Genetic analysis and preliminary mapping by BSA-seq of the CmSR gene regulating the spotted rind trait in melon (Cucumis melo L.)

Abstract

Melon (Cucumis melo L.) is an economically important horticultural crop. Spotted rind at maturity is an important appearance quality trait in melons. However, the gene controlling this trait remains unknown. In this study, the inheritance pattern of this trait was explored, and the candidate gene underlying this trait was also successfully identified. Genetic analysis showed that a single dominant gene, Cucumis melo Spotted Rind (CmSR), regulates the spotted rind trait. A preliminary genetic mapping analysis was conducted based on a BSA-seq approach. The CmAPRR2 gene was identified to be linked with the spotted rind trait and was located on the short arm of chromosome 4. It harbored two single-nucleotide mutations (chr4: 687014 G/A and chr4: 687244 C/A) in the non-spotted line ‘Yellow 2’, which may result in the alternative splicing of the transcript and an amino acid change in the respective protein, from proline to glutamine, respectively. Moreover, marker SNP687014-G/A was developed and co-segregated with the spotted rind trait. Therefore, it is speculated that the CmAPRR2 gene may be involved in the regulation of the spotted rind trait in melon. This study provides a theoretical foundation for further research on the gene regulatory mechanism of the rind color in melon.

Keywords:
Melon; rind color; CmSR; spotted rind; molecular marker

Introduction

Melon is an annual trailing herbaceous plant of the Cucurbitaceae family, and it is cultivated worldwide (Garcia-Mas et al., 2012). Because of its short cultivation period and high production capacity, melon is a highly economically important crop that can generate high revenues for the farmers and is widely preferred by the consumers. China is the leading country globally in melon planting area and yield production (Wang et al., 2020). According to statistics from FAOSTAT (http://www.fao.org/faostat/en/#data), the melon cultivation area exceeded 354,500 hectares, and more than 12.73 million tons were produced in China in 2018, accounting for around 33.85% and 46.54% of the world’s total cultivation area and yield. There are two types of melon: C. melo ssp. agrestis (thin-skinned) and C. melo ssp. melo (muskmelon) (Liu et al., 2020). The thin-skinned melons is characterized by rich aroma, delicious taste, and high sweetness. Meanwhile, it is rich in nutrients such as glucose, malic acid, vitamins, and amino acids, and therefore, it is particularly favored by consumers (Guo et al., 2022).

Rind color is the most direct indicator of the melon fruit appearance quality. Research on rind color has been undertaken on various crops, such as tomato, pepper, cucumber, and bottle gourd (Pan et al., 2013; Liu et al., 2016; Huo et al., 2023). These studies showed that rind color formation is associated with the type and content of pigments in the fruit, which mainly include carotenoids, chlorophyll, anthocyanins, and flavonoids (Tao et al., 2003; Borovsky et al., 2013). The rind color in melon fruits begins to change in the early stage of fruit development, and during the young fruit stage, it is green. As the fruit matures, its rind color undergoes significant changes, exhibiting a green, white, yellow, or orange color, and sometimes various colors mixed and reticulated (Gusmini and Wehner, 2005; Tadmor et al., 2010). An early study suggested that the green rind of melon is dominant relative to white and is genetically controlled by a single gene - Wi (Kubicki, 1962). The white rind trait in the ‘Honeydew’ variety is recessive relative to the green rind of the variety ‘Smiths Perfect cantaloupe variety’ (Hughes, 1948). Oren et al. (2019) used the dark green-colored melon accession ‘Dulce’ and light green-colored accession ‘Tam Dew’ to construct segregating populations and perform gene mapping. They identified CmAPRR2 (MELO3C003375) as the key gene that controls rind color (Oren et al., 2019). In fruits with light-colored rind, this gene mainly harbors two mutations: one SNP mutation (G→T) in exon 8 and a 13-bp insertion in exon 9. Both mutations lead to premature translation termination of the CmAPRR2 gene (Oren et al., 2019). Feder et al. (2015) used yellow and white rind melon accessions to map the genes that control the yellow rind color trait. As a result, the CmKFB gene encoding an F-box protein was identified as the key gene controlling the yellow rind color. This gene is a negative regulator of naringin chalcone accumulation (Feder et al., 2015). Similarly, using a genome-wide association study, the CmKFB gene was also identified to control the yellow rind color in melon (Gur et al., 2017). Using 635 melon accessions, Zhao et al. (2019) conducted a genome-wide association study to identify genes regulating rind color. They concluded that the green rind color trait was dominant to white and that white was dominant to yellow. Moreover, CmAPRR2 and CmKFB were significantly associated with the green and yellow rind color, respectively, and MELO3C003097 is a minor-effect regulatory gene (Zhao et al., 2019). In addition, Lv et al. (2018) carried out fine mapping of the CmSp-1 that controls the striped to non-striped trait of melon, and they located it to a 280.872 kb interval between the markers I734-2 and I757 on chromosome 2. Liu et al. (2019) used the green striped melon X010 and the white rind melon M1-113 to construct a genetic population and mapped the st3 gene, locating it to a 172.8 kb interval between markers M-4-28 and M-4-27 on chromosome 4. Although many studies have been conducted on melon rind traits, the key gene responsible for spotted rind in melon has not yet been identified.

In this study, two thin-skinned melon inbred lines, ‘Spotted 1’ and ‘Yellow 2’, differing in rind appearance, were used for the genetic study of the spotted rind trait. After constructing a genetically segregating population, a bulked-segregant analysis sequencing (BSA-seq) method was employed to locate the CmSR gene that controls the spotted rind trait of melon. Our results lay the foundation for revealing the molecular mechanisms underlying the spotted rind formation in melon.

Material and Methods

Plant material

The inbred lines ‘Spotted 1’ and ‘Yellow 2’, belonging to the melon subspecies C. melo ssp. agrestis var. momordica were used in this study and were preserved in controlled conditions. F₁ plants were obtained by crossing ‘Spotted 1’ and ‘Yellow 2’ and self-pollinated to obtain the F₂ population. All plants were grown in the Wupu Farm in Huaibei City, Anhui Province, with conventional field production management.

Assessment of fruit rind color

The rind color of individual plants of both parents and F₁ and F₂ populations was assessed on fruits 30 days after flowering (DAF). The fruits were visually inspected and photographed (^{Figure S1}).

BSA-seq analysis

DNA was extracted from 30 spotted rind plants and 30 non-spotted rind plants selected from the F₂ population using the CTAB method (Murray and Thompson, 1980). The DNA isolated from each plant was mixed in equal amounts to construct two mixed pools, Hua-pool and Huang-pool. Then, two DNA libraries were constructed and submitted to Biomarker Technologies Corporation (Beijing, China) for sequencing analysis. The raw reads were filtered to obtain clean reads. The reads filtering criteria are as follows: (1) the reads with adaptor sequences were trimmed; (2) when the number of bases containing N in the single-end reads was more than 5, the paired end reads were excluded; (3) when the number of bases with low quality (Q <= 15) in single-end sequencing read exceeds 40% of the read length ratio, paired end reads should be removed. After filtering the low-quality raw data, the clean reads from the two pools were aligned to the reference genome with Burrows-Wheeler Aligner (BWA) software (Li and Durbin, 2009). The ‘DHL92’ v3.6.1 (http://cucurbitgenomics.org/organism/18) genome was used as the reference genome. The Euclidean distance (ED) values were used to identify candidate regions related to the spotted rind (Hill et al., 2013) A flowchart of the analysis steps is shown in ^{Figure S2}.

Marker development and validation

A dCAPS marker SNP687014-G/A was designed using the online software dCAPS Finder 2.0 (http://helix.wustl.edu/dcaps/dcaps.html). Then, PCR amplification was performed. The PCR reaction mixture consisted of 25 μl of 2X PrimeSTAR Max Premix (TaRaKa, Beijing), 1 μL of forward primer (10 μM), 1 μL of reverse primer (10 μM), 2 μL of genomic DNA (50 ng/μL), and 21 μL of sterilized distilled water. The PCR cycling conditions were as follows: initial denaturation at 98 ℃ for 2 min, followed by 35 cycles for 10 s at 98 ℃, 5 s at 55 ℃, 30 s at 72 ℃, and finally, extension at 72 ℃ for 5 min. The PCR products were digested immediately with the restriction endonuclease BglII (Thermo Scientific, USA), including 25 μL PCR products, 3 μl 10×FastDigest^® green buffer, 2 μL BglII at 37 ℃ for 4 hours. The digested products were detected by 8% polyacrylamide gel electrophoresis. The primer used for this study is listed in Table 1.

Table 1 -
Primer sequences used in this study.

Primer name	Forward primer (F, 5’-3’)	Reverse primer (R, 5’-3’)	Endonuclease	Expected size
SNP687014-G/A	CCCTATCATGTGTGTGTTCTCC	TCACAATTTTTGCTAGAACTGAACAAG	Bgl II	198/174 bp

Results

Phenotypic and genetic analyses of the spotted rind

By observing the rind color of mature fruits (30 DAF), it was found that the parent ‘Spotted 1’ displayed a yellow-spotted rind (Figure 1 A ). In contrast, the parent ‘Yellow 2’ displayed a plain yellow, non-spotted rind (Figure 1 B ). Reciprocal crosses were performed using the ‘Spotted 1’ and ‘Yellow 2’ parents to explore the genetics underlying the spotted rind phenotype. The rind color of the obtained F₁ generation was the same as the parent ‘Spotted 1’, exhibiting a yellow spotted rind. This suggests that the spotted rind phenotype is controlled by dominant nuclear genes, which are dominant to the plain yellow non-spotted rind phenotype (Figure 1 C , D). Subsequently, a phenotypic observation was conducted on the rind color of 170 F₂ lines. The results showed that 124 F₂ lines carried fruits with spotted rind and 46 F₂ lines with non-spotted rind, fitting a 3:1 ratio of Mendelian segregation (χ² _0.05 = 0.38 <3.84). These results indicate that the spotted rind is a qualitative trait controlled by a single gene, temporarily termed CmSR (Cucumis melo Spotted Rind).

Figure 1 -
Rind colors of parental and reciprocal cross F₁ plants. (A), Fruit phenotype of the parent ‘Spotted 1’; (B), Fruit phenotype of the parent ‘Yellow 2’; (C), F₁ fruit phenotype (‘Spotted 1’ as the female parent, ‘Yellow 2’ as the male parent); (D), F₁’ fruit phenotype (‘Spotted 1’ as the male parent, ‘Yellow 2’ as the female parent).

Preliminary localization of the CmSR gene

To primarily determine the chromosome location of the CmSR gene that controls the spotted rind phenotype, BSA-seq based on genomic DNA re-sequencing was conducted. First, 30 F₂ plants with spotted rind and 30 F₂ plants with non-spotted rind were selected from the F₂ population. The DNA of the individual plants was extracted, and the spotted Hua-pool and non-spotted line Huang-pool were established. Subsequently, the constructed bulked DNA pools were used for genome re-sequencing using Illumina HiSeq^TM 2500, with a sequencing depth of 30X. An average of total 15.48 Gb filtered clean reads were obtained, with an average of 96.82% reads at a Q20 value, and were mapped to the reference DHL92 v3.6.1 reference genome (Castanera et al., 2020; http://cucurbitgenomics.org/organism/18). High-quality SNPs were filtered through the GATK software (V3.7) and used for association analysis according to the Euclidean distance (ED) algorithm by DeepBSA software (McKenna et al., 2010; Hill et al., 2013; Li et al., 2022). A confidence interval (99%) significantly associated with the spotted rind trait was identified at the top end of chromosome 4, located within the 0.007~3.57 Mb region, spanning 3.57 Mb (Figure 2). The preliminary BSA-seq mapping results suggested that the CmSR gene might be located in this candidate genomic region.

Figure 2 -
Manhattan plot of the CmSR gene based on ED algorithm. Each coloured dot represents an ED-based linkage value of an SNP site. The orange lines represent the fitted ED value. The blue dotted line represents the threshold for the screening of the candidate region. The window larger than the threshold at 99% confidence level was selected as the candidate interval indicating with the red arrow.

Analysis of candidate genes within the mapped interval

According to previous reports, the MELO3C003375 gene (i.e., CmAPRR2), located on the short arm of chromosome 4, is related to the rind color of melon. Therefore, its gene sequences in the parents ‘Spotted 1’ and ‘Yellow 2’ were initially examined. Gene re-sequencing results showed that the MELO3C003375 gene carried a G to A mutation and a C to A mutation on chr4: 687014 and chr4: 687244, respectively, in ‘Yellow 2’. The former is located at the last base of the fifth exon and might have caused alternative splicing of mRNA, with the latter leading to an amino acid residue change from proline (Pro) to glutamine (Gln). From this, it was speculated that MELO3C003375 (CmAPRR2) is likely the target candidate gene controlling the spotted rind phenotype in melon.

Development and validation of molecular marker

In order to clarify the relationship between the SNP variation in the CmAPRR2 gene and the spotted rind phenotype, a dCAPS maker SNP687014-G/A was developed based on the G to A mutation on the chr4: 687014 site using the online software dCAPS Finder 2.0. A mismatched base, G, was introduced at the end of the reverse primer to form a specific cleavage site for the restriction endonuclease BglII. Then, 170 F₂ individuals were genotyped by the marker SNP687014-G/A. The results showed that marker SNP687014-G/A co-segregated with the spotted rind trait (Figure 3), indicating that the variation in the CmAPRR2 gene was associated with the spotted rind trait.

Figure 3 -
The gene structure of candidate gene and development of molecular marker. (A), The sequence variations and gene structure of MELO3C003375. UTR, exons and introns are indicated by white rectangles, black rectangles and black lines, respectively. (B),Validation of SNP687014-G/A marker on parents, F₁, F₁’, and partial F₂-generation individuals. M: DL500 DNA marker; P₁: parent ‘Spotted 1’; P₂: parent ‘Yellow 2’; F₁: ‘Spotted 1’^♀× ‘Yellow 2’^♂); F₁’: ‘Spotted 1’^♂בYellow 2’^♀.

Discussion

Rind color is an important agronomic trait of melon, and its genetic control has been a focus of research. Previous studies have demonstrated that the CmAPRR2 gene located on chromosome 4 and the CmKFB gene on chromosome 10 of the melon genome are the two main functional genes that control the green and yellow color of melon rind (Oren et al., 2019; Zhao et al., 2019). Among them, the CmAPRR2 gene encodes a Golden2-like transcription factor and this gene family has been reported to regulate plastid development and chlorophyll metabolism of the fruit rind in cucumber, tomato, and other crops (Pan et al., 2013; Liu et al., 2016; Ma et al., 2021; Zhu et al., 2022; Fang et al., 2023). In this study, genetic analysis indicated that the spotted rind phenotype of melon is controlled by a single dominant gene, CmSR. Using the BSA-seq method, the gene was located on the short arm of chromosome 4, with 2 single base mutations present in the CmAPRR2 allele within the interval. The mutations may lead to alternative splicing and amino acid variation in the transcript and protein, respectively.

CmAPRR2 is homologous to the Arabidopsis pseudo-response regulator 2 (APRR2) gene, a specific plant transcription factor. It is derived from authentic response regulators (ARRs) and belongs to the pseudo-response regulator (PRR) family (Hosoda et al., 2002). A typical PRR2 protein contains a receiver-like domain (RLD) and a Golden-2-like (GLK) motif containing the Myb-like DNA binding domain (Chen et al., 2016). GLK transcription factors belong to the GARP superfamily, which plays key regulatory roles for the expression of photosynthesis-related genes in leaves and fruits and the development of chloroplasts (Riechmann et al., 2000; Hosoda et al., 2002; Waters et al., 2008; Nguyen et al., 2014). These genes were thought to be associated with increased plastid number and chlorophyll accumulation in immature fruits, resulting in white or light green rind. Studies have shown that APRR2 and its homologous genes can regulate chlorophyll content and thus affect rind color in many Solanaceae and Cucurbitaceae vegetables, such as tomato, pepper, cucumber, bitter melon, watermelon, and wax guard (Pan et al., 2013; Oren et al., 2019; Arrones et al., 2022; Tian et al., 2023). In cucumber, APRR2 controls the rind color in immature fruits (Liu et al., 2016). The premature termination of the protein encoded by this gene causes a change in the young fruit peel color from green to white (Liu et al., 2016). In melon, Xu et al. (2021) showed that in the light green parent, ‘LGR’, a G to T mutation is present in the coding region of the CmAPRR2 gene, resulting in premature termination of protein translation with most of its Myb-DNA binding domain being truncated. Therefore, it has been proposed that CmAPRR2 is the major candidate gene affecting the rind color of immature melon fruits (Xu et al., 2021). In this study, the rind of the immature fruits of the parent ‘Spotted 1’ was green, and when they matured, they exhibited a yellow rind with green spots. It is speculated that it is caused by incomplete chlorophyll degradation during fruit ripening. It is possibly also related to the metabolism of chlorophyll, as suggested by the function of the candidate gene CmAPRR2.

Rind color is an important quality trait of melon and an important objective of melon breeding. The ‘Hualei’ type melons are oriental melon types with superior quality and high yield. The fruit rind of ‘Hualei’ is spotted, which is favored by consumers, but the mechanism regulating the spotted rind is unknown. Through genetic analysis and gene mapping, this study preliminarily clarified that the CmAPRR2 gene is the key gene controlling the spotted rind trait, and a dCAPS marker SNP687014-G/A was developed and co-segregated with the spotted rind trait. This study lays the foundation for future molecular breeding programs on melon rind color and may aid the elucidation of the detailed molecular mechanisms underlying the CmAPRR2 regulation of the spotted rind phenotype in melon.

Conclusions

In this study, the inheritance pattern of the spotted rind trait was explored in melon. Genetic analysis revealed that a single dominant gene CmSR controls spotted rind of melon. A candidate interval located on the short arm of chromosome 4 was associated with the spotted and non-spotted rind traits based BSA-seq. And a candidate gene (MELO3C003375) was mapped to this interval, which was predicted to encode an APRR2 protein regulated the rind color in previous studies. Subsequently, gene re-sequence analysis revealed that two SNP mutations in the non-spotted line ‘Yellow 2’ led to alternative splicing and an amino acid change in the predicted protein. Genotypic validation of 170 F₂ individuals using the dCAPS marker SNP687014-G/A co-segregated with CmAPRR2 gene could predict the rind color (spotted/non-spotted) trait with an accuracy of 100%. This study will be valuable for molecular marker-assisted selection in melon breeding and provides a theoretical foundation for further research on the formation mechanism of the rind color in melon.

Acknowledgments

The authors thank MogoEdit for providing English language polishing service. This research was funded by the Science Fund for Distinguished Young Scholars Higher Education of Anhui Excellent Youth Foundation of Higher Education of Anhui (2022AH020037), the Key Research and Development Projects of Anhui Province (2023z04020019), the Innovation and Development Program of Beijing Vegetable Research Center (KYCX202301), and the Open Projects of Anhui Province Watermelon and Melon Biological Breeding Engineering Research Center (AHXTKF2023011).

References

• Arrones A, Mangino G, Alonso D, Plazas M, Prohens J, Portis E, Barchi L, Giuliano G, Vilanova S and Gramazio P (2022) Mutations in the SmAPRR2 transcription factor suppressing chlorophyll pigmentation in the eggplant fruit peel are key drivers of a diversified colour palette. Front Plant Sci 13:1025951.
• Borovsky Y, Tadmor Y, Bar E, Meir A, Lewinsohn E and Paran I (2013) Induced mutation in β-CAROTENE HYDROXYLASE results in accumulation of β-carotene and conversion of red to orange color in pepper fruit. Theor Appl Genet 126:557-565.
• Castanera R, Ruggieri V, Pujol M, Garcia-Mas J and Casacuberta JM (2020) An improved melon reference genome with single-molecule sequencing uncovers a recent burst of transposable elements with potential impact on genes. Front Plant Sci 10:1815.
• Chen M, Ji M, Wen B, Liu L, Li S, Chen X, Gao D and Li L (2016) GOLDEN 2-LIKE transcription factors of plants. Front Plant Sci 7:1509.
• Fang H, Wang P, Wang W, Peng J, Zheng J, Zhu G, Zhong C and Yu W (2023) Fine mapping and identification of SmAPRR2 regulating rind color in eggplant (Solanum melongena L.). Int J Mol Sci 24:3059.
• Feder A, Burger J, Gao S, Lewinsohn E, Katzir N, Schaffer AA, Meir A, Davidovich-Rikanati R, Portnoy V, Gal-On A et al (2015) A Kelch Domain-Containing F-Box coding gene negatively regulates flavonoid accumulation in muskmelon. Plant Physiol 169:1714-1726.
• Garcia-Mas J, Benjak A, Sanseverino W, Bourgeois M, Mir G, González VM, Hénaff E, Câmara F, Cozzuto L, Lowy E et al (2012) The genome of melon (Cucumis melo L.). Proc Natl Acad Sci U S A 109:11872-11877.
• Guo F, Fan J, Zhao W, Luo X, Hou S, Liu H, Zhang L, Li X and Cheng Z (2022) Breeding of a new melon cultivar Caihong No. 6. China Cucurbits Veg 35:89-91.
• Gur A, Tzuri G, Meir A, Sa’ar U, Portnoy V, Katzir N, Schaffer AA, Li L, Burger J and Tadmor Y (2017) Genome-wide linkage-disequilibrium mapping to the candidate gene level in melon (Cucumis melo). Sci Rep 7:9770.
• Gusmini G and Wehner TC (2005) Genes determining rind pattern inheritance in watermelon: A review. Hort Sci 40:1928-1930.
• Hill JT, Demarest BL, Bisgrove BW, Gorsi B, Su YC and Yost HJ (2013) MMAPPR: Mutation mapping analysis pipeline for pooled RNA-seq. Genome Res 23:687-697.
• Hosoda K, Imamura A, Katoh E, Hatta T, Tachiki M, Yamada H, Mizuno T and Yamazaki T (2002) Molecular structure of the GARP family of plant Myb-related DNA binding motifs of the Arabidopsis response regulators. Plant Cell 14:2015-2029.
• Hughes M (1948) The inheritance of two characters of Cucumis melo and their interrelationship. J Amer Soc Hort Sci 52:399-402.
• Huo Y, Zhang G, Yu W, Liu Z, Shen M, Zhao R, Hu S, Zheng X, Wang P and Yang Y (2023) Forward genetic studies revealLsAPRR2as a key gene in regulating the green color of pericarp in bottle gourd (Lagenaria siceraria). Frontiers Plant Sci 14:1130669.
• Kubicki B (1962) Inheritance of some characters in muskmelons. Genet Pol 3:265-274.
• Li H and Durbin R (2009) Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 25:1754-1760.
• Li Z, Chen X, Shi S, Zhang H, Wang X, Chen H, Li W and Li L (2022) DeepBSA: A deep-learning algorithm improves bulked segregant analysis for dissecting complex traits. Mol Plant 15:1418-1427.
• Liu H, Jiao J, Liang X, Liu J, Meng H, Chen S, Li Y and Cheng Z (2016) Map-based cloning, identification and characterization of the w gene controlling white immature fruit color in cucumber (Cucumis sativus L.). Theor Appl Genet 129:1247-1256.
• Liu L, Sun T, Liu X, Guo Y, Huang X, Gao P and Wang X (2019) Genetic analysis and mapping of a striped rind gene (st3) in melon (Cucumis meloL.). Euphytica 215:20.
• Liu S, Gao P, Zhu Q, Zhu Z, Liu H, Wang X, Weng Y, Gao M and Luan F (2020) Resequencing of 297 melon accessions reveals the genomic history of improvement and loci related to fruit traits in melon. Plant Biotechnol J 18:2545-2558.
• Lv J, Fu Q, Lai Y, Zhou M and Wang H (2018) Inheritance and gene mapping of spotted to non-spotted trait gene CmSp-1 in melon (Cucumis melo L. var. chinensis Pangalo). Mol Breed 38:105.
• Ma L, Liu Z, Cheng Z, Gou J, Chen J, Yu W and Wang P (2021) Identification and application of BhAPRR2 controlling peel colour in wax gourd (Benincasa hispida). Front Plant Sci 12:716772.
• McKenna A, Hanna M, Banks E, Sivachenko A, Cibulskis K, Kernytsky A, Garimella K, Altshuler D, Gabriel S, Daly M et al (2010) The genome analysis toolkit: A MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res 20:297-1303.
• Murray MG and Thompson WF (1980) Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res 8:4321-4325.
• Nguyen CV, Vrebalov JT, Gapper NE, Zheng Y, Zhong S, Fei Z and Giovannoni JJ (2014) Tomato GOLDEN2-LIKE transcription factors reveal molecular gradients that function during fruit development and ripening. Plant Cell 26:585-601.
• Oren E, Tzuri G, Vexler L, Dafna A, Meir A, Faigenboim A, Kenigswald M, Portnoy V, Schaffer AA, Levi A et al (2019) The multi-allelic APRR2 gene is associated with fruit pigment accumulation in melon and watermelon. J Exp Bot 70:3781-3794.
• Pan Y, Bradley G, Pyke K, Ball G, Lu C, Fray R, Marshall A, Jayasuta S, Baxter C, van Wijk R et al (2013) Network inference analysis identifies an APRR2-like gene linked to pigment accumulation in tomato and pepper fruits. Plant Physiol 161:1476-1485.
• Riechmann JL, Heard J, Martin G, Reuber L, Jiang C, Keddie J, Adam L, Pineda O, Ratcliffe OJ, Samaha RR et al (2000) Arabidopsis transcription factors: Genome-wide comparative analysis among eukaryotes. Science 290:2105-2110.
• Tadmor Y, Burger J, Yaakov I, Feder A, Libhaber SE, Portnoy V, Meir A, Tzuri G, Sa’ar U, Rogachev I et al (2010) Genetics of flavonoid, carotenoid, and chlorophyll pigments in melon fruit rinds. J Agric Food Chem 58:10722-10728.
• Tao J, Zhang S, Zhang L, An X and Liu C (2003) Relationship between color formation and change in composition of carotenoids in pericarp of citrus fruit. J Plant Physiol Mol Biol 29:121-122.
• Tian S, Yang J, Fu Y, Zhang X, Zhang J, Zhao H, Hu Q, Liu P, He W, Han X et al (2023) McAPRR2: The key regulator of domesticated pericarp color in bitter gourd. Plants (Basel) 12:3585.
• Wang J, Li L and Shang H (2020) Present situation and development countermeasures of watermelon and melon industry in China. China Cucurbits Veg 33:69-73.
• Waters MT, Moylan EC and Langdale JA (2008) GLK transcription factors regulate chloroplast development in a cell-autonomous manner. Plant J 56:432-444.
• Xu X, Shen J, Zhang Y, Li G, Niu X and Shou W (2021) Fine mapping of an immature rind color gene GR in melon. Sci Agric Sin 54:3308-3319.
• Zhao G, Lian Q, Zhang Z, Fu Q, He Y, Ma S, Ruggieri V, Monforte AJ, Wang P, Julca I et al (2019) A comprehensive genome variation map of melon identifies multiple domestication events and loci influencing agronomic traits. Nat Genet 51:1607-1615.
• Zhu L, Wang Y, Zhang Z, Hu D, Wang Z, Hu J, Ma C, Yang L, Sun S and Li Y (2022) Chromosomal fragment deletion in APRR2-repeated locus modulates the dark stem color in Cucurbita pepo Theor Appl Genet 135:4277-4288.

Supplementary material

The following online material is available for this article:

Figure S1 - The images of partial F2 individuals. Figure S2 - Flowchart of information analysis procedure.

Edited by

Associate Editor:

Márcio C. Silva-Filho

Publication Dates

• Publication in this collection
  19 Aug 2024
• Date of issue
  2024

History

• Received
  19 Mar 2024
• Accepted
  05 June 2024