Molecular target |
Methodology |
Primer/Probe sequences (5’-3’) or Kit company/Consortium |
Reference |
T. cruzi satellite DNA |
Conventional PCR or real time PCR |
TcZ-F “GCTCTTGCCCACAMGGGTGC” |
8282. Schijman AG, Bisio M, Orellana L, Sued M, Duffy T, Mejia Jaramillo AM, et al. International study to evaluate PCR methods for detection of Trypanosoma cruzi DNA in blood samples from Chagas disease patients. PLoS Negl Trop Dis. 2011; 5(1): e93.
|
Tcz-R “CCAAGCAGCGGATAGTTCAGG” |
Standardised in-house TaqMan qPCR |
Cruzi 1 “ASTCGGCTGATCGTTTTCGA” |
8282. Schijman AG, Bisio M, Orellana L, Sued M, Duffy T, Mejia Jaramillo AM, et al. International study to evaluate PCR methods for detection of Trypanosoma cruzi DNA in blood samples from Chagas disease patients. PLoS Negl Trop Dis. 2011; 5(1): e93.,8585. Ramírez JC, Cura CI, Moreira OC, Lages-Silva E, Juiz N, Velázquez E, et al. Analytical validation of quantitative real-time PCR methods for quantification of Trypanosoma cruzi DNA in blood samples from Chagas disease patients. J Mol Diagn. 2015; 17(5): 605-15.
|
Cruzi 2 “AATTCCTCCAAGCAGCGGATA” |
Cruzi 3 Probe “FAM-CACACACTGGACACCAA-NFQ-MGB” |
Comercial real time PCR |
Wiener Lab-CONICET-ANLIS MALBRAN-Argentina |
5454. Benatar AF, Sosa-Estani S, Rojkin F, Schijman AG. Validation of a real time PCR kit prototype for early diagnosis of congenital Chagas disease in a multicenter field study. Medicina. 2017; 77(Suppl. 1): 400.
|
RealCycler CHAG; Progenie Molecular, Spain |
6060. Abras A, Ballart C, Llovet T, Roig C, Gutiérrez C, Tebar S, et al. Introducing automation to the molecular diagnosis of Trypanosoma cruzi infection: a comparative study of sample treatments, DNA extraction methods and real-time PCR assays. PLoS One. 2018; 13(4): e0195738.
|
TCRUZI DNA.CE Diagnostic Bioprobes Srl, Italy |
6161. Seiringer P, Pritsch M, Flores-Chávez M, Marchisio E, Helfrich K, Mengele C, et al. Comparison of four PCR methods for efficient detection of Trypanosoma cruzi in routine diagnostics. Diagn Microbiol Infect Dis. 2017; 88(3): 225-32.
|
Comercial LAMP |
Eiken Chemical Company, Japan |
5353. Besuschio SA, Murcia ML, Benatar AF, Monnerat S, Cruz I, Picado A, et al. Analytical sensitivity and specificity of a loop-mediated isothermal amplification (LAMP) kit prototype for detection of Trypanosoma cruzi DNA in human blood samples. PLoS Negl Trop Dis. 2017; 11(7): e0005779.,5959. Besuschio SA, Picado A, Calderon-Muñoz A, Wehrendt DP, Fernández M, Benatar A, et al. Trypanosoma cruzi Loop mediated isothermal amplification (Trypanosoma cruzi Loopamp(tm)) kit for detection of congenital, acute or Chagas disease reactivation. PLoS Negl Trop Dis. 2020; 14(8): e0008402.
|
T. cruzi minicircle DNA |
Conventional PCR |
121 “AAATAATGTACGGGKGAGATGCATGA” |
5050. Schijman AG, Altcheh J, Burgos JM, Biancardi M, Bisio M, Levin MJ, et al. Aetiological treatment of congenital Chagas' disease diagnosed and monitored by the polymerase chain reaction. J Antimicrob Chemother. 2003; 52(3): 441-9.,5151. Mora MC, Sanchez-Negrette O, Marco D, Barrio A, Ciaccio M, Segura MA, et al. Early diagnosis of congenital Trypanosoma cruzi infection using PCR, hemoculture, and capillary concentration, as compared with delayed serology. J Parasitol. 2005; 91: 1468-73.,5252. Cura CI, Ramírez JC, Rodríguez M, Lopez-Albízu C, Irazu L, Scollo K, et al. Comparative study and analytical verification of PCR methods for the diagnosis of congenital Chagas disease. J Mol Diagn. 2017; 19(5): 673-81.,8282. Schijman AG, Bisio M, Orellana L, Sued M, Duffy T, Mejia Jaramillo AM, et al. International study to evaluate PCR methods for detection of Trypanosoma cruzi DNA in blood samples from Chagas disease patients. PLoS Negl Trop Dis. 2011; 5(1): e93.
|
122 “GGTTCGATTGGGGTTGGTGTAATATA” |
Standardised in-house TaqMan qPCR |
32F “TTTGGGAGGGGCGTTCA” |
8585. Ramírez JC, Cura CI, Moreira OC, Lages-Silva E, Juiz N, Velázquez E, et al. Analytical validation of quantitative real-time PCR methods for quantification of Trypanosoma cruzi DNA in blood samples from Chagas disease patients. J Mol Diagn. 2015; 17(5): 605-15.
|
148R “ATATTACACCAACCCCAATCGAA” |
71P Probe “FAM-CATCTCACCCGTACATT-BHQ1a ” |
Comercial real time PCR |
Real STAR Chagas, ALTONA Diagnostics, Germany |
6262. Besuschio SA, Wehrendt DP, Kuhn H, Longhi SA, Rottengatter K, Schijman AG. Towards the use of qualitative real time PCR as a routine tool for Neglected Tropical Diseases: evaluation of a commercial kit for detection of Trypanosoma cruzi DNA. XV Congreso de Microbiología, CAM 2019, Argentina.
|