Genetic characterization of coat color genes in Brazilian Crioula sheep from a conservation nucleus

Cavalcanti, Lilian Cristina Gomes; Moraes, José Carlos Ferrugem; Faria, Danielle Assis de; McManus, Concepta Margaret; Nepomuceno, Alcebiades Renato; Souza, Carlos José Hoff de; Caetano, Alexandre Rodrigues; Paiva, Samuel Rezende

doi:10.1590/S0100-204X2017000800007

Acessibilidade / Reportar erro

Brasil

Pesquisa Agropecuária Brasileira

Español English

Brasil

Español English

sumário « anterior atual seguinte »

Sumário

GENETICS • Pesq. agropec. bras. 52 (8) • Aug 2017 • https://doi.org/10.1590/S0100-204X2017000800007 copy

Genetic characterization of coat color genes in Brazilian Crioula sheep from a conservation nucleus

Caracterização genética de genes para cor da pelagem do núcleo de conservação da ovelha Crioula no Brasil

Authorship SCIMAGO INSTITUTIONS RANKINGS

Abstract:

The objective of this work was to identify single nucleotide polymorphisms (SNPs) in resequencing data from MC1R, ASIP, and TYRP1 genes derived from Crioula sheep (Ovis aris) with different coat colors. Polymorphisms in the ASIP (agouti-signaling protein), MC1R (melanocortin 1 receptor), and TRYP1 (tyrosinase-related protein 1) genes were analyzed in 115 sheep from Embrapa’s conservation nucleus of crioula sheep, in Brazil. A total of 7,914 bp were sequenced per animal, and 14 SNPs were identified. Two additional assays were performed to detect duplications and deletions in the ASIP gene. Ninety-five percent of the coat color variation was explained by epistatic interactions observed between specific alleles in the MC1R and ASIP genes. Evidence suggests an important role of TYRP1 variants for wool color, despite their low frequencies. The marker panel was efficient enough in predicting coat color in the studied animals and, therefore, can be used to implement a marker-assisted selection program in the conservation nucleus of sheep of the crioula breed.

Index terms:
Ovis aris; ASIP; genetic resources conservation; marker-assisted selection; MC1R; TYRP1

Embrapa Secretaria de Pesquisa e Desenvolvimento; Pesquisa Agropecuária Brasileira Caixa Postal 040315, 70770-901 Brasília DF Brazil, Tel. +55 61 3448-1813, Fax +55 61 3340-5483 - Brasília - DF - Brazil
E-mail: pab@embrapa.br

Acompanhe os números deste periódico no seu leitor de RSS

[TFN1] ⁽¹⁾Crosses eliminated after the contradictory results of the paternity test between the MC1R SNPs and pedigree records.

Description of the herd crosses		Number of crosses		Number of progenies
Description of the herd crosses		Eliminated ⁽¹⁾	Included	Dark	White/Pale
Group 1, white or pale wool
	White x black	0	4	2	3
	White x white	0	1	0	1
	White x mouro	0	2	4	0
	White x mouro malhado	1	0	0	0
	White x white masked	0	1	1	1
	White masked x black	0	2	1	1
	White masked x white	0	2	0	2
	White masked x mouro	1	0	0	0
	White masked x black with white spots	0	2	2	0
	White masked x mouro malhado	0	1	1	0
	Pale brown x white	1	2	0	2
Subtotal		3	17	11	10
Group 2, dark wool
	Black x black	7	9	8	2
	Black x mouro	0	2	1	1
	Black x black with white spots	1	1	1	0
	Black x mouro malhado	2	3	3	0
	Mouro x black	1	4	2	2
	Mouro x mouro	0	1	0	1
	Mouro x black with white spots	1	3	1	2
	Mouro x mouro malhado	0	1	1	0
Subtotal		12	24	17	8
Total		15	41	28	18

Primer	Gene region	Primer sequence (5´- 3´)	PCR conditions⁽¹⁾	Fragment length⁽²⁾	Source
ASIP_F2	ASIP/Ex2	acactgggctgtgggatg	62/1.5	410	Gratten et al. (2010GRATTEN, J.; PILKINGTON, J.G.; BROWN, E.A.; BERALDI, D.; PEMBERTON, J.M.; SLATE, J. The genetic basis of recessive self-colour pattern in a wild sheep population. Heredity, v.104, p.206-214, 2010. DOI: 10.1038/hdy.2009.105. https://doi.org/10.1038/hdy.2009.105... )
ASIP_R2		agggacacttgattcctcca
ASIP_F3	ASIP/Ex3	ctctttgctgtcagtctctgg	60/2.0	391	Gratten et al. (2010GRATTEN, J.; PILKINGTON, J.G.; BROWN, E.A.; BERALDI, D.; PEMBERTON, J.M.; SLATE, J. The genetic basis of recessive self-colour pattern in a wild sheep population. Heredity, v.104, p.206-214, 2010. DOI: 10.1038/hdy.2009.105. https://doi.org/10.1038/hdy.2009.105... )
ASIP_R3		tggtagctttctgtttctctgg
ASIP_F4	ASIP/Ex4	cagctagggtgctctgtgg	60/1.5	650	Gratten et al. (2010GRATTEN, J.; PILKINGTON, J.G.; BROWN, E.A.; BERALDI, D.; PEMBERTON, J.M.; SLATE, J. The genetic basis of recessive self-colour pattern in a wild sheep population. Heredity, v.104, p.206-214, 2010. DOI: 10.1038/hdy.2009.105. https://doi.org/10.1038/hdy.2009.105... )
ASIP_R4		agcctcagggctaagcaac
Agt_8b	ASIP	aacaggttcatggaagaattg
Agt_7b	ASIP/Del	6FAM-ctacctgactgccttctctg	55/2.0	165 -174	Norris & Whan (2008NORRIS, B.J.; WHAN, V.A. A gene duplication affecting expression of the ovine ASIP gene is responsible for white and black sheep. Genome Research, v.18, p.1282-1293, 2008. DOI: 10.1101/gr.072090.107. https://doi.org/10.1101/gr.072090.107... )
Agt 1	ASIP	cattactggggacctatcaac
Agt 11		tatcggcttggagagtgtttg
Agt_16b	ASIP/Dupl	6FAM-agcaatgaggacgtgagttt	60/2.0	238 -242	Norris & Whan (2008NORRIS, B.J.; WHAN, V.A. A gene duplication affecting expression of the ovine ASIP gene is responsible for white and black sheep. Genome Research, v.18, p.1282-1293, 2008. DOI: 10.1101/gr.072090.107. https://doi.org/10.1101/gr.072090.107... )
Agt_17b		gtttctgctggacctcttgttc
Agt_18b	ASIP	gtgccttgtgaggtagagatggtgt
Font_F1	MC1R/Ex1	agtgcctggaggtgtccatcc	64/2.5	169	Fontanesi et al. (2010FONTANESI, L.; BERETTI, F.; RIGGIO, V.; DALL’OLIO, S.; CALASCIBETTA, V.; RUSSO, V.; PORTOLANO, B. Sequence characterization of the melanocortin 1 receptor (MC1R) gene in sheep with different coat colours and identification of the putative e allele at the ovine Extension locus. Small Ruminant Research, v.91, p.200-207, 2010. DOI: 10.1016/j.smallrumres.2010.03.015. https://doi.org/10.1016/j.smallrumres.20... )
Font_R1		ctgacgctcaccagcaagt
Font_F2	MC1R/Ex1	agccatgagttgagcaggac	62/1.0	376	Fontanesi et al. (2010FONTANESI, L.; BERETTI, F.; RIGGIO, V.; DALL’OLIO, S.; CALASCIBETTA, V.; RUSSO, V.; PORTOLANO, B. Sequence characterization of the melanocortin 1 receptor (MC1R) gene in sheep with different coat colours and identification of the putative e allele at the ovine Extension locus. Small Ruminant Research, v.91, p.200-207, 2010. DOI: 10.1016/j.smallrumres.2010.03.015. https://doi.org/10.1016/j.smallrumres.20... )
Font_R2		caggacaccagcctccag
Font_F3	MC1R/Ex1	gtgagcgtcagcaacgtg	61/1.5	366	Fontanesi et al. (2010FONTANESI, L.; BERETTI, F.; RIGGIO, V.; DALL’OLIO, S.; CALASCIBETTA, V.; RUSSO, V.; PORTOLANO, B. Sequence characterization of the melanocortin 1 receptor (MC1R) gene in sheep with different coat colours and identification of the putative e allele at the ovine Extension locus. Small Ruminant Research, v.91, p.200-207, 2010. DOI: 10.1016/j.smallrumres.2010.03.015. https://doi.org/10.1016/j.smallrumres.20... )
Font_R3		acatagaggacggccatcag
Font_F4	MC1R/Ex1	gcctggttggcttcttcata	58/2.5	456	Fontanesi et al. (2010FONTANESI, L.; BERETTI, F.; RIGGIO, V.; DALL’OLIO, S.; CALASCIBETTA, V.; RUSSO, V.; PORTOLANO, B. Sequence characterization of the melanocortin 1 receptor (MC1R) gene in sheep with different coat colours and identification of the putative e allele at the ovine Extension locus. Small Ruminant Research, v.91, p.200-207, 2010. DOI: 10.1016/j.smallrumres.2010.03.015. https://doi.org/10.1016/j.smallrumres.20... )
Font_R4		tggtctagcgatcctctttg
Tyrp_EX1F	TYRP1/Ex1	tggctgttttgtactgcctg	58/1.5	750	Deng et al. (2008DENG, W.D.; XI, D.M.; GOU, X.; YANG, S.L.; SHI, X.W.; MAO, H.M. Pigmentation in Black-boned sheep (Ovis aries): association with polymorphism of the Tyrosinase gene. Molecular Biology Reports, v.35, p.379-385, 2008. DOI: 10.1007/s11033-007-9097-z. https://doi.org/10.1007/s11033-007-9097-... )
Tyrp_EX1R		ccctcccatgtactcatctgt
Tyrp_EX4F	TYRP1/Ex4	tgcaggatccttctttctcc	58/2.5	400	Gratten et al. (2007GRATTEN, J.; BERALDI, D.; LOWDER, B.V.; MCRAE, A.F.; VISSCHER, P.M.; PEMBERTON, J.M.; SLATE, J. Compelling evidence that a single nucleotide substitution in TYRP1 is responsible for coat-colour polymorphism in a free-living population of Soay sheep. Proceedings of the Royal Society B, v.274, p.619-626, 2007. DOI: 10.1098/rspb.2006.3762. https://doi.org/10.1098/rspb.2006.3762... )
Tyrp_EX4R		tgaatatctgtacatccgttctct
Tyrp_INT_F	TYRP1/Ex1	caagagcctgatggagaagga	60/2.0	425	Deng et al. (2008DENG, W.D.; XI, D.M.; GOU, X.; YANG, S.L.; SHI, X.W.; MAO, H.M. Pigmentation in Black-boned sheep (Ovis aries): association with polymorphism of the Tyrosinase gene. Molecular Biology Reports, v.35, p.379-385, 2008. DOI: 10.1007/s11033-007-9097-z. https://doi.org/10.1007/s11033-007-9097-... )
Tyrp_INT_R		cattaaacaggggcgttgttc

ASIP polymorphism	Genotype	Number of observations⁽¹⁾							Total
ASIP polymorphism	Genotype	White	White masked	Pale brown	Black	Black with spots	Mouro	Mouro malhado	Total
		Absence of ASIP duplication
Exon 2 deletions	D₅N	-	-	-	11 (7)	6 (2)	-	1 (1)	18
	D₉N	-	-	-	2 (1)	-	-	-	2
	NN	1	-	-	3 (2)	1 (1)	3 (1)	1	9
	D₅D₅	-	-	-	1 (1)	-	-	-	1
	Total	1	-	-	17 (17)	7 (3)	3 (1)	2 (1)	30
Exon 4 (g.5172T>A)	TT	-	-	-	7 (5)	1	-	1(1)	9
	TA	1	-	-	7 (5)	5 (2)	3 (1)	1	17
	AA	-	-	-	3 (1)	1 (1)	-	-	4
	Total	1	-	-	17 (17)	7 (3)	3 (1)	2 (1)	30
		Presence of ASIP duplication
Exon 2 deletions	D₅D₉ND₅N	1	1	1	5 (5)	1 (1)	1 (1)	-	10
	D₅N	7	7	-	12 (10)	6 (6)	2 (2)	1 (1)	35
	D₉N	2	2	-	2 (2)	-	-	1 (1)	7
	NN	3	2	-	3 (3)	-	-	-	9
	Total	13	12	1	22 (22)	7 (7)	3 (3)	2 (2)	61
Exon 4 (g.5172T>A)	TT	4	2	-	11 (10)	5 (5)	1 (1)	1 (1)	24
	TA	8	9	1	11 (9)	2 (2)	2 (2)	1 (1)	35
	AA	1	1	-	-	-	-	-	2
	Total	13	12	1	22 (22)	7 (7)	3 (3)	2 (2)	61

Genotype combination	Progenies (N=46)	Parents (N=45)
MC1R E⁺E⁺/ E^D_	p<0.0001	p<0.0001
ASIP duplication	p<0.0001	p=0.02
MC1R E⁺E⁺/ E^D and ASIP duplication	p<0.0001	p<0.0001
ASIP exon 2 deletion	p=0.4	p=0.99
ASIP c.5172T>A exon 4	p=0.04	p=0.15
MC1R E⁺E⁺/ E^D_ and ASIP duplication and deletion	p<0.0001	p<0.0001
TYRP1 c.192G>C exon 1	p=0.52	p=0.12
TYRP1 c.462C>T exon 1	p=0.09	p=0.007