Omission and Resupply of Nitrogen Affect Physiological and Enzymatic Activities and the Gene Expression of Eucalypt Clones

Fernandes, Loane Vaz; Moreira, Lílian Angélica; Barros, Nairam Félix de; Ribeiro, Cléberson; Neves, Júlio César Lima

doi:10.1590/18069657rbcs20150464

home Sumário navigate_before Anterior Atual Seguinte navigate_next

home Sumário

Division 3 - Soil Use and Management • Rev. Bras. Ciênc. Solo 40 • 2016 • https://doi.org/10.1590/18069657rbcs20150464 linkcopy

Omission and Resupply of Nitrogen Affect Physiological and Enzymatic Activities and the Gene Expression of Eucalypt Clones

Authorship SCIMAGO INSTITUTIONS RANKINGS

ABSTRACT:

The mineral nutrient uptake of plants in the field occurs in pulses, due to variations in the substance concentrations at the root surface. The fluctuations in nutrient supply probably induce changes in the plant, which are to date unknown for Eucalyptus. This study evaluated these changes in plant growth, nutritional status, photosynthesis, and gene expression, which can serve as biomarkers of the nitrogen status, of four eucalypt clones exposed to N omission and resupply. A greenhouse experiment with four Eucalyptus clones was installed, and after initial growth exposed to N omission for 21 d, followed by N resupply in nutrient solution for 14 d. Nitrogen omission decreased the total N and photosynthetic pigments, net photosynthesis and photochemical dissipation, and increased enzyme activity especially in leaves and the gene expression in leaves and roots. Nitrogen resupply decreased these variations, indicating recovery. The total N concentration was highly and significantly correlated with net photosynthesis, enzyme activity, expression of genes GS2;1 and Gln1;3 in the leaves and AMT1;2 in the roots, contents of chlorophyll a and b, and photochemical energy dissipation. The enzymes GS and NR in the leaves and the genes AMT1;2, GS2;1 and Gln1;3 proved to be sensitive N indicators.

Keywords: nutritional efficiency of plants; fertilization and nutrition of perennial crops; plant tolerance to stress

Gene	Accession NCBI⁽¹⁾	Fw/Rv 5′-3′ Primers
TIP2;1	AT3G16240.1	GATCCATCTGGGCTAGTGGC
NIA1	AT1G77760	TGTCCCAATTCATCACCGGG
GLn1;3	AT3G17820.1	GTGCAGACAAGGCTTTTGGG
GS2;1	AT1G66200.2	GATCCTTTCCGAGGTGGCAA
NRT1;1	AT1G12110	TGGTCCCGCAGTTCTTCTTC
AMT1;2	AT1G64780	TCATGCTCACCAACGTCCTC

Week	386		I-144 I-042				VM-01
	Control	N	Control N Control N				Control	N
Dry matter mass (g per pot)
5	112	56**	85 62^83 67^				75	73 ns
Total N concentration - Diagnostic leaf (g kg^-1)
1	32.94	18.97^**	34.72	20.61^**	33.36	21.63^**	28.90	17.76^**
3	33.70	12.87^**	30.46	15.22^**	33.94	14.32^**	33.77	16.20^**
4	30.94	24.56^**	30.82	23.28^**	29.44	22.82^**	32.01	24.29^**
5	34.26	35.72^*	33.34	36.62^**	33.68	37.46^**	34.42	36.50^*
Total N concentration - Old leaf (g kg^-1)
3	27.09	15.45^**	27.78 15.90^**26.85			14.62^**	26.62	16.42^**
5	25.77	20.96^**	23.82 20.02^**26.91			22.33^**	23.68	21.22^**
			N content (g per pot)
5	2.27	1.05^**	1.82 1.12^**1.93			1.31^**	1.69	1.38^**

	386	I-144 I-042	VM-01
		NUpE (mg g^-1)
Control	78.3	81.4 104.0	125.6
N	76.1^ns	67.6^71.3^	93.5^**
		NUsE (g² mg^-1)
Control	5,579	3,982 3,573	3,364
N	2,967^**	3,414^**3,436^ns	3,805^**
		NRetI (%)
	43.0 a	42.7 a 45.5 a	38.3 b

Clone	Week	A		Ŷ_II
Clone	Week	Control	N	Control	N
------------------------------------- µmol m^-2 s^-1 -----------------------------------------
386 1	20.2	14.7^**	0.27	0.17^**
I-144	24.4	12.9^**	0.26	0.24^**
I-042	20.6	14.2^**	0.31	0.15^**
VM-01	19.2	14.5^**	0.25	0.17^**
386 2	18.0	7.9^**	0.22	0.09^**
I-144	16.0	8.4^**	0.25	0.11^**
I-042	16.7	7.9^**	0.22	0.09^**
VM-01	17.8	10.1^**	0.33	0.17^**
386 3	17.0	7.2^**	0.19	0.11^**
I-144	17.3	7.6^**	0.22	0.11^**
I-042	17.5	9.1^**	0.24	0.11^**
VM-01	15.6	9.0^**	0.21	0.09^**
386 4	17.5	12.4^**	0.18	0.18 ^ns
I-144	18.3	13.6^*	0.19	0.17 ^ns
I-042	17.8	15.8^**	0.19	0.15^**
VM-01	14.6	15.0^ns	0.17	0.16 ^ns
386 5	20.6	21.1 ^ns	0.22	0.22 ^ns
I-144	19.9	23.2 ^ns	0.21	0.21 ^ns
I-042	20.6	19.6^**	0.2	0.26^**
VM-01	15.8	20.3^**	0.19	0.21^**

Clone	Week	Chlorophyll a		Chlorophyll b		Carotenoids		Chlorophyll a/b
Clone	Week	Control	N	Control	N	Control	N	Control		N
			--------------------------------------------------- mg g^-1 ---------------------------------------------------------				N	Control
386	1	1.83	1.01^**	0.78	0.45^**	Control	0.38	0.33^ns	2.36	2.23^ns
I-144		2.57	1.44^**	0.74	0.56^**	0.57	0.43^**	3.47	2.55^**
I-042		2.35	1.85^**	0.71	0.66^*	0.57	0.52^*	3.29	2.82^**
VM-01		2.02	1.29^**	0.67	0.48^**	0.50	0.36^**	3.00	2.69^**
386	3	2.18	1.19^**	0.53	0.20^**	0.55	0.35^**	4.13	5.90^**
I-144		2.72	0.85^**	0.66	0.12^**	0.68	0.33^**	4.14	6.95^**
I-042		2.50	1.29^**	0.70	0.18^**	0.61	0.33^**	3.60	7.29^**
VM-01		2.18	1.06^**	0.53	0.17^**	0.55	0.33^**	4.08	6.25^**
386	4	2.25	1.47^**	0.77	0.45^**	0.57	0.39^**	2.93	3.27^*
I-144		2.39	1.39^**	0.74	0.37^**	0.63	0.36^**	3.21	3.73^*
I-042		2.22	1.09^**	0.70	0.33^**	0.52	0.32^**	3.17	3.32 ^ns
VM-01		2.29	1.17^**	0.54	0.31^**	0.52	0.33^**	4.26	3.78^**
386	5	2.27	2.47^*	0.76	0.83^**	0.55	0.55^ns	3.00	2.96 ^ns
I-144		2.25	2.45^*	0.77	0.80^*	0.57	0.54^ns	2.95	3.08 ^ns
I-042		2.34	2.26^ns	0.78	0.75^ns	0.48	0.49 ^ns	3.02	3.02 ^ns
VM-01		1.99	1.84^*	0.66	0.56^*	0.44	0.43 ^ns	3.00	3.26^*

Clone	Week	Leaf			Root
		NR		GS		NR		GS
		Control	N	Control	N	Control	N	Control	N
			---------------- μmol mg-1 min-1 ----------------			Control	---------------- nmol mg-1 min-1 ----------------
386	1	1.06	6.96^**	43.0	341.2^**	0.28	1.06^**	374.7	485.0^**
I-144		1.01	14.15^**	88.2	1186.3^**	0.36	0.82^**	259.9	355.2^**
I-042		1.62	21.43^**	141.6	1486.2^**	0.82	1.55^**	217.6	285.3^**
VM-01		1.08	3.79^**	78.7	242.5^**	1.47	3.48^**	272.4	336.3^**
386	3	1.11	35.39^**	43.7	1997.2^**	0.59	1.63^**	389.5	693.4^**
I-144		1.07	45.86^**	46.4	3442.6^**	0.42	1.52^**	433.2	611.6^**
I-042		1.09	49.93^**	96.3	4262.2^**	0.58	2.42^**	357.9	630.4^**
VM-01		1.18	38.89^**	104.4	3069.1^**	1.08	3.42^**	319.7	447.9^**
386	4	1.23	48.51^**	54.0	2397.5^**	0.48	4.00^**	302.9	418.9^**
I-144		3.66	22.62^**	260.4	1675.4^**	1.14	3.33^**	126.0	129.6
I-042		4.67	54.52^**	461.6	4565.0^**	0.89	2.21^**	357.4	159.9^**
VM-01		3.52	28.67^**	159.8	1719.8^**	0.96	1.09 ^ns 158.4		332.8^**
386	5	1.39	4.67^**	56.4	182.3^**	1.18	6.56^**318.6		362.1^**
I-144		4.65	16.07^**	270.6	789.2^**	0.48	4.30^**363.9		332.9^*
I-042		4.15	4.52^ns	238.4	268.3 ^ns	1.10	1.15 ^ns 309.4		286.5^*
VM-01		3.43	3.30^ns	159.9	170.5 ^ns	1.03	1.63^**327.0		467.5^**

Clone	Week	Leaf				Root
Clone	Week	NIA1	TIP2; 1	GS2; 1	Gln1; 3	NRT1; 1	TIP2; 1	AMT2; 1	Gln1; 3
386	1	1.83 a	1.21 a	1.06 a	2.39 b	1.62 a	0.83 a	0.45 c	4.08 a
	3	1.96 a	1.24 a	1.67 a	7.72 a	1.00 b	1.26 a	1.69 a	2.16 b
	4	0.96 b	1.93 a	1.14 a	1.46 b	0.53 c	0.94 ab	1.15 b	1.34 c
	5	1.11 b	0.81 a	1.03 a	1.15 b	0.87 a	0.47 c	0.60 c	0.72 d
					1.15 b	0.87 a	0.47 c	0.60 c	0.72 d
I - 144	1	1.73 b	0.50 b	1.44 c	2.28 a	1.13 b	1.82 b	1.96 b	1.71 a
	3	3.71 b	2.51 a	8.13 a	0.95 b	1.92 a	2.43 a	3.29 a	0.84 b
	4	1.32 b	1.04 b	2.64 b	3.61 a	1.17 b	1.39 a	0.89 c	1.99 a
	5	1.30 b	0.34 c	0.98 d	1.14 b	1.22 b	0.37 a	0.41 c	1.13 b
					1.14 b	1.22 b	0.37 a	0.41 c	1.13 b
I - 042	1	1.37 a	0.73 b	2.65 a	2.32 b	2.52 a	1.19 b	2.46 a	6.54 a
	3	1.01 b	1.93 a	1.19 b	15.00 a	1.07 b	1.87 a	1.20 b	3.20 b
	4	0.97 b	0.91 b	1.40 b	1.62 c	0.69 a	1.44 b	1.10 b	1.56 c
	5	1.35 b	0.58 b	1.04 b	1.22 a	1.28 b	0.55 c	0.71 c	1.2 c
					1.22 a	1.28 b	0.55 c	0.71 c	1.2 c
VM - 01	1	3.00 a	2.37 a	4.05 a	5.00 b	2.49 a	1.71 b	4.17 b	2.65 b
	3	2.86 a	1.33 b	3.53 a	6.30 a	2.86 a	2.81 a	6.08 a	5.12 a
	4	0.92 c	1.02 b	2.72 a	2.67 c	0.90 b	1.60 b	2.10 c	1.60 c
	5	1.15 b	0.51 c	1.15 b	1.17 d	1.23 b	0.74 c	0.55 d	1.35 c

vertical_align_top file_download show_chart

more_horizclose
- image
- translate
- link
- article
- vertical_align_top
- file_download
- show_chart
- image
- translate
- link
- article

location_on

Sociedade Brasileira de Ciência do Solo Sociedade Brasileira de Ciência do Solo, Departamento de Solos - Edifício Silvio Brandão, s/n, Caixa Postal 231 - Campus da UFV, CEP 36570-900 - Viçosa-MG, Tel.: (31) 3612-4542 - Viçosa - MG - Brazil
E-mail: sbcs@sbcs.org.br

rss_feed Acompanhe os números deste periódico no seu leitor de RSS

Acessibilidade / Reportar erro

[TFN1] ^*
¹⁾ NCBI: National Center for Biotechnology Information.