Genes codificadores de enterotoxinas em <i>Staphylococcus aureus</i> no leite de búfalas

Este estudo investigou a ocorrência de isolados de Staphylococcus aureus e a detecção de genes que codificam a enterotoxigenicidade dessas cepas em leite de búfala utilizado na produção de laticínios no Brasil. As amostras foram coletados em 30 búfalos da raça Murrah, identificado por testes laboratoriais convencionais, foram identificados um total de 68 cepas de S. aureus e rastreados para os genes que codificam a enterotoxina sea, seb, sec, sed, see, seg, seh and sei por reação em cadeia da polimerase (PCR). Doze cepas contendo genes da enterotoxina foram amplificadas, com maior expressão para os genes sei e seh. Esses resultados podem ser atribuídos à saúde animal e à higiene inadequada do equipamento, indicando a necessidade de melhor controle de qualidade nas linhas de produção e saúde animal. Os resultados desta pesquisa, com a presença de patógenos e seu potencial enterotoxigênico, indicam uma fonte de intoxicação alimentar, além de ser uma pesquisa pioneira na detecção de novas enterotoxinas para o leite de búfala.

TERMOS DE IDEXAÇÃO:
Genes codificadores; enterotoxinas; Staphylococcus aureus; búfalos; produtos de origem animal; microbiologia de alimentos; mastite; qualidade de leite; leite de búfala; bovinos

Autoria

Emmanuella O. Moura

Graduate Studies Program in Animal Production, Unidade Acadêmica Especializada em Ciências Agrárias, Universidade Federal do Rio Grande do Norte (UFRN), RN-160 Km 3, Cx. Postal 07, Distrito de Jundiaí, Macaíba, RN 59280-000, Brazil.Universidade Federal do Rio Grande do NorteBrazilMacaíba, RN, Brazil Graduate Studies Program in Animal Production, Unidade Acadêmica Especializada em Ciências Agrárias, Universidade Federal do Rio Grande do Norte (UFRN), RN-160 Km 3, Cx. Postal 07, Distrito de Jundiaí, Macaíba, RN 59280-000, Brazil.

Adriano H.N. Rangel

Cláudia S. Macêdo

Stela A. Urbano

Luciano P. Novaes

Dorgival M. Lima Júnior^**Corresponding author: juniorzootec@yahoo.com.br

Universidade Federal de Alagoas (UFAL), Campus Arapiraca, Av. Manoel Severino Barbosa s/n, Bom Sucesso, Arapiraca, AL 57309-005, Brazil.Universidade Federal de AlagoasBrazilArapiraca, AL, Brazil Universidade Federal de Alagoas (UFAL), Campus Arapiraca, Av. Manoel Severino Barbosa s/n, Bom Sucesso, Arapiraca, AL 57309-005, Brazil.

https://orcid.org/0000-0002-1154-8579

*Corresponding author: juniorzootec@yahoo.com.br

Conflict of interest statement.- The authors declare that they have no conflicts of interest.

SCIMAGO INSTITUTIONS RANKINGS

Figuras | Tabelas

Figuras (1)
Tabelas (2)

Thumbnail

Fig.1.
Agarose gel containing the amplified PCR products from enterotoxin-encoding genes of Staphylococcus aureus. M = 1,000bp DNA ladder, 1 = positive control for sea (120 bp), 2 = positive sample for sea (120 bp), 3 = negative control for sea, 4 = positive control for seh (376 bp), 5 = positive samples for seh (376 bp), 6 = negative control for seh, 7 = positive control for sei (577bp), 8 = positive samples for sei, and 9 = negative control for sei.

Thumbnail

Table 1.
Primers and temperature used for the detection of staphylococcal enterotoxin genes

Thumbnail

Table 2.
Enterotoxin-encoding genes found in buffaloes belonging to Group 1 (early lactation animals) and Group 2 (late lactation animals)

Fig.1. Agarose gel containing the amplified PCR products from enterotoxin-encoding genes of Staphylococcus aureus. M = 1,000bp DNA ladder, 1 = positive control for sea (120 bp), 2 = positive sample for sea (120 bp), 3 = negative control for sea, 4 = positive control for seh (376 bp), 5 = positive samples for seh (376 bp), 6 = negative control for seh, 7 = positive control for sei (577bp), 8 = positive samples for sei, and 9 = negative control for sei.

Table 1. Primers and temperature used for the detection of staphylococcal enterotoxin genes

Gene	Primer	Sequence	Base pair	Annealing temperature	Reference
sea	SEA-F	ttggaaacggttaaaacgaa	120	52.3°C	Johnson et al. (1991)Johnson W.M., Tyler S.D., Ewan E.P., Ashton F.E., Pollard D.R. & Rozee K.R. 1991. Detection of genes for enterotoxins, exfoliative toxins, and toxic shock syndrome toxin 1 in Staphylococcus aureus by the polymerase chain reaction. J. Clin. Microbiol. 29(3):426-430. <PMid:2037659>
	SEA-R	gaaccttcccatcaaaaaca
seb	SEB-F	tcgcatcaaactgacaaacg	478	52.3°C	Johnson et al. (1991)Johnson W.M., Tyler S.D., Ewan E.P., Ashton F.E., Pollard D.R. & Rozee K.R. 1991. Detection of genes for enterotoxins, exfoliative toxins, and toxic shock syndrome toxin 1 in Staphylococcus aureus by the polymerase chain reaction. J. Clin. Microbiol. 29(3):426-430. <PMid:2037659>
	SEB-R	gcaggtactctataagtgcc
sec	SEC-F	gacataaaagctaggaattt	257	52.3°C	Johnson et al. (1991)Johnson W.M., Tyler S.D., Ewan E.P., Ashton F.E., Pollard D.R. & Rozee K.R. 1991. Detection of genes for enterotoxins, exfoliative toxins, and toxic shock syndrome toxin 1 in Staphylococcus aureus by the polymerase chain reaction. J. Clin. Microbiol. 29(3):426-430. <PMid:2037659>
	SEC-R	aaatcggattaacattatcc
sed	SED-F	ctagtttggtaatatctcct	317	51.1°C	Johnson et al. (1991)Johnson W.M., Tyler S.D., Ewan E.P., Ashton F.E., Pollard D.R. & Rozee K.R. 1991. Detection of genes for enterotoxins, exfoliative toxins, and toxic shock syndrome toxin 1 in Staphylococcus aureus by the polymerase chain reaction. J. Clin. Microbiol. 29(3):426-430. <PMid:2037659>
	SED-R	taatgctatatcttataggg
see	SEE-F	aggttttttcacaggtcatcc	209	50°C	Mehrotra et al. (2000)Mehrotra M., Wang G. & Johnson W.M. 2000. Multiplex PCR for detection of genes for Staphylococcus aureus enterotoxins, exfoliative toxins, toxic shock syndrome toxin 1, and methicillin resistance. J. Clin. Microbiol. 38(3):1032-1035. <PMid:10698991>
	SEE-R	cttttttttcttcggtcaatc
seg	SEG-F	aattatgtgaatgctcaacccgatc	642	55°C	Jarraud et al. (2002)Jarraud S., Mougel C., Thioulouse J., Lina G., Meugnier H., Forey F., Nesme X., Etienne J. & Vandenesch L. 2002. Relationships between Staphylococcus aureus genetic background, virulence factors, agr groups (alleles), and human disease. Infect. Immunity J. 70(2):631-641. <http://dx.doi.org/10.1128/IAI.70.2.631-641.2002> <PMid:11796592> https://doi.org/10.1128/IAI.70.2.631-641...
	SEG-R	aaacttatatggaacaaaaggtactagttc
seh	SEH-F	caatcaactcatatgcgaaagcag	376	61.8°C	Jarraud et al. (2002)Jarraud S., Mougel C., Thioulouse J., Lina G., Meugnier H., Forey F., Nesme X., Etienne J. & Vandenesch L. 2002. Relationships between Staphylococcus aureus genetic background, virulence factors, agr groups (alleles), and human disease. Infect. Immunity J. 70(2):631-641. <http://dx.doi.org/10.1128/IAI.70.2.631-641.2002> <PMid:11796592> https://doi.org/10.1128/IAI.70.2.631-641...
	SEH-R	catctacccaaacattagcacc
sei	SEI-F	ctcaaggtgatattggtgtagg	577	61.8°C	Jarraud et al. (2002)Jarraud S., Mougel C., Thioulouse J., Lina G., Meugnier H., Forey F., Nesme X., Etienne J. & Vandenesch L. 2002. Relationships between Staphylococcus aureus genetic background, virulence factors, agr groups (alleles), and human disease. Infect. Immunity J. 70(2):631-641. <http://dx.doi.org/10.1128/IAI.70.2.631-641.2002> <PMid:11796592> https://doi.org/10.1128/IAI.70.2.631-641...
	SEI-R	aaaaaacttacaggcagtccatctc

Table 2. Enterotoxin-encoding genes found in buffaloes belonging to Group 1 (early lactation animals) and Group 2 (late lactation animals)

Enterotoxins^a	n (%)	Group 1	Group 2
A	1 (8.3)	0	1
H	5 (41.7)	0	5
I	9 (75)	3	6
Total	12	6	6

^a
The presence of genes in association were observed in 3 samples among the enterotoxins found, specifically A+I in 1 sample, and H+I in 2 samples.

Como citar

copiar

Colégio Brasileiro de Patologia Animal - CBPA Pesquisa Veterinária Brasileira, Caixa Postal 74.591, 23890-000 Rio de Janeiro, RJ, Brasil, Tel./Fax: (55 21) 2682-1081 - Rio de Janeiro - RJ - Brazil
E-mail: pvb@pvb.com.br

Acompanhe os números deste periódico no seu leitor de RSS

Versão para download de PDF

PDF

Inglês

Versões e tradução automática

Versão original do texto

English

Tradução automática

Google Translator
Microsoft Translator

Como citar

RIS

BIBTEX

Outros formatos de citação e exportação:

SciELO - Scientific Electronic Library Online
Rua Dr. Diogo de Faria, 1087 – 9º andar – Vila Clementino 04037-003 São Paulo/SP - Brasil
E-mail: scielo@scielo.org

Leia a Declaração de Acesso Aberto

Métricas

Genes codificadores de enterotoxinas em <i>Staphylococcus aureus</i> no leite de búfalas

PlumX

Mensagem

[1] *Corresponding author: juniorzootec@yahoo.com.br