Identification of Virulence-Associated Markers in Escherichia Coli Isolated from Captive Red-Browed Amazon Parrot (Amazona Rhodocorytha)

Bonissi, DA; Salle, FO; Rocha, DT; Borges, KA; Furian, TQ; Rocha, SLS; Moraes, HLS; Nascimento, VP; Salle, CTP

doi:10.1590/1806-9061-2021-1581

Acessibilidade / Reportar erro

Brasil

Brazilian Journal of Poultry Science

Español English

Brasil

Español English

sumário « anterior atual seguinte »

Sumário

Technical Note • Braz. J. Poult. Sci. 24 (04) • 2022 • https://doi.org/10.1590/1806-9061-2021-1581 copy

Identification of Virulence-Associated Markers in Escherichia Coli Isolated from Captive Red-Browed Amazon Parrot (Amazona Rhodocorytha)

Authorship SCIMAGO INSTITUTIONS RANKINGS

ABSTRACT

Due to the genetic similarity of pathogenic Escherichia coli isolated from birds and pathotypes of human origin, it is suggested that they have a common ancestor and may exchange virulence-associated genes. This study aimed to detect virulence-associated genes in E. coli strains isolated from the Red-browed Amazon parrot (Amazona rhodocorytha) kept at a conservation institute in Brazil. High genetic variability in virulence was observed, since 12 virulence profiles were found among 14 strains. The number of virulence-associated genes of single strains ranged from 5 to 22 out of 33 genes tested, and only one strain did not present any virulence genes. Regarding adhesion genes, most strains presented from two to five genes, and crlA (85.7%) and fimC (85.7%) were the most frequent. Frequencies were similar for invasion and iron acquisition genes. Variations among genes were observed for serum resistance and toxin-related genes. Some of the E. coli strains isolated from parrots presented virulence genes that are commonly associated with pathotypes of human origin, including newborn meningitis E. coli, uropathogenic E. coli, and sepsis-associated E. coli. It is noteworthy that some of these genes were present in the majority of the analyzed strains. Our results indicate that these strains detected in clinically healthy parrots can be potential reservoirs of several virulence-associated genes. These genes can be transmitted to other E. coli strains, including those that affect humans. These E. coli strains present a high pathogenic potential of virulence-associated genes in extraintestinal pathogenic E. coli strains.

Keywords:
Escherichia coli; parrot; public health; virulence genes

Function-related group	Gene	Primer (5’  3’)	Amplicon size (bp)	Primer reference
Adhesion	afa/draB	F: TAAGGAAGTGAAGGAGCGTG R: CCAGTAACTGTCCGTGACA	810	*Ewers et al., 2007*Ewers C, Li G, Wilking H, Kie?ling S, Alt K, Antáo EM, et al. Avian pathogenic, uropathogenic, and newborn meningitis-causing Escherichia coli: how closely related are they? International Journal of Medical Microbiology 2007;297:163-76.
	crlA	F: TTTCGATTGTCTGGCTGTATG R: CTTCAGATTCAGCGTCGTC	250	*Maurer et al., 1998*Maurer JJ, Brown TP, Steffens WL, Thayer SG. The occurrence of ambient temperature-regulated adhesins, curli, and the temperature-sensitive hemagglutinin tsh among avian Escherichia coli. Avian Disease 1998;42:106-18.
	fimC	F: GGGTAGAAAATGCCGATGGTG R: CGTCATTTTGGGGGTAAGTGC	477	*Janssen et al., 2001*Janssen T, Schwarz C, Preikschat P, Voss M, Philipp HC, Wieler LH. Virulence-associated genes in avian pathogenic Escherichia coli (APEC) isolated from internal organs of poultry having died from colibacillosis. International Journal of Medical Microbiology 2001;291:371-8.
	hrlA	F: TCACTTGCAGACCAGCGTTTC R: GTAACTCACACTGCTGTCACCT	537	*Ewers et al., 2007*Ewers C, Li G, Wilking H, Kie?ling S, Alt K, Antáo EM, et al. Avian pathogenic, uropathogenic, and newborn meningitis-causing Escherichia coli: how closely related are they? International Journal of Medical Microbiology 2007;297:163-76.
	iha	F: TAGTGCGTTGGGTTATCGCTC R: AAGCCAGAGTGGTTATTCGC	609	*Ewers et al., 2007*Ewers C, Li G, Wilking H, Kie?ling S, Alt K, Antáo EM, et al. Avian pathogenic, uropathogenic, and newborn meningitis-causing Escherichia coli: how closely related are they? International Journal of Medical Microbiology 2007;297:163-76.
	papC	F: TGATATCACGCAGTCAGTAGC R: CCGGCCATATTCACATAAC	501	*Janssen et al., 2001*Janssen T, Schwarz C, Preikschat P, Voss M, Philipp HC, Wieler LH. Virulence-associated genes in avian pathogenic Escherichia coli (APEC) isolated from internal organs of poultry having died from colibacillosis. International Journal of Medical Microbiology 2001;291:371-8.
	sfa/focD	F: GTCCTGACTCATCTGAAACTGCA R: CGGAGAACTGGGTGCATCTTA	1242	*Ewers et al., 2007*Ewers C, Li G, Wilking H, Kie?ling S, Alt K, Antáo EM, et al. Avian pathogenic, uropathogenic, and newborn meningitis-causing Escherichia coli: how closely related are they? International Journal of Medical Microbiology 2007;297:163-76.
	tsh	F: ACTATTCTCTGCAGGAAGTC R: CTTCCGATGTTCTGAACGT	824	*Ewers et al., 2007*Ewers C, Li G, Wilking H, Kie?ling S, Alt K, Antáo EM, et al. Avian pathogenic, uropathogenic, and newborn meningitis-causing Escherichia coli: how closely related are they? International Journal of Medical Microbiology 2007;297:163-76.
	mat	F: TATACGCTGGACTGAGTCGTG R: CAGGTAGCGTCGAACTGTA	899	*Ewers et al., 2007*Ewers C, Li G, Wilking H, Kie?ling S, Alt K, Antáo EM, et al. Avian pathogenic, uropathogenic, and newborn meningitis-causing Escherichia coli: how closely related are they? International Journal of Medical Microbiology 2007;297:163-76.
Invasion	gimB	F: TCCAGATTGAGCATATCCC R: CCTGTAACATGTTGGCTTCA	736	*Ewers et al., 2007*Ewers C, Li G, Wilking H, Kie?ling S, Alt K, Antáo EM, et al. Avian pathogenic, uropathogenic, and newborn meningitis-causing Escherichia coli: how closely related are they? International Journal of Medical Microbiology 2007;297:163-76.
	ibeA	F: TGGAACCCGCTCGTAATATAC R: CTGCCTGTTCAAGCATTGCA	342	*Ewers et al., 2007*Ewers C, Li G, Wilking H, Kie?ling S, Alt K, Antáo EM, et al. Avian pathogenic, uropathogenic, and newborn meningitis-causing Escherichia coli: how closely related are they? International Journal of Medical Microbiology 2007;297:163-76.
	tia	F: AGCGCTTCCGTCAGGACTT R: ACCAGCATCCAGATAGCGAT	512	*Ewers et al., 2007*Ewers C, Li G, Wilking H, Kie?ling S, Alt K, Antáo EM, et al. Avian pathogenic, uropathogenic, and newborn meningitis-causing Escherichia coli: how closely related are they? International Journal of Medical Microbiology 2007;297:163-76.
Iron aquision	chuA	F: GACGAACCAACGGTCAGGAT R: TGCCGCCAGTACCAAAGACA	278	*Clermont et al., 2000*Clermont O, Bonacorsi S, Bingen E. Rapid and simple determination of the Escherichia coli phylogenetic group. Applied and Environmental Microbiology Journal 2000;66:4555-8.
	fyuA	F: GCGACGGGAAGCGATGACTTA R: CGCAGTAGGCACGATGTTGTA	774	*Schubert et al., 2002*Schubert S, Picard B, Gouriou S, Heesemann J, Denamur E.Yersinia high-pathogenicity island contributes to virulence in Escherichia coli causing extraintestinal infections. Infection and Immunity 2002;70:5335-7.
	ireA	F: ATTGCCGTGATGTGTTCTGC R: CACGGATCACTTCAATGCGT	384	*Ewers et al., 2007*Ewers C, Li G, Wilking H, Kie?ling S, Alt K, Antáo EM, et al. Avian pathogenic, uropathogenic, and newborn meningitis-causing Escherichia coli: how closely related are they? International Journal of Medical Microbiology 2007;297:163-76.
	iroN1	F: ATCCTCTGGTCGCTAACTG R: CTGCACTGGAAGAACTGTTCT	847	*Ewers et al., 2007*Ewers C, Li G, Wilking H, Kie?ling S, Alt K, Antáo EM, et al. Avian pathogenic, uropathogenic, and newborn meningitis-causing Escherichia coli: how closely related are they? International Journal of Medical Microbiology 2007;297:163-76.
	irp2	F: AAGGATTCGCTGTTACCGGAC R: TCGTCGGGCAGCGTTTCTTCT	413	*Schubert et al., 2002*Schubert S, Picard B, Gouriou S, Heesemann J, Denamur E.Yersinia high-pathogenicity island contributes to virulence in Escherichia coli causing extraintestinal infections. Infection and Immunity 2002;70:5335-7.
	iucD	F: ACAAAAAGTTCTATCGCTTCC R: CCTGATCCAGATGATGCTC	714	*Janssen et al., 2001*Janssen T, Schwarz C, Preikschat P, Voss M, Philipp HC, Wieler LH. Virulence-associated genes in avian pathogenic Escherichia coli (APEC) isolated from internal organs of poultry having died from colibacillosis. International Journal of Medical Microbiology 2001;291:371-8.
	sitD chr.	F: ACTCCCATACACAGGATCTG R: CTGTCTGTGTCCGGAATGA	554	*Ewers et al., 2007*Ewers C, Li G, Wilking H, Kie?ling S, Alt K, Antáo EM, et al. Avian pathogenic, uropathogenic, and newborn meningitis-causing Escherichia coli: how closely related are they? International Journal of Medical Microbiology 2007;297:163-76.
	sitD ep.	F: TTGAGAACGACAGCGACTTC R: CTATCGAGCAGGTGAGGA	1052	*Ewers et al., 2007*Ewers C, Li G, Wilking H, Kie?ling S, Alt K, Antáo EM, et al. Avian pathogenic, uropathogenic, and newborn meningitis-causing Escherichia coli: how closely related are they? International Journal of Medical Microbiology 2007;297:163-76.
Serum resistance	cvi/cva	F: TCCAAGCGGACCCCTTATAG R: CGCAGCATAGTTCCATGCT	598	*Ewers et al., 2007*Ewers C, Li G, Wilking H, Kie?ling S, Alt K, Antáo EM, et al. Avian pathogenic, uropathogenic, and newborn meningitis-causing Escherichia coli: how closely related are they? International Journal of Medical Microbiology 2007;297:163-76.
	iss	F: ATCACATAGGATTCTGCCG R: CAGCGGAGTATAGATGCCA	309	*Ewers et al., 2007*Ewers C, Li G, Wilking H, Kie?ling S, Alt K, Antáo EM, et al. Avian pathogenic, uropathogenic, and newborn meningitis-causing Escherichia coli: how closely related are they? International Journal of Medical Microbiology 2007;297:163-76.
	neuC	F: GGTGGTACATTCCGGGATGTC R: AGGTGAAAAGCCTGGTAGTGTG	676	*Ewers et al., 2007*Ewers C, Li G, Wilking H, Kie?ling S, Alt K, Antáo EM, et al. Avian pathogenic, uropathogenic, and newborn meningitis-causing Escherichia coli: how closely related are they? International Journal of Medical Microbiology 2007;297:163-76.
	kpsMT II	F: GCGCATTTGCTGATACTGTTG R: CATCCAGACGATAAGCATGAGCA	280	Genbank accession number X53819
	ompA	F: AGCTATCGCGATTGCAGTG R: GGTGTTGCCAGTAACCGG	919	*Ewers et al., 2007*Ewers C, Li G, Wilking H, Kie?ling S, Alt K, Antáo EM, et al. Avian pathogenic, uropathogenic, and newborn meningitis-causing Escherichia coli: how closely related are they? International Journal of Medical Microbiology 2007;297:163-76.
	traT	F: GTGGTGCGATGAGCACAG R: TAGTTCACATCTTCCACCATCG	430	*Ewers et al., 2007*Ewers C, Li G, Wilking H, Kie?ling S, Alt K, Antáo EM, et al. Avian pathogenic, uropathogenic, and newborn meningitis-causing Escherichia coli: how closely related are they? International Journal of Medical Microbiology 2007;297:163-76.
Toxins	cnf1/2	F: TCGTTATAAAATCAAACAGTG R: CTTTACAATATTGACATGCTG	446	*Ewers et al., 2007*Ewers C, Li G, Wilking H, Kie?ling S, Alt K, Antáo EM, et al. Avian pathogenic, uropathogenic, and newborn meningitis-causing Escherichia coli: how closely related are they? International Journal of Medical Microbiology 2007;297:163-76.
	sat	F: TGCTGGCTCTGGAGGAAC R: TTGAACATTCAGAGTACCGGG	667	*Ewers et al., 2007*Ewers C, Li G, Wilking H, Kie?ling S, Alt K, Antáo EM, et al. Avian pathogenic, uropathogenic, and newborn meningitis-causing Escherichia coli: how closely related are they? International Journal of Medical Microbiology 2007;297:163-76.
	astA	F:TGCCATCAACACAGTATATCC R: TAGGATCCTCAGGTCGCGAGTGACGGC	116	*Yamamoto et al., 1996*Yamamoto T, Echeverria P. Detection of the enteroaggregative Escherichia coli heat-stable enterotoxin 1 gene sequences in enterotoxigenic E. coli strains pathogenic for humans. Infection and Immunity 1996;64:1441-5.
	vat	F: TCCTGGGACATAATGGTCAG R: GTGTCAGAACGGAATTGTC	981	*Ewers et al., 2007*Ewers C, Li G, Wilking H, Kie?ling S, Alt K, Antáo EM, et al. Avian pathogenic, uropathogenic, and newborn meningitis-causing Escherichia coli: how closely related are they? International Journal of Medical Microbiology 2007;297:163-76.
	hlyA	F: GTCCATTGCCGATAAGTTT R: AAGTAATTTTTGCCGTGTTTT	352	*Ewers et al., 2007*Ewers C, Li G, Wilking H, Kie?ling S, Alt K, Antáo EM, et al. Avian pathogenic, uropathogenic, and newborn meningitis-causing Escherichia coli: how closely related are they? International Journal of Medical Microbiology 2007;297:163-76.
Autotransporter serine protease	pic	F: ACTGGATCTTAAGGCTCAGG R: TGGAATATCAGGGTGCCACT	409	*Ewers et al., 2007*Ewers C, Li G, Wilking H, Kie?ling S, Alt K, Antáo EM, et al. Avian pathogenic, uropathogenic, and newborn meningitis-causing Escherichia coli: how closely related are they? International Journal of Medical Microbiology 2007;297:163-76.
Pathogenicity island associated gene	malX	F: GGACATCCTGTTACAGCGCGCA R: TCGCCACCAATCACAGCCGAAC	922	Johnson et al., 2001

Function-related group	Gene	Frequencies % (n)¹	Strain identification
Function-related group	Gene	Frequencies % (n)¹	1	2	3	4	5	6	7	8	9	10	11	12	13	14
Adhesion	afa/draB	21.4 (3)^b	1	1	0	0	0	0	0	0	0	1	0	0	0	0
	crlA	85.7 (12)^a	1	1	1	1	0	1	1	1	1	1	0	1	1	1
	fimC	85.7 (12)^a	1	1	1	1	0	1	1	1	1	1	0	1	1	1
	hrlA	14.3 (2)^b	0	0	0	0	0	0	1	0	0	0	1	0	0	0
	iha	14.3 (2)^b	0	0	0	0	0	0	1	0	0	0	1	0	0	0
	papC	14.3 (2)^b	0	0	1	0	0	0	0	0	0	1	0	0	0	0
	sfa/focD	7.1 (1)^b	0	0	0	0	0	0	0	0	0	0	1	0	0	0
	tsh	0.0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
	mat	71.4 (10)^a	1	1	1	1	0	0	1	1	1	1	0	1	0	1
	Total of detected genes		4	4	4	3	0	2	5	3	3	5	3	3	2	3
Invasion	gimB	21.4 (3)^a	1	1	0	0	0	0	0	0	0	0	1	0	0	0
	ibeA	50.0 (7)^a	0	0	1	0	0	1	1	1	1	0	0	1	1	0
	tia	57.1 (8)^a	0	0	1	1	0	1	0	1	1	1	0	1	1	0
	Total of detected genes		1	1	2	1	0	2	1	2	2	1	1	2	2	0
Iron aquision	chuA	57.1 (8)^a	0	0	1	1	0	1	1	1	1	0	0	1	1	0
	fyuA	42.9 (6)^a	0	0	1	0	0	1	0	1	1	0	0	1	1	0
	ireA	0.0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
	iroN1	42.9 (6)^a	0	0	1	0	0	1	1	1	0	1	0	0	0	1
	irp2	42.9 (6)^a	0	0	1	0	0	1	0	1	1	0	0	1	1	0
	iucD	57.1 (8)^a	1	1	1	1	0	0	1	1	1	0	0	1	0	0
	sitD chr.	35.7 (5)^a	1	1	0	1	0	1	0	0	0	1	0	0	0	0
	sitD ep	0.0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
	Total of detected genes		2	2	5	3	0	5	3	5	4	2	0	4	3	1
Serum resistance	cvi/cva	78.6 (11)^a	1	1	1	1	0	0	1	1	1	1	1	1	1	0
	iss	21.4 (3)^b	0	0	0	0	0	1	1	1	0	0	0	0	0	0
	neuC	71.4 (10)^ab	1	1	1	1	0	1	0	1	1	0	1	1	1	0
	kpsMTII	64.3 (9)^ab	1	1	1	1	0	0	1	1	1	1	0	1	0	0
	ompA	85.7 (12)^a	1	1	1	1	0	1	1	1	1	1	0	1	1	1
	traT	42.9 (6)^ab	0	0	0	0	0	1	1	1	1	0	0	1	1	0
	Total of detected genes		4	4	4	4	0	4	5	6	5	3	2	5	4	1
Toxins	cnf1/2	85.7 (12)^a	1	1	1	1	0	1	1	1	1	1	1	1	1	0
	sat	28.6 (4)^b	0	0	0	1	0	1	0	1	0	1	0	0	0	0
	astA	0.0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
	vat	50.0 (7)^ab	0	0	1	0	0	1	1	1	1	0	0	1	1	0
	hlyA	42.9 (6)^ab	0	0	0	0	0	0	1	1	1	1	1	1	0	0
	Total of detected genes		1	1	2	2	0	3	3	4	3	3	2	3	2	0
Autotransporter serine protease	pic	42.9 (6)	0	0	1	0	0	1	1	1	0	0	1	0	1	0
Pathogenicity island associated gene	malX	78.6 (11)	1	1	1	1	0	1	1	1	1	1	0	1	1	0

Profile identification	Detected genes	Strain identification
I	afa/draB, crlA, fimC, mat, gimB, iucD, sitD chr., cvi/cva, neuC, kpsMT, ompA, cnf1/2, malX	1 and 2
II	crlA, fimC, papC, mat, beA, tia, chuA, fyuA, iroN1, irp2, iucD, cvi/cva, neuC, kpsMT, ompA, malX	3
III	crlA, fimC, mat, tia, chuA, iucD, sitD chr., cvi/cva, neuC, kpsMT, ompA, cnf/12, sat, malX	4
IV	crlA, fimC, ibeA, tia, chuA, fyuA, iroN1, irp2, sitD chr., iss, neuC, ompA, traT, cnf1/2, sat, vat, pic, malX	6
V	crlA, fimC, hrlA, iha, mat, ibeA, chuA, iroN1, iucD, cvi/cva, iss, kpsMT, ompA, traT, cnf1/2, vat, hlyAm pic, malX	7
VI	fimC, hrlA, mat, ibeA, tia, chuA, fyuA, iroN1, irp2, iucD, cvi/cva, iss, neuC, kpsMT, ompA, traT, cnf1/2, sat, vat, hlyA, pic, malX	8
VII	crlA, fimC, mat, ibeA, tia, chuA, fyuA, irp2, iucD, cvi/cva, neuC, kpsMT, ompA, traT, cnf1/2, vat, hlyA, malX	9 and 12
VIII	afa/draB, crlA, fimC, papC, mat, tia, iroN1, sitD chr., cvi/cva, kpsMT, ompA, cnf1/2, sat, hlyA, malX	10
IX	hrlA, iha, sfa/focD, gimB, cvi/cva, neuC, cnf1/2, hlyA, pic	11
X	crlA, fimC, ibeA, tia, chuA, fyuA, irp2, cvi/cva, neuC, ompA, traT, cnf1/2, vat, pic, malX	13
XI	crlA, fimC, mat, iroN1, ompA	14
XII	No virulence genes detected	5

Fundação de Apoio à Ciência e Tecnologia Avicolas Rua Barão de Paranapanema, 146 - Sala 72, Bloco A, Bosque, Campinas, SP - 13026-010. Tel.: 19 3255-8500 - Campinas - SP - Brazil
E-mail: revista@facta.org.br

Acompanhe os números deste periódico no seu leitor de RSS

[1] Corresponding author e-mail address
Karen Apellanis Borges Centro de Diagnóstico e Pesquisa em Patologia Aviária, Faculdade de Veterinária, Universidade Federal do Rio Grande do Sul, Av. Bento Goncalves 8824, Porto Alegre, CEP 91540-000, Rio Grande do Sul, Brazil. Phone: +55 51 3308-6138 Email: karen.borges@ufrgs.br