CqNLP1 promotes Chenopodium quinoa Willd. seed germination regulated by NO ₃ ^-

ABSTRACT:

Quinoa (Chenopodium quinoa) has earned special attention worldwide due to its higher nutritional value and its adaptive ability to contrasting environments. Here, it was explored how quinoa seed germination is regulated. CqNLP1 gene was identified and cloned due to its higher expression level in quinoa seeds. The role of CqNLP1 in seed germination was studied based on model species as Arabidopsis sp. The function of NO₃ ^- during seed germination of quinoa was analyzed. The results showed CqNLP1 gene can restore the germination rate of Arabidopsis mutant nlp8-1 and nlp8-2 strains, suggesting that CqNLP1 gene plays an important role in promoting seed germination. Appropriate level of NO₃ ^- could improve the germination rate of quinoa seeds, promote the decomposition and utilization of soluble protein and ABA, increase the expression level of CqNLP1 and CYP707A2 during germination. The optimal NO₃ ^- concentration to promote seed germination is 1mM.

Index terms:
ABA; CYP707A2; mutant strain; quinoa; soluble protein

RESUMO:

A quinoa (Chenopodium quinoa) tem ganhado atenção especial em todo o mundo devido ao seu maior valor nutricional e à sua capacidade de adaptação a diferentes ambientes. Nesse estudo, foi explorado como a germinação das sementes de quinoa é regulada. O gene CqNLP1 foi identificado e clonado devido ao seu maior nível de expressão em sementes de quinoa. O papel do CqNLP1 na germinação de sementes foi estudado com base em espécies modelo como Arabidopsis sp. A função do NO₃ ^- durante a germinação de sementes de quinoa foi analisada. Os resultados mostraram que o gene CqNLP1 pode restaurar a taxa de germinação das cepas mutantes nlp8-1 e nlp8-2 de Arabidopsis, sugerindo que o gene CqNLP1 desempenha um papel importante na promoção da germinação de sementes. O nível apropriado de NO₃ ^- poderia melhorar a taxa de germinação das sementes de quinoa, promover a decomposição e utilização de proteína solúvel e ABA, aumentar o nível de expressão de CqNLP1 e CYP707A2 durante a germinação. A concentração ideal de NO₃ ^- para promover a germinação das sementes é de 1 mM.

Termos de indexação:
ABA; CYP707A2; cepa mutante; quinoa; proteína solúvel

INTRODUCTION

Chenopodium is a genus of plants in the Amaranthaceae family and Chenopodaceae subfamily, it was originated in the Andes Mountains and has been cultivated for 7,000 years. Today, quinoa has earned special attention worldwide due to its higher nutritional value and its ability to adapt to contrasting environments (Hinojosa et al., 2018).

Seed germination is the first developmental process in plant life cycle and plays a crucial role in crop production and quality. Hao et al. (2022) demonstrated a transcriptomic and metabolomic landscape of quinoa during seed germination in a general way. In recent years, several studies have contributed to shedding light on the molecular networks underlying seed germination processes with model plants as Arabidopsis (Yan et al., 2016; Gu et al., 2019; Chen et al., 2020; Bai et al., 2020). However, the regulation of quinoa seed germination is largely unknown.

Seed germination is influenced by various environmental cues. In soil, NO₃ ^- is one of the main nitrogen sources for plants, and it is also an important signal molecule involved in seed dormancy interruption (Alboresi et al., 2005). A transcriptome analysis revealed that the environmental factors regulate a common downstream action related to seed dormancy interruption where abscisic acid (ABA) plays a key role (Finch-Savage et al., 2007; Glison et al., 2017). NODULE INCEPTION (NIN)-like protein, namely, NLP transcription factor actively participate in nitrogen response of plants (Konishi and Yanagisawa, 2011). In Arabidopsis thaliana, NLP8，namely AtNLP8 has proven to be a major regulator of nitrate-promoting seed germination, binding directly to the promoter of the CYP707A2, and reducing ABA levels (Yan et al., 2016). Considering the potential presented by quinoa and the benefits of seed germination for the production of offspring, it would be useful to explore how quinoa seed germination is regulated.

Herein, based on the CqNLPs (NLP genes in Chenopodium quinoa) expression profile in different quinoa tissues, we cloned CqNLP1, the homolog of AtNLP8 genes and explored its function in quinoa seed germination.

MATERIAL AND METHODS

Arabidopsis (Col-0) seeds were available at the laboratory stock and quinoa line ZK7 (Chenopodium quinoa. ZK7) was provided by the College of Agronomy of Shanxi Agricultural University, China. Arabidopsis thaliana T-DNA insertion mutants nlp8-1 (SALK_031064) were obtained from the AraShare (http://www.arashare.cn) and nlp8-2 (SALK_025839) (Yan et al., 2016) was gifted by Professor Eiji Nambara, University of Toronto, Canada (all in Col-0 background, simply referred to by their gene abbreviations henceforth). The binary expression vector pNC-Cam2304-MCS35S containing GUS reporter gene (Figure 1) was provided by Yan Pu, Institute of Tropical Biotechnology, Chinese Academy of Tropical Agricultural Sciences, China.

Figure 1
Map of vector pNC-Cam2304-MCS35S.

CqNLPs expression profile analysis

Using the RNA-seq data (SRP226463, SRP116149) of quinoa which were downloaded from the SRA website (https://www.ncbi.nlm.nih.gov/sra/). We analyzed the expression profile of 9 CqNLPs (Zhu et al., 2021) in root, stem, leaf, flower and seed. Gene expression level was calculated as log₂FPKM (fragments per kilobase of transcript per million reads mapped), and the expression heat map of NLPs gene was plotted by TBtools software.

RNA extraction and qRT-PCR analysis

Expression pattern of CqNLP1 genes and CYP707A2 was validated by qRT-PCR analysis with three biological replicates. Total RNA was extracted by the Trizol method (EasyPure® Plant RNA Kit), and RNA quality was detected by a micronucleic acid protein analyzer (scandrop100). The first strand of cDNA was synthesized using the EasyScript® One-Step gDNA Removal and cDNA Synthesis SuperMix. Relative quantification of gene expression was calculated with primers (5’-TGTTTGCCATGCTCTTGAGG-3’; 3’-AAGGCAATCTGTGTGCATGG-5’ for CqNLP1 and 5’-GTCCTGAAGCCGCAAAGATAGTT-3’; 3’-CATCTCAACTAGAGTGTTGATGGAG-5’ for CYP707A2) and normalized using EF1a as an internal standard with primers 5’-GTACGCATGGGTGCTTGACAAACTC-3’; 3’ - ATCAGCCTGGGAGGTACCAGTAAT -5’. The reaction system was 10.0 μL, of which 2× SYBR Green Supermix 5.0 μL and 0.5 μL each of primers. The comparative Ct (2^-(∆∆Ct)) method was used to calculate the fold-changes in gene expression level.

CqNLP1 gene cloning

The coding sequence of the CqNLP1 gene was obtained from the quinoa genome database (https://www.ncbi.nlm.nih.gov/nuccore/2496127099). Using the cDNA of quinoa seed as template, PCR was performed to obtain the full length of CqNLP1 gene. the gene-specific primers (F1 5’-agtggtctctgtccagtcctATGGAATACTCCTTTTCTCCTAAGGA-3’ and R1 (5’-ggtctcagcagaccacaagtCTAACAAATTCCAGGTATGAAACAACT-3’) were designed according to the CqNLP1 coding sequence (lowercase letters are splice sequences). NC Loving was used to construct the expression vector (Yan et al., 2020). A 2,808-bp PCR product was obtained and subsequently ligated into the plasmid pNC-Cam2304-MCS35S to produce the binary vector Pro35S::CqNLP1.

Arabidopsis mutants verification and functional reversion obtainment

CqNLP1 is the homolog of AtNLP8 genes. Arabidopsis T-DNA insertion mutants nlp8-1 and nlp8-2 were adopted to explored CqNLP1 function in seed germination. Arabidopsis mutants nlp8-1 and nlp8-2 were verified by PCR amplification. LP and RP are DNA-specific primers, and BP and RP are T-DNA insertion primers (Table 1). The Pro35S::CqNLP1 construct was introduced into nlp8-1 and nlp8-2 mutants by the flower dip method of agrobacterium (Agrobacterium tumefaciens, GV3101) -mediated transformation (Clough and Bent, 1998). This generated nlp8-1 and nlp8-2 functional recovery lines (refer to nlp8-1-CqNLP1 and nlp8-2-CqNLP1 henceforth). The nlp8-1-CqNLP1 and nlp8-2-CqNLP1 were primarily selected on MS (Murashige and Skoog) medium containing 50 mg.L^-1 hygromycin B, and the presence of the transgene was further confirmed by GUS staining the inbred lines of the recovery lines.

Table 1
nlp8-1 and nlp8-2 mutant identification primers.

Name	Primer name	Primer sequence
nlp8-1	LP	AGCTTGGAACAACAACTTCTAT
	RP	AGCATTAACCTCCATGAATGAT
nlp8-2	LP	TTCTGGCGTTAGGAATTTGA
	RP	ACTATAGCAATCTTGCTGGC
T-DNA	LB1.3	ATTTTGCCGATTTCGGAAC

Measurement of seed germination rate, soluble protein and ABA contents

Germination test

The Arabidopsis seeds of wild type, nlp8-1 and nlp8-2 mutants, nlp8-1-CqNLP1 and nlp8-2-CqNLP1 were used for germination test. Approximately 50 seeds were surface sterilized with 10% NaClO, rinsed thoroughly with sterilized water and sown on 10 cm petri dishes containing solid agarose culture medium. The petri dishes were then placed in a growth chamber under the conditions of 22 °C and 50% humidity. After 4 days, taking radicle protrusion as a criterion for germination, the seed germination rate was calculated (germination rate = number of germinated seeds / total seed × 100%).

Quinoa seed germination was investigated using a similar method. Approximately 50 quinoa seeds were surface sterilized with 10% NaClO, rinsed thoroughly with sterilized water and sown on 10 cm petri dishes covered with filter paper and soaked in the solutions of 1 mM of KNO_3, KCl, KH₂PO₄, K₂SO₄, or different concentrations of KNO₃ (1, 2.5, 5, 10, 20, 40, 50 mM), respectively. Plates were incubated at 27 °C, 70% humidity. The seed germination rate was counted every hour from 6 h to 12 h of incubation using sprout length reaching half of the seed length as the germination criterion, germination rate (%) = number of germinated seeds / total number of seeds × 100%.

Contents of soluble protein and ABA

The protein content in quinoa seeds was determined by Coomassie Brilliant Blue Staining method (Bradford, 1976; Sedmak and Grossberg, 1977). The seeds of different treatments of quinoa were frozen in liquid nitrogen. The content of ABA was determined by high performance liquid chromatography (HPLC) and liquid chromatography-mass spectrometry (HPLC-MS) and was conducted by SCI-TECH INNOVATION Co., Qingdao, China.

RESULTS

The investigation on RNA-seq data of quinoa revealed that CqNLPs presented varied expression patterns in different quinoa tissues. The expression level of CqNLP1, CqNLP5, CqNLP6, CqNLP7 and CqNLP8 were all higher in seeds than those in other tissues, this is especially true for CqNLP1 (Figure 2A). qRT-PCR of CqNLP1 further confirmed that CqNLP1 expression level in seeds was the highest, which was 8.6, 1.8, 1.3 and 2.7 times higher than those of roots, stems, leaves and flowers, respectively (Figure 2B).

Figure 2
Expression level of CqNLPs in quinoa tissues. A is the heat map of CqNLPs expression profile in quinoa, B is the qRT-PCR results of CqNLP1 gene. Different letters indicate significant difference among tissues at p <0.05, according to Duncan’s multiple range test.

Because of the clear evidences for CqNLP1 differential expression in different tissues, we validated its role in quinoa seed germination using Arabidopsis model. The full 2,808-bp of CqNLP1 gene (NCBI Gene ID: MW915417) was ligated into the plasmid pNC-Cam2304-MCS35S to produce the binary vector Pro35S::CqNLP1 (Figure 3). The Arabidopsis nlp8-1 and nlp8-2 mutant plants were verified by PCR and GUS staining (Figures 4A and 4B). We created recovery lines for these mutants by transforming them with the vector carrying CqNLP1. The growth profile of mutants and their recovery lines showed CqNLP1 restored the leaf area, leaf number, and growth rate of the nlp8-1 and nlp8-2 mutant plants (Figure 4C). Further, nlp8-1-CqNLP1 and nlp8-2-CqNLP1 plants grew even better than the wild type. The germination rates of Arabidopsis wild type, nlp8-1, nlp8-2 mutants and nlp8-1-CqNLP1, nlp8-1-CqNLP2 were analyzed on the 4th day (Figure 5). The germination rates of nlp8-1 and nlp8-2 mutant were significantly smaller than WT and recovery lines, and that of recovery lines (nlp8-1-CqNLP1 and nlp8-1-CqNLP2) were the highest.

Figure 3
Binary vector construction for CqNLP1. A is PCR amplification of CqNLP1. M: 5000 bp DNA maker, B is the CDS sequence of CqNLP1, C is the construction of Pro35S::CqNLP1.

Figure 4
Nlp-2 mutant identification and recovery line selection. A is the PCR identification for mutant. WT is wild type plant, 1-23 is different mutant plants. LP: left primer, RP: right primer, LB: T-DNA left border primer. B is the GUS staining for nlp8-1-CqNLP1, nlp8-1-CqNLP2. C is the phenotype of WT, nlp8-1, nlp8-2 mutants and nlp8-1-CqNLP1, nlp8-1-CqNLP2.

Figure 5
Seed germination rate of Arabidopsis in different lines. Different letters indicate significant difference among lines at p<0.05 according to Duncan’s multiple range test.

The effect of different types of potassium salt on quinoa seed germination was explored. It was showed the seed germination rate of quinoa under different treatments gradually increased after 6- to 12h of incubation, it was the highest under KNO₃ treatment at each time point that settled (Table 2). To further clarify the optimal concentration of NO₃ ^- for quinoa seed germination, a series KNO₃ concentrations were settled. The seed germination rate was the highest in 1 mM KNO₃ treatment except that under 2.5 mM KNO₃ treatment at 7 h (Table 3).

Table 2
Germination rate of quinoa seeds treated with different types of potassium salt.

	Time (h)
	6	7	8	9	10	11	12
Water	8±0.82 b	17.3±0.47 bc	35.3±0.47 b	46±0.82 b	61.3±0.47 b	65.3±0.47 bc	70±0.82 c
KNO3	15.3±0.47 a	24±0.82 a	48±0.82 a	55.3±0.47 a	67.3±0.47 a	72.0±0.82 a	78±0.82 a
KCl	7.3±0.47 b	15.3±1.25 c	25.3±0.47 c	36±0.82 c	53.3±0.47 c	67.3±0.47 b	73.3±0.47 b
KH2PO4	9.3±0.47 b	19.3±0.47 b	35.3±0.94 b	43.3±0.47 b	63.3±0.47 b	64±0.82 c	72±0.8b2 c
K2SO4	2.7±0.47 c	11.3±0.47 d	18±0.82 d	29.3±0.94 d	53.3±0.47 c	60±0.82 d	73.3±0.47 b

• Data are shown as means ± SD (n =3). Different letters in the same column indicate significant difference at p<0.05 according to Duncan’s multiple range test. The concentration of KNO₃, KCl, KH₂PO₄ and K₂SO₄ was 1mM.

Table 3
Germination rate of quinoa seeds treated with different concentrations of potassium nitrate.

Time (h)
	6	7	8	9	10	11	12
0 mM	8.0±0.82 c	16±0.82 b	35.3±0.94 b	46±0.82 b	61.3±0.47 b	65.3±0.94 b	70±0.82 d
1 mM	15.3±0.47 a	24±0.82 a	48±0.82 a	54.6±1.25 a	67.3±1.25 a	72±0.82 a	78±0.82 a
2.5 mM	12±1.63 b	22.7±0.94 a	38±0.82 b	46.7±0.47 b	60±0.82 b	70±0.82 a	76±0.82 b
5 mM	3.3±0.47 d	8±0.82 c	24±0.82 c	42±0.82 c	55.3±0.47 c	64±0.82 b	74±0.82 c
10 mM	4.7±0.47 d	6±0.82 c	12.7±0.94 e	29.3±1.67 e	43.3±0.94 d	51.3±0.47 d	63.3±0.47 e
20 mM	4±0.82 d	8.7±0.94 c	16.7±0.47 d	35.3±0.47 d	44±1.41 d	59.3±0.47 c	69.3±0.47 d
40 mM	4.7±0.47 d	7.3±0.47 c	12.7±1.25 e	34±0.82 d	38±0.82 e	52±0.82 d	62±0.82 e
50 mM	2.7±0.47 d	2.7±0.47 d	8±1.63 f	23.3±0.47 f	28±0.82 f	42±0.82 e	57.3±0.47 f

• Data are shown as means ± SD(n =3). Different letters in the same column indicate significant difference at p<0.05 according to Duncan’s multiple range test.

After 6h, 8h,10h and 13h incubation with KNO₃, soluble protein content in quinoa seeds was consistently significantly lower than that under water treatment. Under KCl treatment, soluble protein content was higher than that of water treatment at 6 h, 8 h and 13 h. After 13 h incubation with KH₂PO₄, soluble protein content was lower than that of the water treatment, while it was higher at 6 h, 8 h and 10 h. The lowest soluble protein content was presented under 1 mM KNO₃ treatment. That is, during the quinoa germination process, the soluble protein decomposition speed is faster under NO₃ ^- treatment and the optimal concentration for soluble protein decomposition is 1 mM (Figure 6).

Figure 6
Contents of soluble protein in quinoa seeds. A shows soluble protein content treated with different types of potassium salt. B shows soluble protein content treated with different concentrations of potassium nitrate. Different letters indicate significant difference at the same time (p<0.05, Duncan’s multiple range test).

ABA has an inhibitory effect on seed germination, so it must be degraded when germination occurs. Here, in all the treatments, ABA contents in quinoa seeds were lower under KNO₃ treatment compared with that of water treatment. It was observed that the optimal NO₃- concentration for ABA degradation in quinoa seeds is 1 mM KNO₃ (Figure 7).

Figure 7
Contents of ABA in quinoa seeds treated with different types of potassium salts and different concentrations of potassium nitrate. A is the content of ABA quinoa seeds treated with different types of potassium salt. B is the contents of ABA of quinoa seeds treated with different concentrations of potassium nitrate. Different letters indicate significant difference at the same time (p<0.05, Duncan’s multiple range test).

CYP707A2, coding ABA decomposing enzyme gene, plays a key role in ABA degradation. Here, after 12 h post-treatment, the expression level of CYP707A2 was the highest under NO₃ ^- treatment group which was 2.3 times higher than the water treatment. It was lower in KCl, KH₂PO₄ and K₂SO₄ treatments compared with the water treatment. The concentration of 1mM NO₃ ^- maximized CYP707A2 gene expression, more than twice that of water treatment (Figure 8). The expression pattern of CqNLP1 is similar to that of CYP707A2.

Figure 8
Relative expression of CqCYP707A2 and CqNLP1. A and B show the expression profile of CqCYP707A2 quinoa seeds treated with different types of potassium salt and different concentrations of potassium nitrate. C and D show the expression profile of CqNLP1 with different types of potassium salt and different concentrations of potassium nitrate. Expression levels of CqCYP707A2 and CqNLP1 were analyzed 12h-post treatment. Different letters indicate significant difference at p <0.05 according to Duncan’s multiple range test.

DISCUSSION

AtNLP8 gene has been confirmed to play a key role in Arabidopsis seed germination. In barley, HvNLP2 was verified involved in nitrate signaling (Gao et al., 2022). Here, we found CqNLP, the homologous gene of AtNLP8 exhibited significantly higher expression level in quinoa seeds indicating that CqNLP1 gene might be closely connected to seed germination. It was then verified the role of CqNLP1 in promoting seed germination by expressing it in two different AtNLP8 mutants. The results showed that the germination rate of recovery lines was higher than others, where the presence of CqNLP1 probably increased seed germination. It is documented that AtNLP8 binds directly to the promoter of CYP707A2 gene and reduces ABA levels in a nitrate-dependent manner, thereby promoting seed germination (Yan et al., 2016). Sufficient studies have documented that ABA negatively regulate seed germination (Sano and Marion-Poll, 2021; Xu et al., 2021; Zhou et al., 2023). A transcriptomic study on seed germination of quinoa verified that during transition from quinoa dry seed to seedling, seed metabolism is reprogrammed with significant alteration of multiple phytohormones, especially ABA (Hao et al., 2022). Gao et al. (2023) found quinoa germination rate displayed lower when seeds treated with ABA at concentrations of 50, 100, and 200 μM. Therefore, it was speculated that the promotion function of CqNLP1 in seed germination might related to the suppression of ABA level.

Studies have shown that NO₃ ^-, as a necessary signaling molecule, enables AtNLP8 directly bind to the downstream ABA- degrading enzyme gene and activate its expression, thereby reducing the content of ABA in seeds during germination and thus promoting seed germination (Yan et al., 2016). In this study, the content of soluble protein in quinoa was smaller in KNO₃ treatment and 1 mM NO₃ ^- is the favorable concentration for seed germination. We hypothesize that the NO₃ ^- signaling pathway promotes the degradation of soluble protein during quinoa seed process and therefore provide nutrients for seed germination. The content of ABA in seeds regulates seed germination or dormancy. During seed maturation, ABA content in seeds is constantly induced and accumulated to maintain seed dormancy and inhibit seed germination, while during seed germination process, ABA content decreased continuously.

Herein, ABA content in quinoa seeds was consistent with the soluble protein content in KNO₃ treatment, and with 1 mM NO₃ ^-, ABA content was the lowest. Previous studies have revealed the role of CYP707A2 gene in controlling seed ABA levels during seed germination (Matakiadis et al., 2009; Sasaki et al., 2015), and the present result agreed with their conclusion. We therefore proposed that NO₃ ^-, as a signaling molecule, acts as an upstream regulatory factor activating the expression of CqNLP1 gene in quinoa, and further degrading ABA in seeds, relieving the inhibition of seed germination and promoting the quinoa seed germination. The mechanism is similar to Arabidopsis elucidated by Yan et al. (2016) (Figure 9). In the future, it would be interesting to explore the interaction model of CqNLP1 and CYP707A2.

Figure 9
A proposed schematic model for NLP8 activity in regulating nitrate-promoted seed germination (Yan et al., 2016).

CONCLUSIONS

CqNLP1 gene can restore the germination rate of Arabidopsis mutant nlp8-1 and nlp8-2 strains, suggesting that CqNLP1 gene plays an important role in promoting seed germination.

Among different types of potassium salt and water treatment, the germination rate of quinoa seeds was the highest in KNO₃ treatment. NO₃ ^- could promote the decomposition and utilization of soluble protein and ABA, increase the expression level of CqNLP1 and CYP707A2 during germination. The optimal NO₃ ^- concentration to promote seed germination is 1 mM.

ACKNOWLEDGMENTS

The research was supported by the Natural Science Foundation of Shanxi Province, China (202203021221122).We thank Dr. Chinjian Yang for kindly editing the manuscript.

REFERENCES

• ALBORESI, A.; GESTIN, C.; LEYDECKER, M.T.; BEDU, M.; MEYER, C.; TRUONG, H.N. Nitrate, a signal relieving seed dormancy in Arabidopsis. Plant, Cell & Environment, v.28, n.4, p.500-512, 2005. https://doi.org/10.1111/j.1365-3040.2005.01292.x.
  » https://doi.org/https://doi.org/10.1111/j.1365-3040.2005.01292.x
• BAI, B.; VAN DER HORST, S.; CORDEWENER, J.H.G.; AMERICA, T.A.H.P.; HANSON, J.; BENTSINK, L. Seed-stored mRNAs that are specifically associated to monosomes are translationally regulated during Germination.Plant Physiology, v.182, n.3, p.378-392, 2020. https://doi.org/10.1104/pp.19.00644.
  » https://doi.org/https://doi.org/10.1104/pp.19.00644
• BRADFORD, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry, v.72, p.248- 254. 1976. https://doi.org/10.1006/abio.1976.9999.
  » https://doi.org/https://doi.org/10.1006/abio.1976.9999
• CHEN, N.; WANG, H.; ABDELMAGEED, H.; VEERAPPAN, V.; TADEGE, M; ALLEN, R.D. HSI2/VAL1 and HSL1/VAL2 function redundantly to repress DOG1 expression in Arabidopsis seeds and seedlings.New Phytologist, v. 227, n.3, p.840-856, 2020. https://doi.org/10.1111/nph.16559.
  » https://doi.org/https://doi.org/10.1111/nph.16559
• CLOUGH, S.J.; BENT, A.F. FLORAL DIP: A Simplified method for Agrobacterium-mediated transformation of Arabidopsis thalianaThe Plant Journal, v.16, n.6, p735-743, 1998. https://doi.org/10.1046/j.1365-313x.1998.00343.x.
  » https://doi.org/https://doi.org/10.1046/j.1365-313x.1998.00343.x
• FINCH-SAVAGE, WE.; CADMAN, CS.; TOOROP, P.E.; LYNN, J.R.; HILHORST, H.W. Seed dormancy release in Arabidopsis Cvi by dry after-ripening, low temperature, nitrate and light shows common quantitative patterns of gene expression directed by environmentally specific sensing. The Plant Journal , v.51, n.1, p.60-78, 2007. https://doi.org/10.1111/j.1365-313X.2007.03118.x.
  » https://doi.org/https://doi.org/10.1111/j.1365-313X.2007.03118.x
• GAO, Y.; PAN, X.; ZENG, F.; ZHENG, CM.; GE, W.X.; SUN, Y.X.; DU, W.P.; WU, X.Y. The identification of suitable internal reference genes in quinoa seeds subjected to abscisic acid and gibberellin treatment. Journal of Seed Science, v.45, e202345034, 2023. https://doi.org/10.1590/2317-1545v45274637.
  » https://doi.org/https://doi.org/10.1590/2317-1545v45274637
• GAO, Y.; QUAN, S.; LYU, B.; TIAN, T.; LIU, Z.; NIE, Z.; QI, S.; JIA, J.; SHU, J.; GROOT, E.; WU, J.; WANG, Y. Barley transcription factor HvNLP2 mediates nitrate signaling and affects nitrogen use efficiency. Journal of Experimental Botany, v.73, n.3, p.770-783, 2022.https://doi.org/10.1093/jxb/erab245.
  » https://doi.org/https://doi.org/10.1093/jxb/erab245
• GILSON, N.; VIEGA, L.; SPERANZA, P. Differential incidence of the lemma on seed germination among different Paspalum dilatatum genotypes. Journal of Seed Science , v.39, n.2, p.133-141, 2017. http://dx.doi.org/10.1590/2317-1545v39n2169225.
  » https://doi.org/http://dx.doi.org/10.1590/2317-1545v39n2169225
• GU, D.; JI, R.; HE, C.; PENG, T.; ZHANG, M.; DUAN, J.; XIONG, C.; LIU, X. Arabidopsis histone methyltransferase SUVH5 Is a positive regulator of light-mediated seed germination.Frontiers in Plant Science, v.10, n.841, 2019. http://doi.org/10.3389/fpls.2019.00841.
  » https://doi.org/http://doi.org/10.3389/fpls.2019.00841
• HAO, Y.; HONG, Y. GUO, H.; QIN, P.; HUANG, A.; YANG, X.; REN, G. Transcriptomic and metabolomic landscape of quinoa during seed germination. BMC Plant Biology, v.22, v.1, p.237, 2022.
• HINOJOSA, L.; GONZÁLEZ, J.A.; BARRIOS-MASIAS, F.H.; FUENTES, F.; MURPHY, K.M. Quinoa abiotic stress responses: a review. Plants (Basel), v.7, n.4, p.106, 2018. https://doi.org/10.3390/plants7040106.
  » https://doi.org/https://doi.org/10.3390/plants7040106
• KONISHI, M.; YANAGISAWA, S. The regulatory region controlling the nitrate-responsive expression of a nitrate reductase gene, NIA1, in Arabidopsis. Plant and Cell Physiology, v.52, n.5, p.824-836, 2011. https://doi.org/10.1093/pcp/pcr033.
  » https://doi.org/https://doi.org/10.1093/pcp/pcr033
• MATAKIADIS, T.; ALBORESI, A.; JIKUMARU, Y.; TATEMATSU, K.; PICHON, O.; RENOU, J.P.; KAMIYA, Y.; NAMBARA, E.; TRUONG, H.N. The Arabidopsis abscisic acid catabolic gene CYP707A2 plays a key role in nitrate control of seed dormancy. Plant Physiology , v.149 n.2 p.949-960, 2009. https://doi.org/10.1104/PP.108.126938.
  » https://doi.org/https://doi.org/10.1104/PP.108.126938
• SANO, N.; MARION-POLL, A. ABA metabolism and homeostasis in seed dormancy and germination. International Journal of Molecular Sciences, v.22, n.10, p.5069, 2021. https://doi.org/10.3390/ijms22105069.
  » https://doi.org/https://doi.org/10.3390/ijms22105069
• SASAKI, K.; KIM, M.H.; KANNO, Y.; SEO, M.; KAMIYA, Y.; IMAI, R. Arabidopsis cold shock domain protein 2 influences ABA accumulation in seed and negatively regulates germination. Biochemical and biophysical Research Communications, v.456, n.1, p.380-384, 2015. https://doi.org/10.1016/j.bbrc.2014.11.092.
  » https://doi.org/https://doi.org/10.1016/j.bbrc.2014.11.092
• SEDMAK, J.J.; GROSSBERG, S.E. A rapid, sensitive, and versatile assay for protein using Coomassie brilliant blue G250. Analytical Biochemistry , v79, n.1-2, p.544-552, 1977. https://doi.org/10.1016/0003-2697(77)90428-6.
  » https://doi.org/https://doi.org/10.1016/0003-2697(77)90428-6
• XU, Y.; LU, J.H.; ZHANG, J.D.; LIU, D.K.; WANG, Y.; NIU, Q.D.; HUANG, D.D. Transcriptome revealed the molecular mechanism of Glycyrrhiza inflata root to maintain growth and development, absorb and distribute ions under salt stress, BMC Plant Biology , v.21, p.1-21, 2021. https://doi.org/10.1186/s12870-021-03342-6.
  » https://doi.org/https://doi.org/10.1186/s12870-021-03342-6
• YAN, D.; EASWARAN, V.; CHAU, V.; OKAMOTO, M.; IERULLO, M.; KIMURA, M. NIN-like protein 8 is a master regulator of nitrate-promoted seed germination in Arabidopsis. Nature Communications, v.7, p.13179, 2016. https://doi.org/10.1038/ncomms13179.
  » https://doi.org/https://doi.org/10.1038/ncomms13179
• YAN, P.; ZENG, Y.J.; SHEN, W.T.; TUO, D.C.; LI, X.Y.; ZHOU, P. Nimble Cloning: A Simple, versatile, and efficient system for standardized molecular cloning. Frontiers in Bioengineering and Biotechnology, v.7, p.460, 2020. https://doi.org/10.3389/fbioe.2019.00460.
  » https://doi.org/https://doi.org/10.3389/fbioe.2019.00460
• ZHOU, W.; DUAN, Y.; JIANG, X.; TAN, X.; LI, Q.; WANG, H.; ZHANG, Y.; ZHANG, M. Transcriptome and metabolome analyses reveal novel insights into the seed germination of Michelia chapensis, an endangered species in China. Plant Science, v.328, p.111568. https://doi.org/10.1016/j.plantsci.2022.111568.
  » https://doi.org/https://doi.org/10.1016/j.plantsci.2022.111568
• ZHU, M.X.; ZHANG, Y.R.; YANG, Y.S.; YANG, X.L.; WANG, C.Y.; DENG, Y.; ZHAO, L.; ZHANG, LG.; QIN, L.X.; YANG, L.Y. Identification and expression analysis of NLP transcription factor family of Chenopodium quinoa Acta Agriculturae Boreali-Sinica v.36, n.4, p.37-46, 2021. https://doi.org/10.7668/hbnxb.20191913.
  » https://doi.org/https://doi.org/10.7668/hbnxb.20191913

Publication Dates

• Publication in this collection
  26 Aug 2024
• Date of issue
  2024

History

• Received
  11 Jan 2024
• Accepted
  15 July 2024