Enterotoxin-encoding genes in <i>Staphylococcus aureus</i> from buffalo milk

This paper investigated the occurrence of Staphylococcus aureus and the detection of enterotoxin-encoding genes of these strains in milk collected from 30 Murrah buffaloes used to produce dairy products in Brazil. A total of 68 strains of Staphylococcus aureus were found as identified by conventional laboratory tests, and thus screened for sea, seb, sec, sed, see, seg, seh and sei enterotoxin-encoding genes by polymerase chain reaction (PCR). Twelve strains containing enterotoxin-amplified genes were found, with higher expression for the sei and seh genes. These results can be attributed to animal health and inadequate cleaning of the equipment, indicating the need for better quality control in animal production and health lines. The results of this study with the presence of pathogens and their enterotoxigenic potential indicate a source of food poisoning, as well as being a pioneering study in the detection of new enterotoxins for buffalo milk.

INDEX TERMS:
Enterotoxin; encoding genes; Staphylococcus aureus; buffalo; animal origin food; food microbiology; mastitis; milk quality; bovine

Authorship

Emmanuella O. Moura

Graduate Studies Program in Animal Production, Unidade Acadêmica Especializada em Ciências Agrárias, Universidade Federal do Rio Grande do Norte (UFRN), RN-160 Km 3, Cx. Postal 07, Distrito de Jundiaí, Macaíba, RN 59280-000, Brazil.Universidade Federal do Rio Grande do NorteBrazilMacaíba, RN, Brazil Graduate Studies Program in Animal Production, Unidade Acadêmica Especializada em Ciências Agrárias, Universidade Federal do Rio Grande do Norte (UFRN), RN-160 Km 3, Cx. Postal 07, Distrito de Jundiaí, Macaíba, RN 59280-000, Brazil.

Adriano H.N. Rangel

Cláudia S. Macêdo

Stela A. Urbano

Luciano P. Novaes

Dorgival M. Lima Júnior^**Corresponding author: juniorzootec@yahoo.com.br

Universidade Federal de Alagoas (UFAL), Campus Arapiraca, Av. Manoel Severino Barbosa s/n, Bom Sucesso, Arapiraca, AL 57309-005, Brazil.Universidade Federal de AlagoasBrazilArapiraca, AL, Brazil Universidade Federal de Alagoas (UFAL), Campus Arapiraca, Av. Manoel Severino Barbosa s/n, Bom Sucesso, Arapiraca, AL 57309-005, Brazil.

https://orcid.org/0000-0002-1154-8579

*Corresponding author: juniorzootec@yahoo.com.br

Conflict of interest statement.- The authors declare that they have no conflicts of interest.

SCIMAGO INSTITUTIONS RANKINGS

Figures | Tables

Figures (1)
Tables (2)

Thumbnail

Fig.1.
Agarose gel containing the amplified PCR products from enterotoxin-encoding genes of Staphylococcus aureus. M = 1,000bp DNA ladder, 1 = positive control for sea (120 bp), 2 = positive sample for sea (120 bp), 3 = negative control for sea, 4 = positive control for seh (376 bp), 5 = positive samples for seh (376 bp), 6 = negative control for seh, 7 = positive control for sei (577bp), 8 = positive samples for sei, and 9 = negative control for sei.

Thumbnail

Table 1.
Primers and temperature used for the detection of staphylococcal enterotoxin genes

Thumbnail

Table 2.
Enterotoxin-encoding genes found in buffaloes belonging to Group 1 (early lactation animals) and Group 2 (late lactation animals)

Fig.1. Agarose gel containing the amplified PCR products from enterotoxin-encoding genes of Staphylococcus aureus. M = 1,000bp DNA ladder, 1 = positive control for sea (120 bp), 2 = positive sample for sea (120 bp), 3 = negative control for sea, 4 = positive control for seh (376 bp), 5 = positive samples for seh (376 bp), 6 = negative control for seh, 7 = positive control for sei (577bp), 8 = positive samples for sei, and 9 = negative control for sei.

Table 1. Primers and temperature used for the detection of staphylococcal enterotoxin genes

Gene	Primer	Sequence	Base pair	Annealing temperature	Reference
sea	SEA-F	ttggaaacggttaaaacgaa	120	52.3°C	Johnson et al. (1991)Johnson W.M., Tyler S.D., Ewan E.P., Ashton F.E., Pollard D.R. & Rozee K.R. 1991. Detection of genes for enterotoxins, exfoliative toxins, and toxic shock syndrome toxin 1 in Staphylococcus aureus by the polymerase chain reaction. J. Clin. Microbiol. 29(3):426-430. <PMid:2037659>
	SEA-R	gaaccttcccatcaaaaaca
seb	SEB-F	tcgcatcaaactgacaaacg	478	52.3°C	Johnson et al. (1991)Johnson W.M., Tyler S.D., Ewan E.P., Ashton F.E., Pollard D.R. & Rozee K.R. 1991. Detection of genes for enterotoxins, exfoliative toxins, and toxic shock syndrome toxin 1 in Staphylococcus aureus by the polymerase chain reaction. J. Clin. Microbiol. 29(3):426-430. <PMid:2037659>
	SEB-R	gcaggtactctataagtgcc
sec	SEC-F	gacataaaagctaggaattt	257	52.3°C	Johnson et al. (1991)Johnson W.M., Tyler S.D., Ewan E.P., Ashton F.E., Pollard D.R. & Rozee K.R. 1991. Detection of genes for enterotoxins, exfoliative toxins, and toxic shock syndrome toxin 1 in Staphylococcus aureus by the polymerase chain reaction. J. Clin. Microbiol. 29(3):426-430. <PMid:2037659>
	SEC-R	aaatcggattaacattatcc
sed	SED-F	ctagtttggtaatatctcct	317	51.1°C	Johnson et al. (1991)Johnson W.M., Tyler S.D., Ewan E.P., Ashton F.E., Pollard D.R. & Rozee K.R. 1991. Detection of genes for enterotoxins, exfoliative toxins, and toxic shock syndrome toxin 1 in Staphylococcus aureus by the polymerase chain reaction. J. Clin. Microbiol. 29(3):426-430. <PMid:2037659>
	SED-R	taatgctatatcttataggg
see	SEE-F	aggttttttcacaggtcatcc	209	50°C	Mehrotra et al. (2000)Mehrotra M., Wang G. & Johnson W.M. 2000. Multiplex PCR for detection of genes for Staphylococcus aureus enterotoxins, exfoliative toxins, toxic shock syndrome toxin 1, and methicillin resistance. J. Clin. Microbiol. 38(3):1032-1035. <PMid:10698991>
	SEE-R	cttttttttcttcggtcaatc
seg	SEG-F	aattatgtgaatgctcaacccgatc	642	55°C	Jarraud et al. (2002)Jarraud S., Mougel C., Thioulouse J., Lina G., Meugnier H., Forey F., Nesme X., Etienne J. & Vandenesch L. 2002. Relationships between Staphylococcus aureus genetic background, virulence factors, agr groups (alleles), and human disease. Infect. Immunity J. 70(2):631-641. <http://dx.doi.org/10.1128/IAI.70.2.631-641.2002> <PMid:11796592> https://doi.org/10.1128/IAI.70.2.631-641...
	SEG-R	aaacttatatggaacaaaaggtactagttc
seh	SEH-F	caatcaactcatatgcgaaagcag	376	61.8°C	Jarraud et al. (2002)Jarraud S., Mougel C., Thioulouse J., Lina G., Meugnier H., Forey F., Nesme X., Etienne J. & Vandenesch L. 2002. Relationships between Staphylococcus aureus genetic background, virulence factors, agr groups (alleles), and human disease. Infect. Immunity J. 70(2):631-641. <http://dx.doi.org/10.1128/IAI.70.2.631-641.2002> <PMid:11796592> https://doi.org/10.1128/IAI.70.2.631-641...
	SEH-R	catctacccaaacattagcacc
sei	SEI-F	ctcaaggtgatattggtgtagg	577	61.8°C	Jarraud et al. (2002)Jarraud S., Mougel C., Thioulouse J., Lina G., Meugnier H., Forey F., Nesme X., Etienne J. & Vandenesch L. 2002. Relationships between Staphylococcus aureus genetic background, virulence factors, agr groups (alleles), and human disease. Infect. Immunity J. 70(2):631-641. <http://dx.doi.org/10.1128/IAI.70.2.631-641.2002> <PMid:11796592> https://doi.org/10.1128/IAI.70.2.631-641...
	SEI-R	aaaaaacttacaggcagtccatctc

Table 2. Enterotoxin-encoding genes found in buffaloes belonging to Group 1 (early lactation animals) and Group 2 (late lactation animals)

Enterotoxins^a	n (%)	Group 1	Group 2
A	1 (8.3)	0	1
H	5 (41.7)	0	5
I	9 (75)	3	6
Total	12	6	6

^a
The presence of genes in association were observed in 3 samples among the enterotoxins found, specifically A+I in 1 sample, and H+I in 2 samples.

How to cite

copy

Colégio Brasileiro de Patologia Animal - CBPA Pesquisa Veterinária Brasileira, Caixa Postal 74.591, 23890-000 Rio de Janeiro, RJ, Brasil, Tel./Fax: (55 21) 2682-1081 - Rio de Janeiro - RJ - Brazil
E-mail: pvb@pvb.com.br

Acompanhe os números deste periódico no seu leitor de RSS

Versão para download de PDF

PDF

Inglês

Versões e tradução automática

Versão original do texto

English

Tradução automática

Google Translator
Microsoft Translator

Como citar

RIS

BIBTEX

Outros formatos de citação e exportação:

SciELO - Scientific Electronic Library Online
Rua Dr. Diogo de Faria, 1087 – 9º andar – Vila Clementino 04037-003 São Paulo/SP - Brasil
E-mail: scielo@scielo.org

Leia a Declaração de Acesso Aberto

Métricas

Enterotoxin-encoding genes in <i>Staphylococcus aureus</i> from buffalo milk

PlumX

Mensagem

[1] *Corresponding author: juniorzootec@yahoo.com.br