The Effect of Alpha-Hydroxycholecalciferol and Phytase on the Performance, Carcass Characteristics, Blood Factors, and Expression of Vdr and Cabp-D28k Genes in Broiler Chickens

ABSTRACT

We evaluated the effect of alpha-hydroxycholecalciferol (1α-OH-D3) and phytase supplementation on the performance, carcass characteristics, blood factors, and the expression of vitamin D receptors (VDR) and Calbindin 28k (CaBP-D28k) genes in broiler chickens. In the current experiment, 400 one-day-old male chicks of the Cobb 500 strain were allocated into a completely randomized design with 4 treatments and 5 replicates (20 chicks per replicate). Experimental treatments were: 1- Control (no additional supplements), 2- Addition of 14 mg/kg DM 1α-OH-D3 to the diet, 3- Addition of 5 mg/kg phytase, and 4- Addition of 14 mg/kg 1α- OH-D3 + 5 mg/k phytase. Compared to the control diet, adding 1α-OH-D3 and phytase could significantly improve the feed conversion ratio and weight gain (p≤0.05). The combination also decreased alkaline phosphatase (ALP) activity relative to the control (p≤0.05) The relative expression of VDR and CaBP-D28k genes in the treatments that used 1α-OH-D3 and 1α-OH-D3 along with the phytase enzyme had a significant elevation compared to the control group (p<0.05). Overall, using 1α-OH-D3 along with the phytase enzyme can lead to a higher growth performance than using each one of them separately. The use of 1α-OH-D3 together with phytase led to a greater improvement of the growth performance and expression of the VDR and CaBP-D28k genes when compared to their separate use in broiler chickens’ diets.

Keywords:
1α-OH-D3; performance; broiler; carcass characteristics; phytase

INTRODUCTION

Genetic improvement in broiler chickens’ potential growth rate has significantly increased the importance of nutrient supply for such animals (Poorghasemi et al., 2017). This is particularly true for vitamins and minerals that are essential for most of the metabolic reactions that are crucial for driving growth. One key area where the undersupply of nutrients is important in broilers is the development of skeletal abnormalities. Between 20 and 30 percent of broiler flocks in the world suffer from these skeletal abnormalities, which have significant welfare and productivity consequences (Xue et al., 2016; Ahmadi et al., 2018; Meena et al., 2022). A key reason for the high incidence of skeletal abnormalities in the first weeks after birth is thought to be a lack of pancreas development, which leads to limited secretion of lipase in the first few days after hatching, and therefore reduced absorption of vitamin D3 during that period (Whitehead et al., 2004). Another major issue driving the high incidence of skeletal abnormalities is the high intake of phytates, the main form of phosphorus storage in grains. Poultry lacks the necessary microflora to hydrolyze phytate phosphorus, and so only utilize phytate phosphorus to a limited extent. Moreover, phytate also limits the availability of other key nutrients for bone development, particularly calcium, zinc, copper, and essential amino acids (Rousseau et al., 2016).

Both of these issues can be addressed by supplementing diets. For vitamin D, simply increasing the supply in the diet can increase uptake. However, as broiler growth rates have increased, it has become increasingly clear that simply supplementing vitamin D is no longer sufficient to prevent vitamin D deficiency. Conversely, adding activated metabolites (i.e. hydroxylated) of vitamin D3 to broiler chickens’ diets can partially compensate the lack of this vitamin (Shojadoost et al., 2021), with research showing that 1α-OHD3 is more effective than other sources of vitamin D at increasing calcium absorption and maintaining bone health. Furthermore, 1α-OH-D3 can be effective at improving the absorption of phytate phosphorus. This effect can be further improved by the addition of phytase to the diet: since it hydrolyzes phytate, phytase increases the availability of dietary phosphorus and reduces the impact of phytate on the absorption of other nutrients. However, the use of phytase is not a panacea, as a significant proportion of phytate will not be hydrolyzed, with reports suggesting that supplementation with phytase results, on average, in about 29% of the phytate being hydrolyzed (Ghaly et al., 2017; Manopriya et al., 2022).

The biological effects of vitamin D3 can be mediated by the binding of active vitamin D to vitamin D receptors (VDR) (El-Khasemi and Faye, 2019). In chickens, vitamin D regulates Calbindin 28k (CaBP-D28k), an intracellular Ca²⁺-binding protein that transports Ca from the apical toward the basolateral membrane (Wu et al., 2021). The addition of vitamin D3 also increases CaBP-D28k mRNA expression in the small intestine (Wang et al., 2022). CaBP-D28k protein plays a role in Ca²⁺ transport in the kidneys, eggshell gland and intestine in birds, which can be effective in phosphorus absorption.

One of the characteristics of 1α-OH-D3 is that it acts as a substitute for the phytase enzyme of foreign origin, which can be effective on the absorption of minerals and bird growth. Since past research mostly focused on the separate application of 1α-OH-D3 metabolite and phytase, and considering there are few results on the use of their mixture with broiler chickens, the present research can be important from an innovation standpoint. Therefore, the present experiment was conducted to evaluate the effect of 1α-OH-D3 and phytase separately and together on the performance, carcass characteristics, blood factors and the expression of VDR and CaBP-D28k genes in broiler chickens.

MATERIALS AND METHODS

This experiment was conducted with 400 one-day-old male chickens (Cobb 500 strain), using a completely randomized design with four treatments and five replicates (20 chickens for each replicate) for 42 days. The experimental treatments were: 1- Control (with no 1α-OH-D3 and phytase), 2- Control + 14 mg/kg 1α-OH-D3 in the diet, 3- Control + 5 mg/kg phytase and 4- Control + 14 mg/kg 1α- OH-D3 + 5 mg/k phytase. The two supplements used were crystalline 1α- OH-D3 (Vitamin Derivatives, Georgia USA) and phytase (Bonfezyme, Bioluence, Tehran, Iran). Chickens were initially weighed and the ones with similar average weights were distributed in each replicate. Water and feed were provided freely during the rearing period. Three control diets were used: starter (1-10 days old), grower (11-25 days old), and finisher (26-42 days old), with compositions based on the recommendations of the Cobb 500 Breeding Guide (Table 1).

Table 1
Dietary composition for different rearing periods.

Ingredients (%)	Starter (1-10 days old)	Grower (11-24 days old)	Finisher (25-42 days old)
Corn	49.11	53.51	58.11
Soybean meal	38.70	35.00	27.00
Wheat	5.00	5.52	9.05
Soybean oil	1.70	1.70	2.00
Corn gluten	1	0	0
Sodium bicarbonate	0.03	0.1	0.15
CaCO3	1.80	1.73	1.60
Mono calcium phosphate	1.20	1.07	0.84
NaCl	0.33	0.27	0.25
Mineral premix1	0.25	0.25	0.25
Vitamin premix2	0.25	0.25	0.25
L-Lysine-HCl	0.23	0.23	0.19
DL-Methionine	0.3	0.28	0.26
L-Threonine	0.1	0.09	0.05
Total	100	100	100
Chemical analyses
Metabolizable energy (kcal/kg)	2950	3000	3080
Crude protein (%)	22	20	17.5
Lysine (%)	1.24	1.15	0.95
Methionine (%)	0.6	0.55	0.51
Methionine + Cysteine (%)	0.87	0.8	0.73
Threonine (%)	0.8	0.74	0.6
Arginine (%)	1.34	1.3	1.05
Isoleucine (%)	0.82	0.75	0.68
Valine (%)	1	0.88	0.71
Ca (%)	0.96	0.9	0.8
Available Phosphorus (%)	0.36	0.33	0.28
Na (%)	0.16	0.16	0.16

• ¹
  Supplied the following per kilogram of feed: Mn (as Manganese oxide): 39.68 g; Fe: (as ferrous sulfate): 20 g; Cu (as Copper sulfate): 4 g; Zn (as Zinc oxide): 33.88 g; Se (as sodium selenite): 0.08 g, I (calcium iodate): 0.396 g and Betain: 200 g.
• ²
  Supplied the following per kilogram of feed (without vitamin D3): vitamin A: 3600000 IU; Niacin: 11.88 g; vitamin E: 7200 IU; vitamin K3: 0.8 g; Thiamin: 0.7 g; vitamin H2 (Biotin): 0.04 g; Riboflavin: 2.64 g; Pantothenic acid: 3.92 g; Pyridoxine: 1.176 g; Folic acid: 0.4 g; vitamin B12: 0.006 g; Antioxidant: 400 mg.

The chickens were weighed at the end of the rearing period (42 days old), and weight gain, feed conversion ratio, and feed intake were measured for the 42 day period, corrected for losses. After the rearing period, three chickens close to the average weight for each replicate were selected, weighed, and slaughtered. After feather removal and emptying of the digestive system, the weight was measured for the thighs, chest, wings, and neck of the carcass, as well as for the liver, heart, and abdominal fat, using a digital scale (0.1 ± 0.0 g). The percentage of each of the measured parts was calculated relative to the live weight. At 21 and 42 days of age, 3 chickens were randomly chosen from each of the replicates, and blood sample collection was done from the wing vein into blood tubes without anticoagulant. These were immediately transported to the laboratory, and the samples underwent centrifugation at 3000 rpm for 15 minutes to separate the serum. Finally, serum calcium, phosphorus, and alkaline phosphatase levels were evaluated using an RA-XT Auto-Analyzer (Technicon, city, USA) and a Pars Azmon commercial kit (Zahedi et al., 2023).

Three to 5 g of duodenum (for extraction of VDR mRNA) and 3 to 5 g of liver (for extraction of CaBP-D28k mRNA) genes were subsequently collected, each sample was placed in individual RNA-free sterile microtubes, and then transferred to the laboratory at 4˚C, and frozen at -80 °C until RNA extraction. The RNA extraction was undertaken according to the manufacturing company’s guidelines, using a Favorgen (PingPung, Taiwan) kit with specifications “Cat. No: FABRK001” and “Lot No: BIB05118C10”. The extracted RNA concentration was determined by the spectrophotometric method, and an OD260/280 ratio between 1.8 and 2 was used to evaluate the purity of the extracted RNA. All samples were then kept at -80 ºC. The stages of the gene expression study included cDNA generation and assessment of gene expression using qualitative real-time polymerase chain reaction (PCR).

A reverse transcription reaction was done with 1 gμ RNA and a primescript reverse transcription reagent kit (QIAGEN, 205311) following the manufacturer’s instructions. Qualitative real-time PCR reaction (qPCR) was done with a QIAGEN SYBR Premix PCR Kit, with the help of specific primers designed for VDR and CaBP-D28k genes at a reaction volume of 10 μL, including 5 Lμ of SYBR Green Premix I PCR mix (QIAGEN, 204052) (2X), 0.4 μL from the reverse and forward primers (10 μL), 2.3 μL of RNA free deionized water, and 1 μL of cDNA,. The reaction temperature program comprised 95 ºC for 60 seconds, 40 cycles with 95 ºC for 10 seconds, primer binding temperatures of 60 and 64 ºC for VDR and CaBP-D28k sites, respectively, and 72 ºC for 30 seconds, with the ultimate extension temperature of 72˚C for 5 minutes. The relative expression level of the gene was checked based on the resulting cycle threshold (Ct) curves and by comparison with the beta-actin gene as House Keeping through the 2^-∆∆CT template.

The sequence of primers used in the research for VDR genes was based on Hsiang Hsiao et al. (2018), while that of CaBP-D28k was based on Han et al. (2021), as detailed in Table 2.

Table 2
List of primers used.

Gene	Primer Sequence (5’ to 3’)	Product size
VDR	Forward: CGTGAGAAGCAAATTCAGCA### Reverse: GAGGTCCAGGTTGGAAAACA	157 bp
CaBP-D28k	Forward: AGATCTGGCACCACTACGAC### Reverse:TGAGCAAGCTCAACGATTCCT	187 bp
β-actin	Forward: CCACCGCAAATGCTTCTAAAC### Reverse: GAAGGTGTCAGCAGTCTT	175 bp

STATISTICAL ANALYSIS

Data were analyzed by the statistical model Y_ij = μ + T_i + ε_ij and the general linear models (GLM) procedure of SAS.9.4 software (SAS, 2004). Y_ij is the numerical value of each observation, μ is the average of the population, T_i indicates the effect of experimental groups, and ε_ij indicates the effect of the experimental error. Duncan’s test was used at the 0.05 level to compare the averages.

RESULTS

Table 3 presents the impact of treatments on broiler chickens’ performances. The weight gain of chickens that received 1α-OH-D3 in isolation and with phytase indicated a significant increase in relation to the control (p<0.05). The conversion ratio was significantly improved in relation to the controls only in chickens that received 1α-OH-D3 along with the phytase enzyme (p<0.05).

Table 3
The effect of treatments on broiler chickens’ performances at 42 days.

Treatments	Weight gain (g)	Feed consumption (g)	Conversion ratio
A	2600.1±204.96b	4717.1±1.48	1.82±0.07a
B	2816.5±130.81a	4924.4±7.13	1.74±0.09ab
C	2673.6±94.41b	4851.6±4.46	1.81±0.08a
D	2955.1±55.23a	4958.7±2.91	1.67±0.02b
SEM	30.64	37.54	0.025
p-value	0.0469	0.1849	0.0313

• A: Control (no additional supplements), B: Addition of 14 mg/kg DM 1α-OH-D3 in diet, C: Addition of 5 mg/kg phytase, and D: Addition of 14 mg/kg 1α- OH-D3 + 5 mg/k phytase.
• Means in the same column with at least one common letter have no significant difference (p<0.05)
• SEM: standard error of the mean.

Table 4 presents the results of treatments on the percentage of carcass parts and internal organs. The percentage of thighs in the treatments containing the mixture of 1α-OH-D3 and phytase showed a significant increase in comparison with the controls (p<0.05). There was a significant increase in breast percentages in all treatments in comparison to the controls (p<0.05). Furthermore, the abdominal fat percentage in the treatment containing the mixture of 1α-OH-D3 and phytase was significantly reduced in relation to the controls (p<0.05).

Table 4
- The effect of experimental treatments on the carcass characteristics of broiler chickens at 42 days (%).

Treatments	Thigh (%)	Breast (%)	Wing (%)	Neck (%)	Liver (%)	Heart (%)	Abdominal fat (%)
A	19.78±0.71b	22.15±2.31b	5.67±0.59	4.29±0.08	1.64±0.14	0.53±0.04	1.42±0.34a
B	20.31±1.2b	29.30±1.78a	5.84±0.59	5.01±0.09	1.51±0.19	0.43±0.03	1.19±0.43ab
C	20.04±1.95b	27.34±1.6a	5.74±0.25	4.74±0.02	1.53±0.13	0.52±0.1	1.31±0.21ab
D	28.52±0.34a	29.66±2.03a	6.02±0.63	5.39±0.07	1.41±0.15	0.55±0.11	0.80±0.31b
SEM	0.25	0.47	0.11	0.18	0.04	0.02	0.09
p-value	0.048	0.034	0.7633	0.1819	0.2322	0.1632	0.0409

• A: Control (no additional supplements), B: Addition of 14 mg/kg DM 1α-OH-D3 in diet, C: Addition of 5 mg/kg phytase, and D: Addition of 14 mg/kg 1α- OH-D3 + 5 mg/k phytase.
• Mean values in the same column with at least one common letter are not significantly different (p<0.05)
• SEM: standard error of the mean.

Table 5 presents the results of treatments on the blood biochemical factors of broilers on the 21st and 42nd days of rearing. On the 21^st day of age, a significant increase in relation to the control was observed in the concentration of blood phosphorus of chickens that received phytase (p<0.05). On the 42^nd day of age, the amount of Ca and P in the blood serum of the chickens that received 1α-OH-D3 along with phytase showed a significant increase in comparison with the controls (p<0.05). Moreover, the amount of ALP at the end of the period in the chickens that had received 1α-OH-D3 along with phytase had a significant decrease in relation to the controls (p<0.05).

Table 5
The effect of the experimental treatments on the biochemical parameters of the blood of broiler chickens.

Treatments	21 days of age			42 days of age
	Ca (mg/dl)	P (mg/dl)	ALP (U/L)	Ca (mg/dl)	P (mg/dl)	ALP (U/L)
A	9.84±1.28	5.46±1.06b	11009.00±10362.79	8.43±1.28b	5.52±1.35b	3337.60±2889.85a
B	10.65±1.10	5.75±1.28ab	6495.00±5277.00	8.96±1.1ab	5.58±1.05b	2137.70±932.08ab
C	11.04±1.41	6.78±1.16a	68861.00±8528.07	8.81±2.01ab	5.90±0.83ab	2144.20±984.73ab
D	11.17±2.01	6.18±1.47ab	5203.00±4854.55	9.46±1.41a	6.58±0.54a	1558.50±465.82b
SEM	0.24	0.21	1227.59	0.17	0.17	266.06
p-value	0.2061	0.0399	0.2213	0.0326	0.0246	0.0111

• A: Control (no additional supplements), B: Addition of 14 mg/kg DM 1α-OH-D3 in diet, C: Addition of 5 mg/kg phytase, and D: Addition of 14 mg/kg 1α- OH-D3 + 5 mg/k phytase.
• Means in the same column with at least one common letter are not significantly different (p<0.05)
• SEM: standard error of the mean.

The impact of treatments on VDR and CaBP-D28k gene expression is respectively presented in Figures 1 and 2. The difference in expression of VDR and CaBP-D28k genes in the treatments that used 1α-OH-D3 and 1α-OH-D3 along with phytase enzyme indicated a significant increase in comparison with the controls (p<0.05).

Figure 1
Effect of the experimental diets on VDR gene expression in broiler chickens

Means in the same column with at least one common letter are not significantly different (p < 0.05).

Figure 2
Effect of the experimental diets on VDR gene expression in broiler chickens

Means in the same column with at least one common letter are not significantly different (p<0.05).

DISCUSSION

Chickens had a higher weight gain when 1α-OH-D3 was used in isolation, as well as with phosphatase enzyme in the treatments. Consistent with our results, Edwards (2002) observed that the weight gain of broiler chickens increased with 1α-OH-D3 consumption, and this increase was similar to a group of chickens that received 1,25-(OH)2-D3. Han et al. (2009) and Liem et al. (2009) reported that the addition of a 1α-OH-D3 metabolite to the feed of broilers improved their performance.

Previous researchers have reported the 1α-OH-D3 bioavailability to be about 8-10 times that of cholecalciferol (Haussler et al., 1973; Edwards et al., 2002). Also, Edwards (2002) stated in his report that 1α-OH-D3 bioactivity in broilers is comparable to that of 1,25-(OH)2-D3.

1α-OH-D3 is hydroxylated to 1,25-(OH)2-D3 by 25-hydroxylase enzyme in the liver of broilers. The final active form of 1α-OH-D3 is 1,25-(OH)2-D3 (Hu et al., 2020).

The absorption efficiency of 1α-OH-D3 is higher than vitamin cholecalciferol, and it is converted to 1,25-(OH)2-D3 more quickly in the liver. Since the 1-hydroxylated metabolite of vitamin D has finished one step of hydroxylation, it improves the absorption of calcium and phosphorus through a faster absorption, which can be expected to improve growth performance (Christakos et al., 2016).

Han et al. (2009) reported an interaction effect of 1α-OH-D3 and phytase enzyme improving the feed conversion ratio of broiler chickens. Various studies have shown that calcium in the intestine reduces the ability to dissolve phytate (Tamim et al., 2004). Metabolites of 1α-OH-D3 increase calcium absorption and the ability to dissolve phytates, thus increasing intestinal phytase activity. This can be confirmed by the significant reduction of the conversion ratio in the present experiment.

As seen in the results, breast percentage increased when vitamin D metabolite and phytase were used alone or in combination in the diet. Also, the mixture of 1α-OH-D3 and phytase could increase the percentage of thigh in the broilers. For optimal growth, broilers continuously need the active metabolite of vitamin D3 to absorb calcium and phosphorus. With an increase in the age of the bird, vitamin D metabolism is disturbed due to the decrease in the capacity of liver and kidney hydroxylase enzymes to activate cholecalciferol, or the internal synthesis of active metabolites of vitamin D3 (Ghasemi et al., 2019). Since 1α-OH-D3 is hydroxylated more efficiently and quickly, together with phytase it can increase calcium and phosphorus absorption. As a result, the amount of saponified calcium with fatty acids in the digestive tract is reduced, and the absorption of fatty acids is improved, which can help improve the growth of carcass components (Momeneh et al., 2018).

Furthermore, the simultaneous consumption of 1α-OH-D3 and phytase has a great effect on the mineralization and strength of the tibia due to the absorption of calcium and phosphorus, and their reduction may reduce the ash content of the leg. In the present experiment, better calcium and phosphorus absorption may be effective in improving the weight of the thighs, possibly due to an effect on the weight of the femur (Khajali et al. 2010).

The use of phytase improves protein digestibility and absorption of essential amino acids, especially lysine, and may increase the production of meat and carcasses in broiler chickens (Marchal et al., 2021).

In our experiment, the chickens receiving the mixture of 1α-OH-D3 and phytase showed a lower abdominal fat percentage compared to other chickens. The results of some studies have shown that vitamin D3 can prevent the accumulation of fat in the liver by regulating the circulation of free fatty acids, inhibiting lipogenesis, and strengthening the oxidation of fats (Yin et al., 2012; Asadi Kermani et al., 2023). Regarding the molecular mechanism of the effects of vitamin D3, vitamin D3 can increase the expression of ATG16L1, which is part of the ATG5-ATG12 complex and is necessary for the formation of autophagosomes, thereby reducing fat accumulation in the liver and regulating the organ’s lipid metabolism (Fujita et al., 2008).

The findings of other studies have also confirmed the benefits of phytase enzyme supplementation in reducing abdominal fat. Phosphorus phytate reduces the function of digestive enzymes, including pancreatic lipase function. As a result, adding phytase can lead to optimal lipase activity in the digestive system and to a reduction of abdominal fat (Pieniazek et al., 2016).

Adding phytase along with 1α-OH-D3 significantly increased blood calcium and phosphorus compared to the control group.

1,25-(OH)2-D3 as the active form of vitamin D can increase calcium and phosphorus absorption (Hsiang Hsiao et al., 2018). It increases the calcium and phosphorus absorption from the lumen into the plasma due to its effect on the small intestine’ enterocytes. This vitamin, along with parathyroid hormones, can improve calcium reabsorption from the distal tubules, which will finally lead to an increase in the calcium and phosphorus blood levels (Han et al., 2016). Since 1α-OH-D3 is quickly converted into the active form of vitamin D, it can increase the amount of phosphorus and calcium in the blood.

Some researchers have shown that the use of phytase increases blood phosphorus concentration and the possibility of phosphorus storage in bone tissue (Ciurescu et al., 2020; Shi et al., 2024).

In this study, alkaline phosphatase was affected by the consumption of 1α-OH-D3 along with phytase. Alkaline phosphatase is a zinc-containing metalloenzyme that is considered an indicator of liver damage. Moreover, it is one of the endogenous phosphatases, which, in the small intestine, cause the release of phosphorus from inositol monophosphate, and the production of inositol, which plays a key role in bone mineralization (Zanu et al., 2020).

It was reported that increasing phosphorus availability may reduce birds’ need to use endogenous phosphatases (Daramola et al., 2017). Since the use of 1α-OH-D3 along with phytase has increased the level of available phosphorus in the blood in the course of our experiment, it has probably been able to reduce the amount of alkaline phosphatase.

The level of expression of VDR and CaBP-D28k genes in the treatments that used the vitamin D metabolite, alone or mixed with phytase enzyme, indicated a significant elevation compared to the control and the treatment that contained phytase alone. Centeno et al. (2011) stated that reducing the level of vitamin D in mice caused a decrease in VDR gene expression in their experiments.

Yang et al. (2020) stated that the optimal levels of 1α-hydroxycholecalciferol (1α-OH-D3) and 1,25-(OH)2-D3 enhanced VDR gene expression in the intestine of broiler chickens.

Yang et al. (2019) showed in their experiments that vitamin D increased CaBP-D28k expression levels in broilers, which is in line with our results. In another study, the expression level of intestinal CaBP-D28k in broiler chickens after receiving 1,25-(OH)2-D3 was 50 and 433.7 times higher than in chickens with vitamin D deficiency (Clemens et al., 1988);

Previous studies have shown that vitamin D binds to VDR in the small intestine to regulate phosphorus and calcium absorption. The absorption of phosphorus and calcium in the small intestine is increased by 1α-OH-D3. When 1α-OH-D3 is converted to 1,25-(OH)2-D3, it can bind to VDR (Xu et al., 2002; Yang et al., 2020).

The vitamin D receptor is found in intestinal epithelial cells (Han et al., 2018). In the small intestine of animals, there are transcellular and paracellular channels for calcium absorption. In Ca²⁺ transcellular transport, Ca-binding protein-D28k (CaBP-D28k) plays an effective role (Fleet and Schoch, 2010).

CaBP-D28k transports calcium from the apical membrane to the basolateral membrane, which affects calcium absorption (Okano et al., 2004).

As a phosphorus transporter protein, type IIb sodium-phosphate cotransporter (NaPi-IIb) can be found in the epithelial cell apical membranes of the broilers’ small intestines (Forster et al. 2013). Yang et al. (2020) observed that 1,25-(OH)2-D3 can regulate NaPi-IIb mRNA expression levels in rat intestines.

After absorption, 1α-OH-D3 quickly turns into the active form of 1,25-(OH)2-D3, which enhances calcium and phosphorus absorption. One of the important features of 1α-OH-D3 is that it acts independently of the phytase enzyme with foreign origin. Phytase acts in the upper parts of the digestive tract with low pH to help digest phytate into phosphate and inositol, while 1α-OH-D3 acts in the lower part of the digestive tract with high pH, which can help improve absorption of calcium and phosphorus (Proszkowiec-Weglarz et al., 2019). Therefore, the significant improvement in the expression of the VDR and CaBP-D28k genes in the treatments of this experiment containing 1α-OH-D3, in isolation or mixed with phytase, can indicate a higher absorption of calcium and phosphorus.

CONCLUSIONS

The results showed that the use of 1α-OH-D3 mixed with phytase, compared to their separate use in the diet, can cause higher growth performance, an increase in the amount of Ca and P in blood serum, and a greater relative expression of the VDR and CaBP-D28k genes in broiler chickens.

ACKNOWLEDGMENTS

The authors thank all the teams who worked on the experiments and provided results during this study.

REFERENCES

• Ahmadi M, Ahmadian A, Poorghasemi M, et al. Nano-selenium affects on duodenum, jejunum, ileum and coloncharacteristics in chicks:An animal model. International Journal of Nano Dimension 2018;10(2):225-9.
• Ahmadi M, Poorghasemi M, Seidavi A, et al. An optimum level of nano-selenium supplementation of a broiler diet according to the performance, economical parameters, plasma constituents and immunity. Journal of Elementology 2019;25(3):1178-98. https://doi:10.5601/jelem.2020.25.2.1954
  » https://doi:10.5601/jelem.2020.25.2.1954
• Asadi Kermani Z, Taheri HR, Faridi A, et al. Interactive effects of calcium, vitamin D3, and exogenous phytase on phosphorus utilization in male broiler chickens from 1 to 21 days post-hatch:A meta-analysis approach. Animal Feed Science and Technology 2023;295:115525-36. https://doi:10.1016/j.anifeedsci.2022.115525
  » https://doi:10.1016/j.anifeedsci.2022.115525
• Centeno V, Picotto G, Perez A, et al. Intestinal Na+/Ca2+ exchanger protein and gene expression are regulated by 1,25(OH)2D3 in vitamin D-deficient chicks. Archives of Biochemistry and Biophysics 2011;509:191-6. https://doi:10.1016/j.abb.2011.03.011
  » https://doi:10.1016/j.abb.2011.03.011
• Christakos S, Dhawan P, Verstuyf A, et al. Vitamin D: metabolism, molecular mechanism of action, and pleiotropic effects. Physiological Reviews 2016;96:365-408. https://doi:10.1152/physrev.00014.2015
  » https://doi:10.1152/physrev.00014.2015
• Ciurescu G, Vasilachi A, Grosu H. Efficacy of microbial phytase on growth performance, carcass traits, bone mineralization, and blood biochemistry parameters in broiler turkeys fed raw chickpea (Cicer arietinum L., cv. Burnas) diets. Journal of Applied Poultry Research 2020;29:171-84. https://doi:10.1016/j.japr.2019.10.004
  » https://doi:10.1016/j.japr.2019.10.004
• Clemens TL, McGlade SA, Garrett KP, et al. Tissue-specific regulation of avian vitamin D-dependent calcium-binding protein 28-kDa mRNA by 1,25-dihydroxyvitamin D3. Journal of Biological Chemistry 1988;263:13112-6. https://doi.org/10.1016/S0021-9258(18)37678-6
  » https://doi.org/10.1016/S0021-9258(18)37678-6
• Daramola OT. Haematological parameters, serum metabolites and enzyme activities of broiler chicken fed with or without phytase. Asian Journal of Advances in Agricultural Research 2017;2(4):1-7. https://doi.org/10.9734/AJAAR/2017/36468
  » https://doi.org/10.9734/AJAAR/2017/36468
• Edwards HM. Studies on the efficacy of cholecalciferol and derivatives for stimulating phytate utilization in broilers. Poultry Science 2002;81:1026-31. https://doi.org/10.1093/ps/81.7.1026
  » https://doi.org/10.1093/ps/81.7.1026
• Edwards HMJr, Shirley RB, Escoe WB, et al. Quantitative evaluation of 1?- hydroxycholecalciferol as a cholecalciferol substitute for broilers. Poultry Science 2002;81:664-9. https://doi.org/10.1093/ps/81.5.664
  » https://doi.org/10.1093/ps/81.5.664
• El-Khasemi M, Faye B. Blood, milk and meat vitamin D in the dromedary camel. Iranian Journal of Applied Animal Science 2019;9(4):585-95.
• Fleet JC and Schoch RD. Molecular mechanisms for regulation of intestinal calcium absorption by vitamin D and other factors. Critical Reviews in Clinical Laboratory Sciences 2010;47:181-95. https://doi.org/10.3109/10408363.2010.536429
  » https://doi.org/10.3109/10408363.2010.536429
• Forster IC, Hernando N, Biber J, et al. Phosphate transporters of the SLC20 and SLC34 families. Molecular Aspects of Medicine 2013;34:386-95. https://doi.org/10.1016/j.mam.2012.07.007
  » https://doi.org/10.1016/j.mam.2012.07.007
• Fujita N, Itoh T, Omori H, et al. The Atg16L complex specifies the site of LC3 lipidation for membrane biogenesis in autophagy. Molecular Biology of the Cell 2008;19:2092-100. https://doi.org/10.1091/mbc.e07-12-1257
  » https://doi.org/10.1091/mbc.e07-12-1257
• Ghaly KA, Osman AMA, Abd EL-Latif SA, et al. Effect of phytase and enzymes mixture supplementation on some physiological responses of broiler chicks. Egypt Poultry Science 2017;37(2):379-90. http://doi.org/10.21608/epsj.2017.5408
  » http://doi.org/10.21608/epsj.2017.5408
• Ghasemi P, Toghyani M, Landy N. Effects of dietary 1a lphahydroxycholecalciferol in calcium and phosphorous-deficient diets on growth performance, tibia related indices and immune responses in broiler chickens. Animal Nutrition 2019;5:134-9. https://doi.org/10.1016/j.aninu.2018.04.011
  » https://doi.org/10.1016/j.aninu.2018.04.011
• Han JC, Yang XD, Zhang T, et al. Effects of 1?- hydroxycholecalciferol on growth performance, parameters of tibia and plasma, meat quality, and type IIb sodium phosphate cotransporter gene expression of one- to twenty-one-day-old broilers. Poultry Science 2009;88:323-9. https://doi.org/10.3382/ps.2008-00252
  » https://doi.org/10.3382/ps.2008-00252
• Han JC, Wang JG, Chen GH, et al. Effects of calcium to nonphytate phosphorus ratio and different sources of vitamin D on growth performance and bone mineralization in broiler chickens. Revista Brasileira de Zootecnia 2016;45:1-7. https://doi.org/10.1590/S1806-92902016000100001
  » https://doi.org/10.1590/S1806-92902016000100001
• Han JC, Zhang JL, Zhang N, et al. Age, phosphorus, and 25-hydroxycholecalciferol regulate mRNA expression of vitamin D receptor and sodium-phosphate cotransporter in the small intestine of broiler chickens. Poultry Science 2018;97:1199-208. https://doi.org/10.3382/ps/pex407
  » https://doi.org/10.3382/ps/pex407
• Han JC, Wang XN, Wu LH, et al. Dietary calcium levels regulate calcium transporter gene expression lev in the small intestine of broiler chickens. British Poultry Science 2021;63(2):202-10. https://doi.org/10.1080/00071668.2021.1949697
  » https://doi.org/10.1080/00071668.2021.1949697
• Haussler MR, Zerwekh JE, Hesse RH, et al. Biological activity of l?-hydroxycholecalciferol, a synthetic analog of the hormonal form of vitamin D3. Proceeding of National Academic Science USA 1973;70:2248-52. https://doi.org/10.1073/pnas.70.8.2248
  » https://doi.org/10.1073/pnas.70.8.2248
• Hsiang Hsiao FS, Cheng YH, Han JC, et al. Effect of different vitamin D3 metabolites on intestinal calcium homeostasisrelated gene expression in broiler chickens. Revista Brasileira de Zootecnia 2018;47:1-8. https://doi.org/10.1590/rbz4720170015
  » https://doi.org/10.1590/rbz4720170015
• Hu YX, van Baal J, Hendriks WH, et al. Mucosal expression of Ca and P transporters and claudins in the small intestine of broilers is altered by dietary Ca:P in a limestone particle size dependent manner. PLoS ONE 2020;17(9):e0273852. https://doi.org/10.1371/journal.pone .0273852.
  » https://doi.org/10.1371/journal.pone
• Khajali F, Wideman RF. Dietary arginine:Metabolic, environmental, immunological and physiological interrelationships, World's Poultry Science Journal 2010;66:751-66. https://doi.org/10.1017/S0043933910000711
  » https://doi.org/10.1017/S0043933910000711
• Liem A, Pesti GM, Atencio A, et al. Experimental approach to optimize phytate phosphorus utilization by broiler chickens by addition of supplements. Poultry Science 2009;88:1655-65. https://doi.org/10.3382/ps.2008-00481
  » https://doi.org/10.3382/ps.2008-00481
• Manopriya S, Aberathna AAAU, Satharasinghe DA. Importance of phosphorus in farm animals. Iranian Journal of Applied Animal Science 2022;12(2):203-10.
• Marchal L, Bello A, Sobotik EB, et al. A novel consensus bacterial 6-phytase variant completely replaced inorganic phosphate in broiler diets, maintaining growth performance and bone quality:data from two independent trials. Poultry Science 2021;100:100962. https://doi.org/10.1016/j.psj.2020.12.059
  » https://doi.org/10.1016/j.psj.2020.12.059
• Meena NN, Waiz HA, Chavhan DM, Impact of stocking density on broiler chicken performance, blood biochemisty, and carcass attributes in an intensive rearing system. Iranian Journal of Applied Animal Science 2022;12(4):803-12.
• Momeneh T, Karimi A, Sadeghi G, et al. Evaluation of dietary Calcium level and source of phytase on growth performance, serum metabolits and ileum mineral contents in broiler chicks adequate phosphorus diet form one to 28 days of age. Poultry Science 2018;97:1283-9. https://doi.org/10.3382/ps/pex432
  » https://doi.org/10.3382/ps/pex432
• Okano T, Tsugawa N, Morishita A, et al. Regulation of gene expression of epithelial calcium channels in intestine and kidney of mice by 1?,25- dihydroxyvitamin D3. Journal of Steroid Biochemistry and Molecular Biology 2004;89:335-8. https://doi.org/10.1016/j.jsbmb.2004.03.024
  » https://doi.org/10.1016/j.jsbmb.2004.03.024
• Pieniazek J, Smith KA, Williams MP, et al. Evaluation of increasing levels of a microbial phytase in phosphorus deficient broiler diets via live broiler performance, tibia bone ash, apparent metabolizable energy, and amino acid digestibility. Poultry Science 2016;10:1-13. https://doi.org/10.3382/ps/pew225
  » https://doi.org/10.3382/ps/pew225
• Poorghasemi M, Chamani M, Mirhosseini SZ, et al. Effect of probiotic and different sources of fat on performance, carcass characteristics, intestinal morphology and ghrelin gene expression on broiler chickens. Kafkas Universitesi Veteriner Fakultesi Dergisi 2017;24(2):169-78. https://doi.org/10.9775/kvfd.2017.18433
  » https://doi.org/10.9775/kvfd.2017.18433
• Proszkowiec-Weglarz M, Schreier LL, Miska KB, et al. Effect of early neonatal development and delayed feeding post-hatch on jejunal and ileal calcium and phosphorus transporter genes expression in broiler chickens. Poultry Science 2019;98:1861-71. https://doi.org/10.3382/ps/pey546
  » https://doi.org/10.3382/ps/pey546
• Rousseau X, Valable AS, L'etourneau-Montminy MP, et al. Adaptive response of broilers to dietary phosphorus and calcium restrictions. Poultry Science 2017;95:2849-60. https://doi.org/10.3382/ps/pew172
  » https://doi.org/10.3382/ps/pew172
• SAS Institute. SAS(r)/STAT software. Release 9.4. Cary; 2004.
• Shams S, Kheiri F, Landy N. The effects of 1a(OH)D3 individually or in combination with phytase, and different levels of cholecalciferol on performance, tibia criteria, and plasma minerals of Japanese quails. Acta Scientiarum 2022;44:e54218. https://doi.org/10.4025/actascianimsci.v44i1.54218
  » https://doi.org/10.4025/actascianimsci.v44i1.54218
• Shi H, Lopes T, Tompkins YH, Effects of phytase supplementation on broilers fed with calcium and phosphorus-reduced diets, challenged with Eimeria maxima and Eimeria acervulina:Influence on growth performance, body composition, bone health, and intestinal integrity. Poultry Science 2024;103(4):103511-23. https://doi:10.1016/j.psj.2024.103511
  » https://doi:10.1016/j.psj.2024.103511
• Shojadoost B, Yitbarek A, Alizadeh M, et al. Centennial Review:Effects of vitamins A, D, E, and C on the chicken immune system. Poultry Science 2021;100(4):100930. https://doi.org/10.1016/j.psj.2020.12.027
  » https://doi.org/10.1016/j.psj.2020.12.027
• Tamim NM, Angel R, Christman M. et al. Influence of dietary calcium and phytase on phytate phosphorus hydrolysis in broiler chickens. Poultry Science 2004;83:-67. https://doi.org/10.1093/ps/83.8.1358
  » https://doi.org/10.1093/ps/83.8.1358
• Wang X, Li P, Zhao J, et al. The temporal gene expression profiles of calcium and phosphorus transporters in Hy-Line brown layers. Poultry Science 2022;101:1-11. https://doi.org/10.1016/j.psj.2022.101736
  » https://doi.org/10.1016/j.psj.2022.101736
• Whitehead CC, McCormack HA, McTeir L, et al. High vitamin D3 requirements in broilers for bone quality and prevention of tibial dyschondroplasia and interactions with dietary calcium, available phosphorus and vitamin A. British Poultry Science 2004;45:425-36. https://doi.org/10.1080/00071660410001730941
  » https://doi.org/10.1080/00071660410001730941
• Wu L, Wang X, Lv X, et al. 1,25-Dihydroxycholecalciferol improved the growth performance and upregulated the calcium transporter gene expression levels in the small intestine of broiler chickens. Poultry Science 2021;59(2):129-36. https://doi.org/ 10.2141/jpsa.0210019
  » https://doi.org/
• Xu H, Bai L, Collins JF, et al. Age-dependent regulation of rat intestinal type IIb sodium-phosphate cotransporter by 1,25-(OH)2 vitamin D3. American Journal of Physiology-Cell Physiology 2002;282:487-93. https://doi.org/10.1152/ajpcell.00412.2001
  » https://doi.org/10.1152/ajpcell.00412.2001
• Xue PC, Ajuwon KM, Adeola O. Phosphorus and nitrogen utilization responses of broiler chickens to dietary crude protein and phosphorus levels. Poultry Science 2016;95:2615-23. https://doi.org/10.3382/ps/pew156
  » https://doi.org/10.3382/ps/pew156
• Yang X, Wang XN, Zhang N, et al. Differentially expressed genes in vitamin D regulating calcium and phosphorus absorption in duodenum of broiler chickens using RNAsequencing. Chinese Journal of Animal Nutrition 2019;31:5202-13.
• Yang X, Zhang N, Wang XN, et al. Optimal dietary levels of 1?-hydroxycholecalciferol in broiler chickens from 1 to 42 days of age. Journal of Poultry Science 2020;57:124-30. https://doi.org/10.2141/jpsa.0190013
  » https://doi.org/10.2141/jpsa.0190013
• Yin Y, Yu Z, Xia M, et al. Vitamin D attenuates high fat diet -induced hepatic steatosis in rats by modulating lipid metabolism. European Journal of Clinical Investigation 2012;42:1189-96. https://doi.org/10.1111/j.1365-2362.2012.02706.x
  » https://doi.org/10.1111/j.1365-2362.2012.02706.x
• Zahedi A, Saravy A, Poorghasemi M. Evaluating the antioxidant effects of onion (Allium cepa) on blood biochemical factors and antioxidants after consuming tartrazine in rats. Archives of Razi Institute 2023;78(6):1836-42. https://doi:10.32592/ARI.2023.78.6.1836
  » https://doi:10.32592/ARI.2023.78.6.1836
• Zanu HK, Kheravii SK, Morgan NK, et al. Interactive effect of dietary calcium and phytase on broilers challenged with subclinical necrotic enteritis:part 2. Gut permeability, phytate ester concentrations, jejunal gene expression, and intestinal morphology. Poultry Science 2020;99:4914-28. https://doi.org/10.1016/j.psj.2020.06.030
  » https://doi.org/10.1016/j.psj.2020.06.030

• FUNDING

  This research was undertaken with the personal funding of the authors.

• DATA AVAILABILITY STATEMENT

  Data is available upon request.

• DISCLAIMER/PUBLISHER’S NOTE

  The published papers’ statements, opinions, and data are those of the individual author(s) and contributor(s). The editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions, or products referred to in the content.

Data availability

Data is available upon request.

Publication Dates

• Publication in this collection
  30 Aug 2024
• Date of issue
  2024

History

• Received
  28 Nov 2023
• Accepted
  16 May 2024