Current trends in bovine abortion in Argentina

Bovine abortion is an important cause of significant economic losses in beef and dairy herds. This syndrome is usually difficult to diagnose. The aim of this study was to characterize bovine abortion causes in Argentina by standard diagnosis procedures (histology, bacterial and viral isolation) and other diagnostic tests like direct fluorescent antibody test (DFAT), fetal serology, immunohistochemistry (IHC), and PCR, showing their specific advantages and limitations. Necropsies were performed in 150 aborted bovine fetuses submitted to the diagnostic laboratories of Instituto Nacional de Tecnología Agropecuaria (INTA) Balcarce, Argentina. Etiological diagnosis was confirmed in 78 fetuses (52% of the cases). Most causes of abortion were of infectious origin, being Neospora caninum (14.67%), Campylobacter fetus sp. (9.33%), Leptospira spp. (7.33%) and Brucella abortus (6.65%) the main microorganisms identified. Bovine viral diarrhea virus (BVDV) and bovine herpes virus (BHV) were diagnosed in 2 (1.33%) and 3 (2%) cases, respectively. This study showed a better characterization of bovine abortion compared with previous researches done on this topic.

INDEX TERMS:
Current trends; bovine; abortion; fetuses; diagnosis; PCR; Argentina; surgery

Authorship

Eleonora L. Morrell ^**Corresponding author: morrell.eleonora@inta.gob.ar

Animal Health Group, Instituto Nacional de Tecnología Agropecuaria (INTA), Ruta 226 Km 73,5 (7620), Balcarce, Argentina.Instituto Nacional de Tecnología AgropecuariaArgentinaBalcarce, Argentina Animal Health Group, Instituto Nacional de Tecnología Agropecuaria (INTA), Ruta 226 Km 73,5 (7620), Balcarce, Argentina.

https://orcid.org/0000-0002-3978-5728

Carlos M. Campero

Germán J. Cantón

Anselmo C. Odeón

Dadín P. Moore

Consejo Nacional de Investigaciones Científicas y Técnicas (Conicet), Argentina.Consejo Nacional de Investigaciones Científicas y TécnicasArgentinaArgentina Consejo Nacional de Investigaciones Científicas y Técnicas (Conicet), Argentina.

Ernesto Odriozola

Fernando Paolicchi

María A. Fiorentino

*Corresponding author: morrell.eleonora@inta.gob.ar

Conflict of interest statement.- The authors have no competing interest.

SCIMAGO INSTITUTIONS RANKINGS

Figures | Tables

Figures (4)
Tables (2)

Thumbnail

Fig.1.
Aborted bovine fetus with arthrogryposis.

Thumbnail

Fig.2.
Lymphohistiocytic bronchopneumonia with occasional presence of giant cell from a bovine fetus positive to Tritrichomonas foetus. HE, obj.40x.

Thumbnail

Fig.3.
Positive immunostaining to Neospora caninum tachyzoites in central nervous system of bovine fetus. Mayer haematoxylin, obj.40x.

Thumbnail

Fig.4.
Brucella abortus PCR, products obtained using primers pairs IS 711/All Bru (498 pb). Vertical lanes = size marker, 100pb (1), positive control (2), B. abortus positives fetuses (3, 6, 7, 8), B. abortus negatives fetuses (4, 5), negative control (10), without samples (11, 12).

Thumbnail

Table 1.
PCR conditions of Brucella abortus, Campylobacter fetus venerealis, Leptospira spp., BVDV, BHV, Neospora caninum and Tritrichomonas foetus for diagnosis of bovine abortion

Thumbnail

Table 2.
Diagnosis of bovine abortions in 150 fetuses

Fig.1. Aborted bovine fetus with arthrogryposis.

Fig.2. Lymphohistiocytic bronchopneumonia with occasional presence of giant cell from a bovine fetus positive to Tritrichomonas foetus. HE, obj.40x.

Fig.3. Positive immunostaining to Neospora caninum tachyzoites in central nervous system of bovine fetus. Mayer haematoxylin, obj.40x.

Fig.4. Brucella abortus PCR, products obtained using primers pairs IS 711/All Bru (498 pb). Vertical lanes = size marker, 100pb (1), positive control (2), B. abortus positives fetuses (3, 6, 7, 8), B. abortus negatives fetuses (4, 5), negative control (10), without samples (11, 12).

Table 1. PCR conditions of Brucella abortus, Campylobacter fetus venerealis, Leptospira spp., BVDV, BHV, Neospora caninum and Tritrichomonas foetus for diagnosis of bovine abortion

Infectious agent	Analyzed tissues	Primers	Annealing (°C)	Cycles	Product (bp)	References
B. abortus	Lung, AC^a	tgccgatcacttaagggccttcat gacgaacggaatttttccaatcc	58	40	498	Morrell 2010Morrell E.L. 2010. Diagnostic characterization of infectious causes of bovine abortion. Doctoral Thesis, University of La Plata (UNLP), Argentina.
C. fetus venerealis	Lung, AC	ggtagccgcagctgctaagat tagctacaataacgacaact	55	35	142	Schulze et al. 2006Schulze F., Bagon A., Müller W. & Hotzel H. 2006. Identification of Campylobacter fetus subspecies by phenotypic differentiation and PCR. J. Clin. Microbiol. 44(6):2019-2024. <http://dx.doi.org/10.1128/JCM.02566-05> <PMid:16757592> https://doi.org/10.1128/JCM.02566-05...
Leptospira spp.	Liver, lung, kidney, aqueous humor	ggcggcgcgtcttaaacatg ttagaacgaagttacccccctt	63	29	331	Mérien et al. 1992Mérien F., Amouriaux P., Perolat P., Baranton G. & Saint Girons I. 1992. Polymerase chain reaction for detection of Leptospira spp. in clinical samples. J. Clin. Microbiol. 30(9):2219-2224. <PMid:1400983>
BVDV	Spleen	ccatgtgccatgtacag catgcccatagtaggac	48	25	283	Ridpath et al. 1994Ridpath J.F., Bolin S.R. & Dubovi E.J. 1994. Segregation of bovine viral diarrhea virus into genotypes. Virology 205(1):66-74. <http://dx.doi.org/10.1006/viro.1994.1620> <PMid:7975238> https://doi.org/10.1006/viro.1994.1620...
BHV	Spleen	aacatgcaagggccgacattgg gaccgtgccgtcgatgtacagc	55	30	552	Takiuchi et al. 2005Takiuchi E., Medici K.C., Alfieri A.F. & Alfieri A.A. 2005. Bovine herpesvirus type 1 abortions detected by semi-nested PCR in Brazilian cattle herds. Res. Vet. Sci. 79(1):85-88. <http://dx.doi.org/10.1016/j.rvsc.2004.11.005> <PMid:15894030> https://doi.org/10.1016/j.rvsc.2004.11.0...
N. caninum	CNS^b	cagtcaacctacgtcttct gggtgaaccgagggagttg	56	35	227	Baszler et al. 1999Baszler T.V., Gay L.J., Long M.T. & Mathison B.A. 1999. Detection by PCR of Neospora caninum in fetal tissues from spontaneous bovine abortion. J. Clin. Microbiol. 37(12):4059-4064. <PMid:10565932>
T. foetus	Lung, AC	cgggtcttcctatatgagacagaacc cctgccgttggatcagtttcgttaa	67	40	347	Bon Durant et al. 2003Bon Durant R.H., Campero C.M., Anderson M.L. & Van Hoosear K.A. 2003. Detection of Tritrichomonas foetus by polymerase chain reaction in cultured isolated, cervicovaginal mucus, and formalin-fixed tissues from infected heifers and fetuses. J. Vet. Diagn. Invest. 15(6):579-584. <http://dx.doi.org/10.1177/104063870301500613> <PMid:14667024> https://doi.org/10.1177/1040638703015006...

^a
AC = Abomasal content, ^b CNS = central nervous system.

Table 2. Diagnosis of bovine abortions in 150 fetuses

Diagnostic			SDP ^a	Other diagnostic test*					Percentage of total
Diagnostic			SDP ^a	PCR^b	FS^c+PCR	DFAT^d+PCR	IHC^e	Total	Percentage of total
Determined causes								78	52.0
	Infectious
	a) Bacterial							42	28.0
		Ccampylobacter fetus sp.	14							9.33
		Leptospira spp.				11				7.33
		Brucella abortus	6	4						6.65
		Streptococcus α hemolytic	3							2.0
		Trueperella pyogenes	2							1.33
		Aeromonas hydrophila	1							0.68
		Listeria monocytogenes	1							0.68
	b) Protozoal							24	16.0
		Neospora caninum		5	6		11		14.67
		Tritrichomonas foetus	2							1.33
	c) Fungal							1		0.68
		Aspergillus fumigatus	1							0.68
	d) Viral							5		3.33
		BVDV	2		0					1.33
		BHV			3					2.0
	Non infectious							6		4.0
		Malformations	4							2.67
		Iatrogenic	2							1.33
	Undetermined causes							72	48.0
		With histological lesion	38						25.33
		Without histological lesion	34						22.67

* Include the histology in all cases; ^a SDP = standard diagnostic procedures (include histology, bacterial, and viral isolation), ^b PCR = polymerase chain reaction, ^c FS = fetal serology, ^d DFAT = direct fluorescence antigen test, ^e IHC = Immunohistochemistry.

How to cite

copy

Colégio Brasileiro de Patologia Animal - CBPA Pesquisa Veterinária Brasileira, Caixa Postal 74.591, 23890-000 Rio de Janeiro, RJ, Brasil, Tel./Fax: (55 21) 2682-1081 - Rio de Janeiro - RJ - Brazil
E-mail: pvb@pvb.com.br

Acompanhe os números deste periódico no seu leitor de RSS

Versão para download de PDF

PDF

Inglês

Versões e tradução automática

Versão original do texto

English

Tradução automática

Google Translator
Microsoft Translator

Como citar

RIS

BIBTEX

Outros formatos de citação e exportação:

SciELO - Scientific Electronic Library Online
Rua Dr. Diogo de Faria, 1087 – 9º andar – Vila Clementino 04037-003 São Paulo/SP - Brasil
E-mail: scielo@scielo.org

Leia a Declaração de Acesso Aberto

Métricas

Current trends in bovine abortion in Argentina

PlumX

Mensagem

[1] *Corresponding author: morrell.eleonora@inta.gob.ar