (35.29)	0.584 (0.166-1.939)	23
Another mutation/another mutation	4 (30.77)	1.703 (0.371-7.128)	4 (18.18)	0.617 (0.141-2.393)	4 (23.53)	1.038 (0.234-4.124)	12

Sociedade Brasileira de Pneumologia e Tisiologia SCS Quadra 1, Bl. K salas 203/204, 70398-900 - Brasília - DF - Brasil, Fone/Fax: 0800 61 6218 ramal 211, (55 61)3245-1030/6218 ramal 211 - São Paulo - SP - Brazil
E-mail: jbp@sbpt.org.br

Acompanhe os números deste periódico no seu leitor de RSS

[1] Correspondence to: Fernando Augusto de Lima Marson. Universidade Estadual de Campinas, Faculdade Ciências Médicas, Departamento de Genética Médica. Rua Tessália Vieira de Camargo, 126, Cidade Universitária "Zeferino Vaz", CEP 13083-887, Campinas, SP, Brasil. Tel. 55 19 3521-8902. Fax: 55 19 3521-8909. E-mail: fernandolimamarson@hotmail.com

Brasil

Brasil

Cystic fibrosis transmembrane conductance regulator mutations at a referral center for cystic fibrosis* * Study carried out in the Departments of Medical Genetics and Pediatrics, State University at Campinas School of Medical Sciences, Campinas, Brazil.

OBJECTIVE:

METHODS:

RESULTS:

CONCLUSIONS:

Cystic fibrosis transmembrane conductance regulator mutations at a referral center for cystic fibrosis^* * Study carried out in the Departments of Medical Genetics and Pediatrics, State University at Campinas School of Medical Sciences, Campinas, Brazil.