Identificação e Validação de Genes de Referência para a Normalização no Real-Time RT-qPCR em Arroz e Arroz Vermelho em Competição, sob Diferentes Doses de Nitrogênio

BENEMANN, D.P.; NOHATO, A.M.; VARGAS, L.; AVILA, L.A; AGOSTINETTO, D.

Acessibilidade / Reportar erro

Brasil

Español English

sumário « anterior atual seguinte »

Sumário

Article • Planta daninha 35 • 2017 • https://doi.org/10.1590/S0100-83582017350100015 copiar

Identificação e Validação de Genes de Referência para a Normalização no Real-Time RT-qPCR em Arroz e Arroz Vermelho em Competição, sob Diferentes Doses de Nitrogênio

Autoria SCIMAGO INSTITUTIONS RANKINGS

RESUMO

Reação em cadeia da polimerase da transcrição reversa em tempo real (RT qPCR) é uma técnica importante para analisar a expressão diferencial dos genes, devido à sua sensibilidade, exatidão e especificidade. No entanto, antes da análise da expressão do gene alvo, é necessário identificar e avaliar a estabilidade dos genes candidatos a referência para a normalização apropriada. O objetivo deste trabalho foi avaliar a estabilidade de genes candidatos a genes de referência, a fim de identificar os genes mais adequados para normalização da transcrição em arroz e arroz-vermelho em competição, sob diferentes doses de nitrogênio, e demonstrar a eficácia do gene de referência selecionado pela expressão da ascorbato peroxidase citosólica (OsAPX2). Onze genes candidatos a referência foram avaliados usando o aplicativo online RefFinder, que integra os quatro principais programas de software: geNorm, NormFinder, BestKeeper e método comparativo delta Ct, bem como fez-se análise de variância para identificar genes com menores valores de desvio-padrão e coeficiente de variação. Dos 11 genes, oito apresentaram eficiência dentro do padrão desejado, e, destes, o gene UBC-E2 foi o mais estável. A expressão do gene OsAPX2 mostrou-se eficiente para validação do gene candidato a referência. Este estudo é o primeiro levantamento sobre a estabilidade de genes de referência em arroz e arroz-vermelho em competição, fornecendo informações para obtenção de resultados mais precisos em RT-qPCR.

Palavras-chave:
Oryza sativa; expressão gênica; normalização

Sociedade Brasileira da Ciência das Plantas Daninhas Departamento de Fitotecnia - DFT, Universidade Federal de Viçosa - UFV, 36570-000 - Viçosa-MG - Brasil, Tel./Fax::(+55 31) 3899-2611 - Viçosa - MG - Brazil
E-mail: rpdaninha@gmail.com

Acompanhe os números deste periódico no seu leitor de RSS

[1] * Corresponding author: <daiane_bio@yahoo.com.br>

Gene (reference)	F (5'-3')	R (5'-3')	Efficiency rice	Efficiency red rice
ACT11 (Zhang and Hu, 2009Zhang Z., Hu J. Development and validation of endogenous reference genes for expression profiling of Medaka (Oryzias latipes) exposed to endocrine disrupting chemicals by quantitative real-time RT-PCR. Toxicol Sci. 2009;95:356-68.)	CAGCCACACTGTCCCCATCTA	AGCAAGGTCGAGACGAAGGA	2.44	2.36
β-Tubulina (Zhang and Hu, 2009Zhang Z., Hu J. Development and validation of endogenous reference genes for expression profiling of Medaka (Oryzias latipes) exposed to endocrine disrupting chemicals by quantitative real-time RT-PCR. Toxicol Sci. 2009;95:356-68.)	GCTGACCACACCTAGCTTTGG	AGGGAACCTTAGGCAGCATGT	2.87	2.83
Eef-1a (Zhang and Hu, 2007)	TTTCACTCTTGGTGTGAAGCAGAT	GACTTCCTTCACGATTTCATCGTAA	1.84	2.15
UBC-E2 (Jain et al., 2006Jain M. et al. Validation of housekeeping genes as internal control for studying gene expression in rice by quantitative real-time PCR. Biochem Biophys Res Comm. 2006;345:646-51. )	CCGTTTGTAGAGCCATAATTGCA	AGGTTGCCTGAGTCACAGTTAAGTG	2.14	2.05
eIF-4-a (Jain et al., 2006Jain M. et al. Validation of housekeeping genes as internal control for studying gene expression in rice by quantitative real-time PCR. Biochem Biophys Res Comm. 2006;345:646-51. )	TTGTGCTGGATGAAGCTGATG	GGAAGGAGCTGGAAGATATCATAGA	2.13	2.13
UBQ10 (Jain et al., 2006Jain M. et al. Validation of housekeeping genes as internal control for studying gene expression in rice by quantitative real-time PCR. Biochem Biophys Res Comm. 2006;345:646-51. )	TGGTCAGTAATCAGCCAGTTTGG	GCACCACAAATACTTGACGAACAG	1.83	1.82
UBQ5 (Jain et al., 2006Jain M. et al. Validation of housekeeping genes as internal control for studying gene expression in rice by quantitative real-time PCR. Biochem Biophys Res Comm. 2006;345:646-51. )	ACCACTTCGACCGCCACTACT	ACGCCTAAGCCTGCTGGTT	2.19	2.20
GAPDH (Jain et al., 2006Jain M. et al. Validation of housekeeping genes as internal control for studying gene expression in rice by quantitative real-time PCR. Biochem Biophys Res Comm. 2006;345:646-51. )	AAGCCAGCATCCTATGATCAGATT	CGTAACCCAGAATACCCTTGAGTTT	2.06	2.10
TIP41 - Like (Caldana et al., 2007Caldana C. et al. A quantitative RT-PCR platform for higt-throughput expression profiling of 2500 rice transcription factors. Plant Meth. 2007;3:1-9.)	GTTTGGATGAACCCCGCAA	GGCAACAAGGTCAATCCGATC	1.50	2.30
Cyclophilin (Caldana et al., 2007Caldana C. et al. A quantitative RT-PCR platform for higt-throughput expression profiling of 2500 rice transcription factors. Plant Meth. 2007;3:1-9.)	CCACCATCACAGATCGGATCTT	CGTAACCCAGAATACCCTTGAGTTT	2.17	2.03
18S rRNA (Jain et al., 2006Jain M. et al. Validation of housekeeping genes as internal control for studying gene expression in rice by quantitative real-time PCR. Biochem Biophys Res Comm. 2006;345:646-51. )	CTACGTCCCTGCCCTTTGTACA	GCAACAAGGTCAATCCGATC	2.20	2.14

		18S	Cyclophilin	Eef-1a	EIf-4a	GAPDH	UBC-E2	UBQ5	UBQ10
X	Rice	18.08	29.92	32.01	31.30	27.41	28.79	27.00	32.92
X	Red rice	18.61	30.00	29.94	30.33	26.24	28.63	26.90	24.52
CV	Rice	10.40	4.49	11.69	3.45	8.99	3.29	5.44	4.14
CV	Red rice	9.41	2.63	2.51	2.18	2.96	1.34	1.57	3.11
SD	Rice	1.88	1.34	3.74	1.08	2.46	0.94	1.35	1.03
Red rice	1.75	0.78	0.75	0.60	0.77	0.38	0.42	0.76