Primer |
Gene region |
Primer sequence (5´- 3´) |
PCR conditions(1)
|
Fragment length(2)
|
Source |
ASIP_F2 |
ASIP/Ex2 |
acactgggctgtgggatg |
62/1.5 |
410 |
Gratten et al. (2010GRATTEN, J.; PILKINGTON, J.G.; BROWN, E.A.; BERALDI, D.; PEMBERTON, J.M.; SLATE, J. The genetic basis of recessive self-colour pattern in a wild sheep population. Heredity, v.104, p.206-214, 2010. DOI: 10.1038/hdy.2009.105. https://doi.org/10.1038/hdy.2009.105...
) |
ASIP_R2 |
|
agggacacttgattcctcca |
|
|
|
ASIP_F3 |
ASIP/Ex3 |
ctctttgctgtcagtctctgg |
60/2.0 |
391 |
Gratten et al. (2010GRATTEN, J.; PILKINGTON, J.G.; BROWN, E.A.; BERALDI, D.; PEMBERTON, J.M.; SLATE, J. The genetic basis of recessive self-colour pattern in a wild sheep population. Heredity, v.104, p.206-214, 2010. DOI: 10.1038/hdy.2009.105. https://doi.org/10.1038/hdy.2009.105...
) |
ASIP_R3 |
|
tggtagctttctgtttctctgg |
|
|
|
ASIP_F4 |
ASIP/Ex4 |
cagctagggtgctctgtgg |
60/1.5 |
650 |
Gratten et al. (2010GRATTEN, J.; PILKINGTON, J.G.; BROWN, E.A.; BERALDI, D.; PEMBERTON, J.M.; SLATE, J. The genetic basis of recessive self-colour pattern in a wild sheep population. Heredity, v.104, p.206-214, 2010. DOI: 10.1038/hdy.2009.105. https://doi.org/10.1038/hdy.2009.105...
) |
ASIP_R4 |
|
agcctcagggctaagcaac |
|
|
|
Agt_8b |
ASIP
|
aacaggttcatggaagaattg |
|
|
|
Agt_7b |
ASIP/Del |
6FAM-ctacctgactgccttctctg |
55/2.0 |
165 -174 |
Norris & Whan (2008NORRIS, B.J.; WHAN, V.A. A gene duplication affecting expression of the ovine ASIP gene is responsible for white and black sheep. Genome Research, v.18, p.1282-1293, 2008. DOI: 10.1101/gr.072090.107. https://doi.org/10.1101/gr.072090.107...
) |
Agt 1 |
ASIP
|
cattactggggacctatcaac |
|
|
|
Agt 11 |
|
tatcggcttggagagtgtttg |
|
|
|
Agt_16b |
ASIP/Dupl |
6FAM-agcaatgaggacgtgagttt |
60/2.0 |
238 -242 |
Norris & Whan (2008NORRIS, B.J.; WHAN, V.A. A gene duplication affecting expression of the ovine ASIP gene is responsible for white and black sheep. Genome Research, v.18, p.1282-1293, 2008. DOI: 10.1101/gr.072090.107. https://doi.org/10.1101/gr.072090.107...
) |
Agt_17b |
|
gtttctgctggacctcttgttc |
|
|
|
Agt_18b |
ASIP
|
gtgccttgtgaggtagagatggtgt |
|
|
|
Font_F1 |
MC1R/Ex1 |
agtgcctggaggtgtccatcc |
64/2.5 |
169 |
Fontanesi et al. (2010FONTANESI, L.; BERETTI, F.; RIGGIO, V.; DALL’OLIO, S.; CALASCIBETTA, V.; RUSSO, V.; PORTOLANO, B. Sequence characterization of the melanocortin 1 receptor (MC1R) gene in sheep with different coat colours and identification of the putative e allele at the ovine Extension locus. Small Ruminant Research, v.91, p.200-207, 2010. DOI: 10.1016/j.smallrumres.2010.03.015. https://doi.org/10.1016/j.smallrumres.20...
) |
Font_R1 |
|
ctgacgctcaccagcaagt |
|
|
|
Font_F2 |
MC1R/Ex1 |
agccatgagttgagcaggac |
62/1.0 |
376 |
Fontanesi et al. (2010FONTANESI, L.; BERETTI, F.; RIGGIO, V.; DALL’OLIO, S.; CALASCIBETTA, V.; RUSSO, V.; PORTOLANO, B. Sequence characterization of the melanocortin 1 receptor (MC1R) gene in sheep with different coat colours and identification of the putative e allele at the ovine Extension locus. Small Ruminant Research, v.91, p.200-207, 2010. DOI: 10.1016/j.smallrumres.2010.03.015. https://doi.org/10.1016/j.smallrumres.20...
) |
Font_R2 |
|
caggacaccagcctccag |
|
|
|
Font_F3 |
MC1R/Ex1 |
gtgagcgtcagcaacgtg |
61/1.5 |
366 |
Fontanesi et al. (2010FONTANESI, L.; BERETTI, F.; RIGGIO, V.; DALL’OLIO, S.; CALASCIBETTA, V.; RUSSO, V.; PORTOLANO, B. Sequence characterization of the melanocortin 1 receptor (MC1R) gene in sheep with different coat colours and identification of the putative e allele at the ovine Extension locus. Small Ruminant Research, v.91, p.200-207, 2010. DOI: 10.1016/j.smallrumres.2010.03.015. https://doi.org/10.1016/j.smallrumres.20...
) |
Font_R3 |
|
acatagaggacggccatcag |
|
|
|
Font_F4 |
MC1R/Ex1 |
gcctggttggcttcttcata |
58/2.5 |
456 |
Fontanesi et al. (2010FONTANESI, L.; BERETTI, F.; RIGGIO, V.; DALL’OLIO, S.; CALASCIBETTA, V.; RUSSO, V.; PORTOLANO, B. Sequence characterization of the melanocortin 1 receptor (MC1R) gene in sheep with different coat colours and identification of the putative e allele at the ovine Extension locus. Small Ruminant Research, v.91, p.200-207, 2010. DOI: 10.1016/j.smallrumres.2010.03.015. https://doi.org/10.1016/j.smallrumres.20...
) |
Font_R4 |
|
tggtctagcgatcctctttg |
|
|
|
Tyrp_EX1F |
TYRP1/Ex1 |
tggctgttttgtactgcctg |
58/1.5 |
750 |
Deng et al. (2008DENG, W.D.; XI, D.M.; GOU, X.; YANG, S.L.; SHI, X.W.; MAO, H.M. Pigmentation in Black-boned sheep (Ovis aries): association with polymorphism of the Tyrosinase gene. Molecular Biology Reports, v.35, p.379-385, 2008. DOI: 10.1007/s11033-007-9097-z. https://doi.org/10.1007/s11033-007-9097-...
) |
Tyrp_EX1R |
|
ccctcccatgtactcatctgt |
|
|
|
Tyrp_EX4F |
TYRP1/Ex4 |
tgcaggatccttctttctcc |
58/2.5 |
400 |
Gratten et al. (2007GRATTEN, J.; BERALDI, D.; LOWDER, B.V.; MCRAE, A.F.; VISSCHER, P.M.; PEMBERTON, J.M.; SLATE, J. Compelling evidence that a single nucleotide substitution in TYRP1 is responsible for coat-colour polymorphism in a free-living population of Soay sheep. Proceedings of the Royal Society B, v.274, p.619-626, 2007. DOI: 10.1098/rspb.2006.3762. https://doi.org/10.1098/rspb.2006.3762...
) |
Tyrp_EX4R |
|
tgaatatctgtacatccgttctct |
|
|
|
Tyrp_INT_F |
TYRP1/Ex1 |
caagagcctgatggagaagga |
60/2.0 |
425 |
Deng et al. (2008DENG, W.D.; XI, D.M.; GOU, X.; YANG, S.L.; SHI, X.W.; MAO, H.M. Pigmentation in Black-boned sheep (Ovis aries): association with polymorphism of the Tyrosinase gene. Molecular Biology Reports, v.35, p.379-385, 2008. DOI: 10.1007/s11033-007-9097-z. https://doi.org/10.1007/s11033-007-9097-...
) |
Tyrp_INT_R |
|
cattaaacaggggcgttgttc |
|
|
|