Effects of Heat Stress on Expression of Heat Shock Proteins in the Small Intestine of Wenchang Chicks

ABSTRACT

In this study, immunohistochemistry and real-time fluorescent-based quantitative PCR were used to evaluate the expression of heat shock protein (HSP) 60, HSP70, and HSP90 in the small intestine of Wenchang chicks. Compared with the control group (CK), the positive expression of HSP60 and HSP60 mRNA in the heat stress group (HS) were initially higher and subsequently lower in the duodenum (p<0.01). In the HS jejunum, the levels of HSP60 were higher (p<0.01) and the HSP60 mRNA was lower (p<0.05). Whereas the levels of HSP60 in the HS ileum were higher (p<0.05) and then lower (p<0.01), and the HSP60 mRNA was higher (p<0.01). The levels of HSP70 were higher (p<0.01) and the HSP70 mRNA was lower in the duodenum (p<0.05), while the expression of both HSP70 and HSP70 mRNA was higher in the jejunum (p<0.01) and the ileum (p<0.05) of the HS. In the HS duodenum the levels of HSP90 were lower and then higher (p<0.01), and the HSP90 mRNA was higher (p<0.01). The expression of both HSP90 and HSP90 mRNA was higher in the HS jejunum (p<0.05). The levels of HSP90 were lower while the HSP90 mRNA was higher in the HS ileum (p<0.01). These results indicate that heat stress disturbed the expression of HSP60, HSP70, and HSP90 in the small intestine of chicks.

Keywords:
Heat stress; heat shock proteins; small intestine; Wenchang chicks

INTRODUCTION

The temperature-regulating system is not fully developed in chicks. The body surface of chicks is covered with feathers and contains no sweat glands. Excessive heat in the environment can therefore induce a heat stress reaction leading to adverse effects in chicks. Previous studies have shown that a high-temperature environment causes heat stress and hinders the normal development of chicks, manifesting in damage to the thymus (Liang, et al., 2016), bursa of fabricius (Chen, et al., 2016), and small intestine (Chen, et al., 2015). Heat stress also disrupts the expression of the mitogen-activated protein kinases (MAPKs) signaling pathway (Li, et al., 2020) and the GABAergic system (Liang, et al., 2019) on the hypothalamic-pituitary-gonadal (HPG) axis in chicks. The intestine plays important roles in digestion, nutrient absorption, and substance transport in the body and is particularly sensitive to heat stress. A number of reports have shown that heat stress can cause damage to intestinal morphology and structure; impair intestinal digestion and absorption capacity, antioxidant capacity and intestinal mucosal barrier function (Yu, et al., 2019). As a result, intestinal health is affected, thus hindering the normal growth and development of poultry. Heat shock proteins (HSPs) act as molecular chaperones in the body; heat stress stimulates the expression of HSPs in poultry to varying degrees (Yu, et al., 2019). Studies have shown that acute heat stress causes a sharp decrease in the total cell protein synthesis of chickens. When HSPs synthesis continues to increase, the total protein content of cells gradually increases, suggesting that HSPs have protective and reparative effects on cells in a high-temperature environment (Xie, et al., 2018). The current study examined the effects of heat stress on the expression of HSPs in the small intestines of Wenchang chicks.

HSP60 is a typical mitochondrial protein in eukaryotes. Under stress conditions, HSP60 may bind to mitochondrial membrane proteins to protect the mitochondrial membrane potential and prevent apoptosis in cells (Tangw et al., 2018).

HSP70 is the most common heat shock protein, which protects organisms from the toxic effects of heating. The expression of HSP70 is an endogenous mechanism of adaptive stress in living cells (Hao, et al., 2012; Gu, et al., 2012).

The N-terminal structure of HSP90 contains an ATP binding pocket, which enables HSP90 to have ATPase activity (Prodromou, et al., 1997). As an ATP-dependent molecular chaperone, HSP90 relies on binding to ATP and the hydrolysis of ATP by the N-terminal to perform its function (Meyer, et al., 2003).

MATERIALS AND METHODS

Experimental animals

One hundred one-day-old healthy male Wenchang chicks were purchased from Tanniu Chicken (Hainan Province, China) and were randomly divided into 2 groups: a control group (CK) and a heat stress group (HS). There was no significant difference in bodyweight between all chicks. All chicks had free access to feed and water, and the feed was formulated to meet the nutrient level suggested by the NRC (1994).

From 2 to 6 weeks of age, chicks in the HS were exposed to heat stress (40.00 ± 0.50°C) for 2 hours from 12:00 pm to 14:00 pm every day, beginning at 2 weeks of age; chicks in the CK were exposed to room temperature (28.69 ± 0.18 °C) during the same time frame. After heat stress, chicks were returned to their cages for routine feeding.

Sample collection

At 2 to 6 weeks of age, 6 chicks from each group were randomly selected after the completion of heat stress treatment and euthanized by asphyxiation, followed by immediate dissection of the duodenum, jejunum, and ileum tissues. Some of the tissues were fixed with Boiun’s fixative for immunohistochemistry (IHC) (n=6). The remaining tissues were stored overnight at 4°C in 300 µl RNAstore sample preservation solution (Tiangen Biochemical Technology, Beijing, China) and then removed from the solution and stored at -20 °C for quantitative PCR (n=6). This experiment was approved by the Ethics Committee of Animal Protection Center of Hainan Normal University.

Expression of HSPs in the small intestine detected by immunohistochemistry

The small intestine tissues were paraffin-embedded and sectioned into 5 µm-thick slices and then baked at 50 °C for 2 hours prior to IHC staining using a immunohistochemistry kit for rabbit (mouse) primary antibody (Shanghai Yisheng Biotechnology, Shanghai, China), according to the manufacturer’s instructions. The primary antibodies used for IHC were diluted in 1× PBS (anti-HSP60, 1:100, catalog number: orb67 315; anti-HSP70, 1:8,000, catalog number: orb67306; and anti-HSP90, 1:400, catalog number: orb86613; Biorbyt, Cambridge, United Kingdom). Tissue sections incubated with PBS instead of primary antibodies were used as negative control. Image Pro Plus 6.0 software were used to analyze the mean integrated optical density (mean IOD) of HSP60, HSP70 and HSP90 positive reactions.

Expression of HSPs in the small intestine determined by reverse transcription fluorescent-based quantitative PCR (qPCR)

An RNAprep pure kit, purchased from Tiangen Biochemical Technology was used for the extraction of total RNA from small intestine. The FastKing cDNA first-strand synthesis kit (Tiangen Biochemical Technology) was used to synthesize cDNA, and the SYBR Green SuperReal Fluorescence Quantitative Premix reagent (Tiangen Biochemical Technology) was used for qPCR. A 20 µl qPCR reaction system was prepared on ice for each sample, containing 10 µl 2× SuperReal PreMix Plus, 0.6 µL 10 µM forward primer, 0.6 µl 10 µM reverse primer, 1 µl cDNA template, and 7.8 µl RNase-free double-distilled water. The reaction conditions were 95°C for 15 min; 40 cycles of 95°C for 10 s and 60°C for 30 s; followed by 95°C for 1 min, 60°C for 30 s, and 95°C for 30 s. The 2-week-old chicks’ data from the CK were used as the reference to calculate the relative expression of the target genes using the 2^−ΔΔCt method.

Table 1 shows the primer sequences used in the qPCR and synthesized by Sangon Biotech (Shanghai, China). β-actin was used as the internal reference.

Table 1
Primer Information.

Target gene	Sequence number	Primer sequence (5?-3?)	Product size (bp)
HSP60 Xie, et al., 2018	NM_001012916	F: GGCTATGATGCGATGCTTGG R: ACTACTGCTTCTGCCGTTGA	134
HSP70 Zhou, et al., 2016	NM_001006685	F: CGGGCAAGTTTGACCTAA R: TTGGCTCCCACCCTATCTCT	250
HSP90 Xie, et al., 2018	NM_001109785	F: TCCTGTCCTCTGGCTTTA R: AGGTGGCATCTCCTCGGT	143
β-actin Zhou, et al., 2016	L08165	F: CACCACAGCCGAGAGAGAAAT R: TGACCATCAGGGAGTTCATAGC	135

Statistical analysis

GraphPad Prism 8 software (GraphPad Software, San Diego, CA) was used to perform ANOVA analysis of the obtained data. The data are presented as mean ± SEM. p<0.05 was considered statistically significant, and p<0.01 was considered extremely significant.

RESULTS AND ANALYSIS

Expression of HSPs in the small intestine of chicks

The IHC staining results showed HSP60 positive reactions that were brown in color and present in the intestinal mucosal epithelium and crypts. Most of the HSP60 positive reactions were distributed in the crypts (Fig. 1A). As shown in Fig. 1B, compared with the CK: the expression of HSP60 in the HS duodenum was lower at 2 weeks of age (p<0.01), but higher at 3, 5, and 6 weeks of age (p<0.01); HSP60 expression in the HS jejunum was higher at 3 and 6 weeks of age (p<0.01); and HSP60 expression in the HS ileum was higher at 3 (p<0.05) and 4 (p<0.01) weeks of age and lower at 5 and 6 weeks of age (p<0.05).

Figure 1
Effects of heat stress on HSP60 expression in the intestine of chicks.

Immunohistochemistry showed HSP70 positive reactions that were brown in color and present in the intestinal mucosal epithelium and crypts (Fig. 2A). As shown in Fig. 2B, compared with the CK: the expression of positive reactions in the duodenum, jejunum, and ileum of the HS were increased at 4, 6, and 6 weeks of age, respectively (p<0.01).

Figure 2
Effects of heat stress on HSP70 expression in the intestine of chicks.

Immunohistochemistry showed HSP90 positive reactions that were brown in color and present mostly in the intestinal mucosal epithelium and to a lesser extent in the crypts (Fig. 3A). As shown in Fig. 3B, compared with the CK: the HSP90 expression in the HS duodenum was lower at 2 weeks of age (p<0.01) and higher at 5 and 6 weeks of age (p<0.01); HSP90 expression in the HS jejunum was higher at 5 and 6 weeks of age (p<0.01); and lower at 3 and 5 weeks of age (p<0.01) in the HS ileum.

Figure 3
Effects of heat stress on HSP90 expression in the intestine of chicks.

Expression of HSP mRNAs in the small intestine of chicks

The qPCR results showed that compared with the CK (Fig. 4): HSP60 mRNA expression in duodenum of the HS was lower at 2 weeks of age and higher at 5 weeks of age (p<0.01); HSP60 mRNA expression in the HS jejunum was lower at 3 weeks of age (p<0.01), but higher at 5 weeks of age (p<0.05); and higher at 5 weeks of age in the HS ileum (p<0.01).

Figure 4
Effects of heat stress on the expression of HSP60 mRNA in the intestine of chicks.

In Fig. 5, the qPCR results showed that compared with the CK: HSP70 mRNA expression in the HS duodenum was lower at 3 weeks of age (p<0.05); but higher at the 4 weeks of age in the jejunum (p<0.01) and ileum (p<0.05) of HS.

Figure 5
Effects of heat stress on the expression of HSP70 mRNA in the intestine of chicks.

As shown in the qPCR results in Fig. 6, compared with the CK: HSP90 mRNA expression in the HS duodenum was higher from 4 to 6 weeks of age (p<0.01); in the HS jejunum was higher at 2 (p<0.05), 4 (p<0.01), 5 (p<0.05), and 6 (p<0.01) weeks of age; and higher at 4 and 6 weeks of age (p<0.01) in the HS ileum.

Figure 6
Effects of heat stress on the expression of HSP90 mRNA in the intestine of chicks.

DISCUSSIONS

Impacts of heat stress on the expression of HSP60 in the small intestine

HSP60 is expressed to various degrees in different tissues of broilers under high temperature. Heat stress causes myocardial damage, promotes the release of HSP60 from the mitochondria into the cytoplasm, and triggers the immune response of the body (Hoymans, et al., 2008). A previous study showed that heat stress also significantly increases the HSP60 level in the heart, but decreases in the liver, suggesting that HSP60 expression is related to tissue damage under heat stress (Yan, et al., 2009).

Results of the current study showed that the expression of HSP60 in the duodenum of the HS was significantly higher than in the CK. A study by Song et al. (2016) also indicated that acute heat stress may cause mitochondrial damage, which may induce a significant increase in the expression of HSP60 to maintain a steady mitochondrial membrane potential (Tang, et al., 2018). In addition, HSP60 has ATP binding activity (Itoh, et al., 1995). Heat stress significantly reduces the ATP content in the jejunum mucosa of broilers (Yang, et al., 2018), reducing the binding between HSP60 and ATP, resulting in HSP60 overexpression. We had noticed that the protein expression of HSP60 was lower at 2 weeks of age, and then higher at 3, 5, and 6 weeks of age, but there was no significant at 4 weeks. The current study is difficult to explain this phenomenon, which will be the direction of our further research.

The HSP60 expression in the jejunum of the HS was higher than in the CK; while the HSP60 mRNA expression of the HS was significantly less than that of the CK. A study by Werner et al. (2007) showed that the expression of HSP60 in the livers of heat-stressed green sturgeon larvae was lower than in the livers of normal larvae, and was similar to the expression of HSP60 in the livers of heat-stressed broilers in other studies (Tang, et al., 2018; Xie, et al., 2018; Yan, et al., 2009). Continuous heat stress caused serious damage to the structure and integrity of the small intestine, which exceeded the ability of the small intestine to withstand the negative effect. By this time, the damage to the small intestine was irreversible. Moreover, the consumption of HSP60 in the body might be greater than the amount of HSP60 synthesized by heat stress. When the HSP60 level was lower than normal, the ability of the body to withstand the high-temperature environment was significantly reduced (Huckriede, et al., 1995).

As the heat stress continued, the HSP60 expression in the HS ileum was first higher and then lower compared with the CK. Numerous studies have shown that excessively high ambient temperature often causes structural damage, such as deepening of the small intestinal crypts and exposure of the lamina propria (Li, 2013; Liu, et al., 2016; Song, et al., 2018), which may induce strong expression of HSP60 to protect cells. In the late stage of heat stress, the structural damage to small intestinal tissue was exacerbated and the HSP60 expression began to decline. The HSP60 mRNA expression was significantly higher in the HS compared with the CK. During heat stress, HSP60 is gradually consumed as a mitochondrial chaperone. When the consumption of HSP60 in the body was more than the synthesis due to heat stress stimulation, the protein level inevitably decreased, and negative feedback increased mRNA expression to synthesize more protein to meet the higher HSP60 demand.

Impacts of heat stress on the expression of HSP70 in the small intestine

Heat stress stimulates oxygen free radicals to bind with death receptors to activate mitochondrial signaling pathways and induce apoptosis. High expression of HSP70 significantly improves the heat tolerance of cells, thereby inhibiting the generation of oxygen free radicals, reducing the expression levels of death receptors as well as the upstream and downstream mitochondrial cascade signal, thereby inhibiting cell death induced by heat stress (Peng, et al., 2019).

The experimental results showed that heat stress significantly increased the expression of HSP70 and reduced the expression of HSP70 mRNA in the duodenum. Heat stress destroys the tissue structure of small intestinal villi and the duodenum is the most severely damaged (Wang, et al., 2015), which stimulates the HSP70 expression in the duodenum and requires more HSP70 mRNA to synthesize protein, thereby reducing the HSP70 mRNA level.

Studies have shown that HSP70 alleviates the structural damage and oxidative damage of the intestinal mucosa induced by heat stress (Hao, et al., 2012; Gu, et al., 2012), thereby increasing the HSP70 consumption while reducing the protein content. The current study showed that HSP70 mRNA expression in the jejunum of chicks is similar to the expression in the jejunum mucosa of rats and pigs (Feng, et al., 2014). Heat stress simultaneously enhances the expression of HSP70 mRNA in the jejunum mucosa and activates the ERK signaling pathway in the intestine, suggesting that HSP70 may protect the intestine by activating the ERK signaling pathway under heat stress conditions (Feng, et al., 2014).

Compared with the CK, the expression of HSP70 mRNA in the ileum HS was higher during the early stage of heat stress. This may be a result of heat stress aggravating the metabolic burden of chicks, thus requiring more HSP70 to alleviate the heat stress damage, resulting in an increase in HSP70 mRNA translation, leading to relatively higher levels of HSP70. The HSP70 expression increased at the later stage of heat stress. As the heat stress continued, the negative impact on the intestines intensified and induced high HSP70 expression, which significantly increased the activity of digestive enzymes (Hao, et al., 2012), while inhibiting lipid peroxidation of the intestinal mucosa. These results indicate that HSP70 relieved the oxidative damage of heat stress to the intestinal mucosa of broilers by improving the antioxidant capacity of the body (Gu, et al., 2012).

Impacts of heat stress on the expression of HSP90 in the small intestine

A high-temperature environment stimulates a change in the expression of HSP90 in broilers. HSP90 mRNA in the hearts and livers of broilers was found to increase significantly after 2 hours of heat shock, but the HSP90 mRNA in the heart decreased rapidly when the duration of heat stress was prolonged (Yu, et al., 2009). In addition, expression of HSP90 in the hearts, livers, and kidneys of broilers increased after 2 hours of high-temperature exposure (Lei, et al., 2009).

In this study, compared with the CK, the expression of HSP90 in the duodenum and jejunum of the HS was significantly higher. A previous study also showed that the expression of HSP90 rapidly increased in the intestinal mucosa of silky fowls during the early stage of heat stress, whereas during the late stage of heat stress, its expression decreased to a normal level and then rebounded (Liu, et al., 2016). These results indicate that the heat tolerance of the small intestines of broilers is time-limited and that the body induces HSP90 expression to alleviate heat stress. The tolerance of normal cells to an excessively high-temperature environment is significantly stronger than that of cells with HSP90 gene defects. High ambient temperature can induce the synthesis of HSP90 mRNA and HSP90 protein to protect cells (Lei, et al., 2009). In this study, the HSP90 expression in the ileum was different than in the duodenum and jejunum. The HSP90 expression in the ileum of the HS was significantly lower than in the CK, suggesting that the excessively high-temperature environment caused serious damage to the structure and function of the ileum and aggravated cellular metabolism. What’s more, heat stress accelerates metabolism in the body, thus more ATP was likely required, which might have led to a continuation of HSP90 consumption. HSP90 protein expression is reduced when the consumption of HSP90 is greater than the synthesis of HSP90.

A previous study showed that the level of HSP90 mRNA in both jejunum and ileum of chickens was significantly increased after heat stress exposure (38-39ºC,8 h per day for 5 days) (Varasteh, et al., 2015). In this study, the expression of HSP90 mRNA in the small intestine of the HS was increased to different degrees compared with the CK. A study by Tamaki et al. (2011) showed that inhibition of HSP90 expression weakened the cytoprotective ability of IEC-6-90 cells, suggesting that HSP90 may play a role in protecting small intestinal epithelial cells from damage. Furthermore, heat-stress -induced high expression of HSP90 helped the small intestine resist high-temperature damage and accelerated the transcription of HSP90 mRNA.

CONCLUSIONS

Heat stress disrupted the expression of HSP60, HSP70, and HSP90 in the small intestine of chicks in this study. The expression of HSPs in the duodenum, ileum, and jejunum was tissue-specific and time-specific, suggesting that HSPs may play different roles in physiological functions in the small intestines.

ACKNOWLEDGEMENTS

This study was supported by National Natural Science Foundation of China under grants NSFC 31060312 and 31560680. We also express our high appreciation to Jiang-Wen Wu, Hainan Normal University, for the assistance with sample collection.

REFERENCES

• Chen Z, Xie J, Hu MY, Tang J, Shao ZF, Li MH. Protective effects of ?-aminobutyric acid (GABA) on the small intestinal mucosa in heat-stressed Wenchang chicken. Journal of Animal & Plant Sciences 2015;25(1):78-87.
• Chen Z, Zhou YW, Liang C, Jiang YY, Xie LJ. Effects of ?-aminobutyric acid on the tissue structure, antioxidant activity, cell apoptosis, and cytokine contents of bursa of fabricius in chicks under heat stress. Archives Animal Breeding 2016;59(1):97-105.
• Feng YJ. Effect of heat stress on intestinal structure and function and its repairing mechanism in pig and rat [dissertation]. Beijing (CHN): China Agricultural College; 2014.
• Gu XH, Hao Y, Wang XL. Overexpression of heat shock protein 70 and its relationship to intestine under acute heat stress in broilers: 2. Intestinal oxidative stress. Poultry Science 2012;91(4):790-799.
• Hao Y, Gu XH, Wang XL. Overexpression of heat shock protein 70 and its relationship to intestine under acute heat stress in broilers: 1. Intestinal structure and digestive function. Poultry Science 2012;91(4):781-789.
• Hoymans VY, Bosmans JM, Herck PLV, Ieven MM, Vrints CJ. Implications of antibodies to heat-shock proteins in ischemic heart disease. International Journal of Cardiology 2008;123(3):277-282.
• Huckriede A, Heikema A, Sjollema K, Briones P, Agsteribbe E. Morphology of the mitochondria in heat shock protein 60 deficient fibroblasts from mitochondrial myopathy patients. Effect of stress conditions. Virchows Archiv 1995;427(2):159-165.
• Itoh H, Kobayashi R, Wakui H, Komatsuda A, Ohtani H, Miura AB, et al. Mammalian 60-kDa stress protein (Chaperonin Homolog) identification, biochemical, and location. Journal of Biological Chemistry 1995;270(22):13429-13435.
• Lei L, Yu J, Bao ED. Expression of heat shock protein 90 (HSP90) and transcription of its corresponding mRNA in broilers exposed to high temperature. British Poultry Science 2009;50(4):504-511.
• Li QH, Yu ZQ, Chen Z. Effect of heat stress on mitogen-activated protein kinases in the hypothalamic-pituitary-gonadal axis of developing Wenchang chicks. Poultry Science 2020;99(1):567-577.
• Liang C, Xie XZ, Zhou YW, Jiang YY, Xie LJ, Chen Z. Effects of ?-aminobutyric acid on the thymus tissue structure, antioxidant activity, cell apoptosis, and cytokine levels in chicks under heat stress. Czech Journal of Animal Science 2016;61(12):539-550.
• Liang W, Lu BB, Liang C, Yu ZQ, Xie XZ, Chen Z. Effects of heat stress on the development of GABAergic neurons in the HPG axis of Wenchang chicks. Brazilian Journal of Poultry Science 2019;21(2):eRBCA-2018-092.
• Liu L, Fu CX, Yan ML, Xie HB, Li S, Yu QF, et al. Resveratrol modulates intestinal morphology and HSP70/90, NF-Kb and EGF expression in the jejunal mucosa of black-boned chickens on exposure to circular heat stress. Food Function 2016;7(3):1329-1338.
• Meyer P, Prodromou C, Hu B, Vaughan C, Roe SM, Panaretou B, et al. Structural and functional analysis of the middle segment of HSP90: Implications for ATP hydrolysis and client protein and cochaperone interactions. Molecular Cell 2003;11(3):647-658.
• NRC - National Research Council. Nutrient requirements of poultry. Washington: National Academy Press; 1994.
• Peng QF, Chen L, Ma X, Peng S, Shu XF, Liu LX. Research progress on the function of heat shock protein HSP70. Gansu Animal Husbandry and Veterinary 2019;49(5):18-20.
• Prodromou C, Roe SM, O'Brien R, Ladbury JE, Piper PW, Pearl LH. Identification and structural characterization of the atp/adp-binding site in the HSP90 molecular chaperone. Cell 1997;90(1):65-75.
• Song EB, Tang S, Xu J, Yin B, Bao ED, Hartung J. Lenti-siRNA HSP60 promote bax in mitochondria and induces apoptosis during heat stress. Biochemical and Biophysical Research Communications 2016;481(1-2):125-131.
• Song ZH, Cheng K, Zheng XC, Ahmad H, Zhang LL, Wang T. Effects of dietary supplementation with enzymatically treated Artemisia annua on growth performance, intestinal morphology, digestive enzyme activities, immunity, and antioxidant capacity of heat-stressed broilers. Poultry Science 2018;97(2):430-437.
• Tamaki K, Otaka M, Takada M, Yamamoto S, Odashima M, Itoh H, et al. Evidence for enhanced cytoprotective function of HSP90-overexpressing small intestinal epithelial cells. Digestive Diseases Science 2011;56(7):1954-1961.
• Tang S, Zhou S, Yin B, Xu J, Di LJ, Zhang JB, et al. Heat stress-induced renal damage in poultry and the protective effects of HSP60 and HSP47. Cell Stress Chaperones 2018;23(5):1033-1040.
• Varasteh S, Braber S, Akbari P, Garssen J, Fink-Gremmels J. Differences in susceptibility to heat stress along the chicken intestine and the protective effects of galacto-oligosaccharides. PLoS One 2015;10(9):e0138975.
• Wang Y, Dong HY, Liu Y, Ma Y, Sun BD, Luan WM, et al. Effect of heat stress on morphology of intestine and mast cells in goose. Chinese Journal of Veterinary Medicine 2015;51(5):12-14.
• Werner I, Linares-Casenave J, Eenennaam JPV, Doroshov SI. The Effect of temperature stress on development and heat shock protein expression in larval green sturgeon (Acipenser Microstris). Environmental Biology of Fishes 2007;79(3-4):191-200.
• Xie YX, Shi Y, Huang LH, Zhang SS, Zhang JQ. Effects of acute heat/cold stress on the expression of HSPs in liver and heart of broiler. China Poultry 2018;40(1):7-11. Chinese.
• Yan JY, Bao ED, Yu JM. Heat shock protein 60 expression in heart, liver and kidney of broilers exposed to high temperature. Research in Veterinary Science 2009;86(3): 533-538.
• Yang SX, Xian P. Guan ZG. Effects of supplementation of N-acetylcysteine on growth performance, intestinal energy and antioxidation status, and intestinal morphology of broilers under heat-stressed. China Feed 2018;(10):19-24.
• Yu JM. The mechanism of heat shock protein expression and tissue damages in heat stressed broilers [dissertation]. Nanjing (CHN): Nanjing Agricultural University; 2009.
• Yu ZQ, Wen J, Chen Z. Overview of effects of heat stress on structure and function of intestine in poultry. Progress in Veterinary Medicine 2019;40(9):118-121.
• Zhou YW, Liang C, Jiang YY, Chen Z. Effects of GABA on expressions of IL-6, TNF-? and HSP70 mRNA in bursa of fabricius of chicks under heat stress. China Poultry 2016;38(10):27-31.

Publication Dates

• Publication in this collection
  10 Sept 2021
• Date of issue
  2021

History

• Received
  01 Dec 2020
• Accepted
  05 Mar 2021