Acessibilidade / Reportar erro

Molecular differentiation of Salmonella Gallinarum and Salmonella Pullorum by RFLP of fliC gene from Brazilian isolates

Abstract

Although Salmonella Pullorum and Salmonella Gallinarum cause different diseases in poultry, they are very similar. Both are non-motile and present the same somatic antigenic structure. They are differentiated by biochemical tests. Certain atypical strains are very difficult to distinguish. They do not produce the expected results when dulcitol and ornithine descarxboxylase tests are performed. Therefore, additional tests could be helpful. Many studies have chose the part I of the gene that encodes flagellin (fliC) to differentiate serotypes. Most Salmonella strains have two structural genes (fliC and fliB) that encode flagellins. Non-motile strains generally present these structural genes, but are not able to build a functional flagellum. It was demonstrated that enzymatic restriction of the amplified fliC gene using Hinp1I enzyme can differentiate SG from SP. In the present study, this method was adopted to analyze 14 SP and 22 SG strains, including some strains with atypical results in biochemical tests assessing the utilization of dulcitol and ornithine. The results showed that all SG strains were broken by the enzyme, whereas the 14 SP strains were not.

FliC gene; differentiation; Salmonella Gallinarum; Salmonella Pullorum


v11n4a9

Molecular differentiation of Salmonella Gallinarum and Salmonella Pullorum by RFLP of fliC gene from Brazilian isolates

Paiva JB; Cavallini JS; Silva MD; Almeida MA; Ângela HL; Berchieri Junior A

Faculdade de Ciências Agrárias e Veterinárias- UNESP. Jaboticabal, SP. Departamento de Patologia Veterinária - Laboratório de Ornitopatologia

Mail AddressAngelo Berchieri Junior FCAV-Unesp Departamento de Patologia Veterinária Via de acesso Paulo Donato Castellane, s/n - Bairro Rural 14.884-900. Jaboticabal, SP, Brasil E-mail: berchier@fcav.unesp.br

ABSTRACT

Although Salmonella Pullorum and Salmonella Gallinarum cause different diseases in poultry, they are very similar. Both are non-motile and present the same somatic antigenic structure. They are differentiated by biochemical tests. Certain atypical strains are very difficult to distinguish. They do not produce the expected results when dulcitol and ornithine descarxboxylase tests are performed. Therefore, additional tests could be helpful. Many studies have chose the part I of the gene that encodes flagellin (fliC) to differentiate serotypes. Most Salmonella strains have two structural genes (fliC and fliB) that encode flagellins. Non-motile strains generally present these structural genes, but are not able to build a functional flagellum. It was demonstrated that enzymatic restriction of the amplified fliC gene using Hinp1I enzyme can differentiate SG from SP. In the present study, this method was adopted to analyze 14 SP and 22 SG strains, including some strains with atypical results in biochemical tests assessing the utilization of dulcitol and ornithine. The results showed that all SG strains were broken by the enzyme, whereas the 14 SP strains were not.

Keywords - FliC gene, differentiation, Salmonella Gallinarum, Salmonella Pullorum.

INTRODUCTION

According to Kauffman-White scheme (Grimont & Weill, 2007), more than 2,500 serovars have been described based on the antigen structure of lipopolysaccharide (O antigen) and flagellar proteins (H) (Boyd et al., 1993). However, only a limited set of Salmonella serotypes have been associated with poultry diseases and human salmonellosis. Salmonella enterica serotype Gallinarum (SG) and Salmonella enterica serotype Pullorum (SP) are non-motile host-specific avian pathogens. Salmonella Pullorum causes Pullorum disease, which is mainly characterized by septicemia in young birds, with white diarrhea and mortality (Berchieri Jr. & Freitas Neto, 2009). In general, adult birds do not show symptoms of the disease and may transmit SP to the progeny. Salmonella Gallinarum causes fowl typhoid, an acute septicemic disease with high mortality and morbidity that affects mostly adult birds, although it is very virulent to birds of any age. Some countries are considered free from SP and SG; however, these are sometimes reported, and are still a matter of concern in the poultry industry (Shivaprasad, 2000).

The differentiation between SP and SG is very important from epidemiological and preventive perspectives. They are very similar, and cannot be distinguished by conventional serological methods. The differentiation basically takes into account their biochemical characteristics. The standard methods take approximately 5 to 7 days, and are very time-consuming and expensive. The main biochemical characteristics assessed are the capacity to use dulcitol by SG, but not by SP, and ornithine decarboxylation by SP, but not by SG. Intermediate strains with atypical behavior in the dulcitol and ornithine descarboxilase biochemical tests were described by Li et al. (1993). SP and SG atypical strains were isolated in Brazil (Ribeiro et al., 2009).

Lately, biochemical methods have been complemented by DNA-based molecular techniques, because of their sensitivity, specificity, and swiftness. Such methods include restriction fragment length polymorphism (RFLP), which is sometimes associated to PCR (PCR-RFLP), IS200 profiling, ribotyping, pulse-field gel electrophoresis (PFGE), and single-strand conformational polymorphism (SSPC) (Christensen et al., 1992; Olsen et al., 1996; Kwon et al., 2000). Many studies used part I of the gene that encodes flagellin (fliC) to differentiate serotypes. Most Salmonella strains have two structural genes (fliC and fliB) that encode flagellins. Non-motile strains generally exhibit these structural genes, but are unable to build up a functional flagellum (Popoff et al., 1992).

The objective of the present study was to differentiate SP and SG isolated in Brazil, including strains with atypical biochemical behavior, by a single method: restriction of the amplified fliC gene using Hinp 1I enzyme.

MATERIAL AND METHODS

Bacterial strains

The strains used in this study are listed in Table 1. These strains were obtained from the Brazilian governmental laboratories LANAGRO, FIOCRUZ, and Adolfo Lutz Institute.

DNA extraction

Bacterial DNA was prepared as described by Soumet et al. (1994) with modifications. SP and SG strains were inoculated in Luria Bertani (LB) broth (Invitrogen 12780-052) and incubated 37ºC for 24h in shaking incubator (100rpm). One ml of each culture was centrifuged for 3min at 13000xg (4ºC).the resulting pellets were washed twice in 500µL 1X TAE buffer (Tris, Acetic Acid, and EDTA; pH 8.0), and centrifuged at 13000xg for 3min (4ºC). The pellet was resuspended in 200µL sterile water, boiled for 8min, and stored at -20ºC.

PCR primers

The following two primers were used for the amplification of flagellin gene phase 1: CTGGTGATGACGGTAATGGT (fliCF: 866-885) and CAGAAAGTTTCGCACTCTCG (fliCR: 1063-1044) (Kwon et al., 2000).

Amplification of the fliC gene by PCR

A reaction mixture containing 16.8µL ultra pure water (Gibco), 2µL PCR Buffer 10x, 0.7µL d-NTP (2mM), 0.8µL MgCl2 (50mM), 0.5µL of each primer, 0.5µL Taq DNA polymerase, and 3.2µL DNA, was prepared. The thermocycler was programmed with 1 cycle of 94ºC for 5min, 35 three-step cycles (denaturation at 94ºC for 30s, annealing at 58ºC for 10s, extension at 72ºC for 20s), and a final cycle at 72ºC for 7min. The amplicons were analyzed by electrophoresis in 1.5% agarose gel for 1h and 80V. Product size was compared to the 50 pb ladder (Fermentas SM1211) after ethidium bromide staining.

PCR-RFLP analysis. Digestion solution was prepared with 5µL of the PCR product, 1µL of Hinp 1I buffer (10x), 0.1µl of Hinp 1l enzyme, and 3.9µl of ultra-pure water (Gibco). After incubation at 37ºC for 1h, RFLPs were determined by electrophoresis of the digested DNA in 4% agarose gel for 4h at 40V. Product size of the products was analyzed in comparison to the 50bp ladder (Fermentas SM1211).

RESULTS

Amplification of the fliC gene. The expected 197 bp fragment of the fliC gene was successfully amplified from all the 22 Salmonella Gallinarum strains and 14 Salmonella Pullorum strains tested. Nonspecific pairing was not observed. The amplicons are shown in Figure 1.


PCR-RFLP analysis

Twenty-two SG strains and 14 SP strains were analyzed. Digestion of SG amplicons with Hinp 1I yielded two bands, of 115 and 82 bp, while no change in SP amplicons was observed, since no digestion occurred (Figure 2).


DISCUSSION AND CONCLUSIONS

Salmonella Gallinarum and Salmonella Pullorum are non-motile pathogens that infect poultry and other galliform birds (Barrow et al., 1994; Shivaprasad, 2000). Salmonella Gallinarum is responsible for fowl typhoid, and Salmonella Pullorum causes pullorosis, which is characterized by white diarrhea in chicks (Pomeroy, 1984). SG, found mostly in adult birds, can also affect young birds. Salmonella Pullorum may infect older chickens, causing symptoms similar to those observed in fowl typhoid (Wray et al., 1996). Therefore, the proper identification of both Salmonella serovars is very important from the epidemiological and control standpoints. The differentiation between SG and SP is based on biochemical characteristics (Cox & Willians, 1976); Ewing, 1986). These serovars cannot be distinguished by conventional serological methods because they have very similar antigenic O-factors. Biochemical methods are currently complemented by DNA-based molecular techniques. Most Salmonella strains exhibit two structural genes (fliC and fliB) that encode flagellins. Only of these structural genes is expressed in the bacterium at a time. Non-motile strains generally have these structural genes, but are unable to build up a functional flagellum (Popoff et al., 1992). Early studies showed that Salmonella Pullorum and Salmonella Gallinarum have a cryptic structural gene, flagellin (Zinder & Ledeberg, 1952). Several sequences of the gene encoding phase 1 flagellin (fliC) are available (Selander et al. 1992; Li et al., 1993; Kwon et al., 2000). The distal parts of the fliC alleles are conserved regions, making this gene in any serotype suitable for easy amplification, whereas the central region of the fliC gene is hyper variable, making it a target for differentiation among Salmonella serotypes (Wei & Joys, 1985; Kilger & Grimont, 1993; Dauga et al., 1998). Genetic events, such as point mutations, lateral transfer, and recombination, may explain the genetic diversity of Salmonella flagellin genes (Smith et al. 1990); Li et al., 1994) The SG and SP fliC gene represent allelic variants, and differ only in two codons (316 and 339) (Li et al., 1993). Kwon et al. (2000) showed that the Hinp1I enzyme recognizes one cleavage site in SG (codon 316), but not in SP.

The PCR-RFLP system has been frequently used in differentiation techniques because it is cheap and easy to perform. In our study, the fliC gene in SP (14 strains) and SG (22 strains), including intermediate strains dulcitol and ornithine descarboxylase positive and negative isolates in Brazil, were amplified. PCR-amplicons (197bp) were digested with the Hinp1I enzyme. Two fragments were obtained (82bp and 115bp) for all SG strains, including one dulcitol and ornithine descarboxylase positive strain, whereas no digestion was observed in the 14 SP strains, which gene remained unchanged (197bp), including the two atypical strains.

The RFLP-PCR flagellar typing scheme was successfully applied to serotype identification in 112 Salmonella isolates obtained from poultry and poultry environment (Hong et al., 2003). Kilger & Grimont (1993) showed practical application of restriction patterns of fliC gene using a mixture of endonucleases (TaqI and ScaI) to differentiate Pullorum and Gallinarum strains from non-motile Salmonella Typhi and some flagellar strains of Salmonella; however, this method was not useful to differentiate Gallinarum from Pullorum strains. Kwon et al. (2000) demonstrated that fliC gene RFLP-PCR using Hinp 1I enzyme can be successfully applied for differentiate these two Salmonella serovars in Korean isolates. However, the authors tested only eight strains of each serovar, all presenting typical biochemical behavior. In the present study, we were able to demonstrate that the use of fliC gene restriction patterns is an useful method to allow the differentiation between strains of S. Pullorum and S. Gallinarum isolated in Brazil, including those with atypical biochemical behavior. Therefore, our results reinforce that this method may be adopted to differentiate SP from SG.

Mail Address:

Arrived: August/2009

Aproved: October/2009

  • Barrow PA, Huggins MB, Lovell MA. Host specificity of Salmonella infection in chickens and mice is expressed in vivo primarily at the level of the reticuloendothelial system. Infection Immunology 1994; 62:4062-4610.
  • Berchieri Jr. A, Freitas Neto OC. Salmoneloses aviárias. In: BERCHIERI Jr. et al. Doença das aves. 2.ed. Campinas: Facta; 2009. p.435-451.
  • Boyd EE, Wang FS, Beltran P, Plock SA, Nelson K, Selander RK. Salmonella reference collection B (SARB): strains of 37 serovars of subspecies. Journal of General Microbiology 1993; 139:1125-1132.
  • Christensen JP, Olsen JE, Hansen HC, Bisgaard M. Characterization of Salmonella enterica serotype gallinarum byotipes gallinarum pullorum by plasmid profiling and biochemical analysis. Avian Pathology 1992; 21:461-470.
  • Cox NA, Willians JE. A simplified biochemical system to screen Salmonella isolates from poultry for serotyping. Poultry Science 1976; 55:1968-1971.
  • Dauga CA, Zabrovscala A, Grimont PAD. Restriction fragment length polymorfism analysis of some flagellin genes of Salmonella enterica. Journal of Clinical Microbiology 1998; 36:2835-2843.
  • Ewing WH. Edwards and ewing's identification of enterobacteriaceae. 4th ed. New York: Elsevier Science Publishing; 1986. p. 81-318.
  • Grimont PAD, Weill F. Antigenic Formulae of the Salmonella serovars. 9th ed Paris: World Health Organization Collaborating Centre for Reference and Research on Salmonella, Institut Pasteur; 2007.
  • Hong Y, Liu T, Hofacre C, Maier M, White DG, Ayers S, Wang L, Maurer JJ. A restriction fragment length polymorphism-based polymerase chain reaction as an alternative to serotyping for identifying Salmonella serotypes. Avian Diseases 2003; 47:387-395.
  • Kilger G, Grimont PAD. Differentiation of Salmonella phase 1 flagellar antigen types by restriction of the amplified fliC gene. Journal of Clinical Microbiology 1993; 31:1108-1110.
  • Kisiela D, Kuczkowski M, Kiczak L, Wieliczko A, Ugorski M. Differentiation of Salmonella Gallinarum biovar Gallinarum from Salmonella Gallinarum biovar Pullorum by PCR-RFLP of the fimH gene. Journal of Veterinary Medicine 2005; 52:214-218.
  • Kwon JH, Park KY, Yoo HS, Park JY, Young HP, Kim SJ. Differentiation of Salmonella enteric serotype gallinarum byotipe pullorum from byotipe gallinarum by analysis of phase 1 flagellin C gene (fliC). Journal of Microbiological Methods 2000; 40: 33-38.
  • Li J, Nelson K, Mcwhorter AC, Whittam TS. Recombinational basis of serovars diversity in Salmonella enterica. Proceedings of the National Academy of Science 1994; 91:2552-2556.
  • Li J, Smith NH, Nelson K, Crichton PB, Old DC, Whittam TS, Selander RK. Evolutionary origin and radiation of the avian-adapted non-motile Salmonellae. Journal of General Microbiology 1993; 38:129-139.
  • Olsen JE, Skov MN, Christensen JP, Bisgaard M. Genomic lineage of Salmonella enteric serotype Gallinarum. Journal of Medical Microbiology 1996; 45:413-418.
  • Pomeroy BS. Fowl typhoid. In: Hofstad, M.S. Barnes, H.J. Calneck, B.W., Reid, W.M., Yoder, H.W. Diseases of poultry. 8th ed. Ames: Iowa State University Press; 1984. p.79-90.
  • Poppof MY, Le Minor L. Antigenic formulas of the Salmonella serovars, 7th rev. Paris: WHO Collaborating Centre for Reference and Research on Salmonella, Institut Pasteur; 1992.
  • Ribeiro SAM, Paiva JB, Zotesso F, Lemos MVF, Berchieri Jr A. Molecular differentiation between Salmonella enterica subsp enterica serovar Pullorum and Salmonella enterica subsp enterica serovar Gallinarum. Brazilian Journal Microbiology 2009; 40:184-188.
  • Selander RK, Smith NH, Beltran P, Ferris KE, Kopecko DJ, Rubin FA. Molecular evolutionary genetics of the cattle-adapted serovar Salmonella Dublin. Journal of Bacteriology 1992; 172:603-609.
  • Shivaprasad HL. Pullorum disease and fowl typhoid. Revue Scientifique et Technique de Office International des Epizooties 2000; 19:405-424
  • Smith NH, Beltran P, Selander RK. Recombination of Salmonella phase 1flagellin genes generates new serovars. Journal of Bacteriology 1990; 172:2209-2216.
  • Soumet C, Ermel G, Fach P, Colin P. Evaluation of different DNA extraction procedures for the detection of Salmonella from chicken products by polymerase chain reaction. Letters in Applied Microbiology 1994; 19:294-298.
  • Wei L, Joys TM. Covalent structure of three phase-1 flagellar filament proteins of Salmonella. Journal of Molecular Biology 1985; 186:791-803.
  • Wray C, Davies Rh, Corkish JD. Enterobacteriaceae. In: Jordan FTW, Pattison, M. Poultry diseases. 4th ed. London: Saunders Company; 1996. p 9-43.
  • Zinder ND, Ledeberg J. Genetic exchange in Salmonella. Journal of Bacteriology 1952; 64:679-699.
  • Angelo Berchieri Junior
    FCAV-Unesp Departamento de Patologia Veterinária
    Via de acesso Paulo Donato Castellane, s/n - Bairro Rural
    14.884-900. Jaboticabal, SP, Brasil
    E-mail:
  • Publication Dates

    • Publication in this collection
      17 Mar 2010
    • Date of issue
      Dec 2009

    History

    • Accepted
      Oct 2009
    • Received
      Aug 2009
    Fundação de Apoio à Ciência e Tecnologia Avicolas Rua Barão de Paranapanema, 146 - Sala 72, Bloco A, Bosque., CEP: 13026-010. , Tel.: +55 (19) 3255-8500 - Campinas - SP - Brazil
    E-mail: revista@facta.org.br