1,25(OH)₂D₃ increase osteogenic potential of human periodontal ligament cells with low osteoblast potential*

Abstracts

Periodontal dental ligament mesenchymal stem cells (PDLMSCs) play a major role in periodontal tissue regeneration by the neoformation of root cementum and alveolar bone. These cells are highly heterogeneous, and many present low potential to renovate the hard tissue damaged by periodontal disease. A previous study found that the low osteoblast/cementoblast (O/C) differentiation potential of PDLMSCs is related to high asporin (ASPN) expression, which was identified as a negative regulator of PDL cells differentiation and mineralization, suppressing BMP-2-induced O/C differentiation.

Objective  This study aimed to investigate whether 1,25(OH)₂D₃ treatment could stimulate the O/C differentiation of periodontal ligament mesenchymal progenitor cells characterized as low osteoblast potential (LOP), by asporin and bone morphogenetic protein-2 alteration.

Methodology  Three LOP cell populations were cultured in standard medium (CONTROL), osteogenic medium (OM), and osteogenic medium associated with 1 nM of 1,25(OH)₂D₃ (OM + VD). The following assays were performed: 1) MTT to evaluate metabolic activity; 2) gene expression for asporin (ASPN), bone morphogenetic protein-2 (BMP-2), runt-related transcription factor 2 (RUNX2), alkaline phosphatase (ALP), osteocalcin (OCN), and vitamin D receptor (VDR) using qRT-PCR; 3) BMP-2 extracellular expression; and 4) quantification of mineralized nodule deposition by Alizarin Red Staining. Data were subjected to two-way ANOVA and Tukey’s test (P<0.05).

Results  The results showed that the 1,25(OH)₂D₃ treatment did not affect the cell viability, as demonstrated by metabolic activity increase over the 10 days in culture. After 14 days of 1,25(OH)₂D₃ treatment, the mRNA levels for ASPN and VDR decreased (P<0.05), while BMP-2 transcripts and extracellular expression increased (P<0.05). In parallel, RUNX2, ALP, and OCN gene expression was upregulated by 1,25(OH)₂D₃ treatment, resulting in an increase of mineral nodule deposition in vitro (P<0.05).

Conclusions  These data show that 1,25(OH)₂D₃ improves osteoblast/cementoblast differentiation of low osteoblast potential accompanied by alterations in ASPN and BMP-2 expression.

Calcitriol; Osteoblast; Cementoblast; Periodontal Dental Ligament Mesenchymal Progenitor Cells; Differentiation; Asporin; Bone Morphogenetic Protein 2

Introduction

One of the biggest challenges of periodontal therapy has been the regeneration of lost periodontal ligament, cementum, and alveolar bone during the process of inflammatory periodontal disease. Numerous clinical therapies have been proposed to regenerate the periodontium, such as guided tissue regeneration, root conditioning, enamel matrix derivative protein, bone graft, and growth factors.¹-³ However, periodontal regeneration has not been achieved completely and predictably with current techniques.⁴,⁵ That may occur due to periodontium being a complex structure comprised of soft and hard tissues, and the regeneration process requiring new cementum formation on previously exposed root surfaces, the synthesis of fibers, and the insertion into newly formed cementum and bone.⁶,⁷

Studies have shown that the neoformation of alveolar bone and mainly of root cementum depends on the migration and proliferation of remnant mesenchymal progenitor cells from periodontal ligament (PDLMCs) into the periodontal defect, followed by the differentiation into cementoblast or osteoblast cells (O/C).⁸,⁹ Nevertheless, PDL is constituted by heterogeneous cell populations, and the great amount of mesenchymal progenitor cells presents low potential to renovate the hard tissue damaged by periodontal disease.¹⁰-¹⁴ In previous studies performed by our research group, we could observe that even when cells were purified for CD105/endoglin/SH2 antigen (PDL-CD105⁺ cells), a specific mesenchymal stem cell marker, PDLMCs retained their heterogeneity and only few of them showed ability to produce mineralized matrix in vitro.¹⁴-¹⁶ Furthermore, it was found that PDL-CD105⁺ cells committed to O/C phenotype had notable variation in relation to mineralized matrix deposition in vitro.

Under osteogenic condition, PDL-CD105⁺ characterized as low osteoblast potential (LOP) cells showed a downregulation of the gene expression for osteoblast markers such as, runt-related transcription factor 2 (RUNX2), alkaline phosphatase (ALP), osteocalcin (OCN), and, for bone morphogenetic protein-2 (BMP-2),¹⁶ which is a potent inductor of O/C differentiation.¹⁷ LOP cells express high asporin (ASPN)/periodontal ligament protein-1 (PLAP-1) mRNA levels, which was identified as a negative regulator of PDL cells differentiation and mineralization suppressing BMP-2-induced osteoblast differentiation.¹⁸

Bone morphogenetic proteins (BMPs) have been strongly associated with osteogenic differentiation of mesenchymal stem cells (MSCs).¹⁹ Studies have confirmed that BMP-2 accelerates the osteoblast differentiation of PDLMCs and enhances the expression of proteins associated with osteogenic differentiation, such as ALP, and OCN, thus promoting bone formation.²⁰-²² In this way, the regulation of signaling pathways associated with osteogenesis may be a viable approach to modulate gene expression and change the phenotype of LOP cells, improving the predictability of periodontal tissue regeneration.

Vitamin D is a crucial fat-soluble vitamin that plays a fundamental role in various physiological processes within the human body.²³ Vitamin D₃ is metabolized by hydroxylation in two steps: the first hydroxylation occurs in the liver to form 25-hydroxyvitamin D3 (25OHD₃), the main circulating metabolite of vitamin D_3;²³ the second one occurs in the kidney to form 1α,25(OH)₂D₃ (1,25D) the biologically active metabolite of vitamin D.²³ The vitamin D receptor (VDR) is a nuclear receptor found in abundance in the key organs involved in calcium balance, including the periodontal ligament, intestine, bones, kidneys, and parathyroid glands.²⁴-²⁶ Recognized for its role in calcium homeostasis and bone health, emerging research has highlighted Vitamin D significance in maintaining periodontal health,²⁷ since it also plays an important role in immunity, in the cardiovascular system, as well as in diabetes, cancer, and chronic illness.²⁸ In addition, vitamin D could enhance the osteogenic differentiation of PDLMCs under inflammatory conditions by inhibiting ASPN expression transcriptionally.²⁹

In this context, the study aimed to understand the effect of 1,25(OH)₂D₃ on periodontal ligament cells, more specifically to evaluate if vitamin D₃ could alter the expression of ASPN, favoring BMP-2 mediated LOP cell differentiation towards osteoblast/cementoblast phenotype. In this sense, we sought to determine the possible alterations and modulations to osteogenic differentiation that 1,25(OH)₂D₃ provided for three LOP cells. The null hypothesis is that there is no significant difference between OM and OM + VD groups in improving osteoblast/cementoblast potential of LOP cells.

Methodology

Cell culture

This study was approved by the Institutional Review Board of Piracicaba School of Dentistry of Campinas State University (CAAE 63957722.0.0000.5418), São Paulo, Brazil. Three populations of PDLMCs cells were exposed to 1,25(OH)₂D₃ and assessed for cell viability, ASPN, BMP-2, VDR, RUNX2, ALP, and OCN gene expression, in addition to BMP-2 protein expression levels and osteogenic differentiation potential.

The three populations of mesenchymal progenitor cells (CD105⁺ CD34- CD45-) from periodontal ligament (PDLMCs) of permanent teeth were obtained from third molars, named LOP 1, LOP 2, LOP 3, and characterized in a previous study.¹² Briefly, CD105⁺ enriched cell subsets from PDL were isolated by magnetic cell sorting and characterized by flow cytometry and immunostaining, as previously described.¹⁵ PDLMCs were grown in alpha Minimum Essential Medium (α-MEM) (Gibco, New York, USA) with 10% fetal bovine serum (FBS; Gibco, New York, USA) and 1% penicillin/streptomycin (P/S; FBS, Gibco, New York, USA) at 37°C in the atmosphere containing 5% CO₂. These three PDLMCs populations were previously characterized as low osteoblast potential (LOP cells) according to quantification of mineral nodule deposition in vitro by Alizarin Red Staining (AR-S).³⁰ They were frozen in Recovery Cell Culture Freezing Medium (Gibco, New York, USA) and kept in liquid nitrogen for subsequent experiments. For each experiment, cells at passages from 3–5 were used in triplicate. Experiments were performed in triplicate three times, with comparable results obtained for each one.

Cell viability

Cell viability of LOP cells was determined using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) assay (Thermo Scientific, New York, USA) on days 1,3, 7 and 10. When cells were cultured to approximately 80% confluence, they were seeded in 96-well plates (0.5 x 10⁴cells/well) in standard medium (α-MEM supplemented with 2% FBS and 1% P/S) and incubated in a humidified incubator at 37°C and 5% CO₂ for 24h to allow cell adhesion. After 24 hours, medium was changed according to the experimental groups: (1) CONTROL - cells cultured in standard medium, (2) OM - cells cultured in osteogenic medium composed by standard medium supplemented with 50 mg/mL ascorbic acid (Sigma-Aldrich, Burlington, USA), 10 mM b- glycerophosphate (Sigma-Aldrich, Burlington, USA), and 10^-5 M dexamethasone (Sigma-Aldrich, Burlington, USA), (3) OM + VD - cells cultured in OM supplemented with 1nM of 1,25(OH)₂D₃ (vitamin D₃; Sigma-Aldrich, Burlington, USA). Cells were cultured for 10 days, and the medium was changed every other day. Experiments were performed in triplicate three times, with comparable results obtained on each occasion (technical replicates) for absorbance reading at 570 nm using VersaMax microplate reader (Molecular Devices).

Real-time PCR

For RNA isolation, LOP cells were seeded (20 × 10⁴ cells/well) in 60 cm² plates with standard medium and incubated for 24 h. After this period, the medium was changed according to the experimental groups described above, and cells were cultured for three, seven, and 14 days. At every time point, cells were lyzed for total RNA extraction using TRIzol reagent (Invitrogen, San Diego, CA, USA), followed by a phenol/chloroform extraction, and isopropanol precipitation. RNA samples were treated with Turbo DNA-free to remove genomic DNA (Invitrogen, San Diego, CA, USA). Single-stranded complementary DNA (cDNA) was synthesized from 2 μg total DNA-free RNA using First-strand cDNA synthesis (Roche Applied

Science, New York, USA) following the manufacturer’s recommendations for a final volume of 20 μL.

The primers for 18S, RUNX2, ALP, OCN, BMP-2, ASPN, and VDR (Table 1) were designed using Primer3web version 4.1.0³¹ and sequences confirmed by UCSC PCR in silico.³² For subsequent analysis of secondary structures and confirmation of annealing temperature, the Beacon Designer free edition was used (Premier Biosoft International). The efficiency of reactions for each “primer” was optimized prior to the start of the RT-qPCR reactions themselves. The real-time PCR reaction was performed with the LightCycler 480 system (Roche Diagnostics GmbH, USA) using the “LightCycler 480 SYBR Green I Master” kit (Roche Diagnostics GmbH). The reaction profile was determined by a formula suggested by the equipment manufacturer. For each run, water was used as a negative control, and the reaction product was quantified using the LightCycler Relative Quantification Software (Roche Diagnostics GmbH). β-actin, GAPDH, and 18S genes were evaluated according to their expression stability by algorithms (NormFinder software – MOMA). 18S was chosen as the reference gene (“housekeeping”) for the normalization of values.

Table 1
Primer sequences used for real-time quantitative PCR amplifications.

Gene	Primer (5`- 3`sequences)	Anneling temperature	Product Size
18S	F: CGGACAGGATTGACAGATTGATAGC	51ºC	171 bp
	R: TGCCAGAGTCTCGTTCGTTATCG
RUNX2	F: CCGTCCATCCACTCTACCAC	55º C	139 bp
	R: ATGAAATGCTTGGGAACTGC
ALP	F: CGGGCACCATGAAGGAAA	55º C	184 bp
	R: GGCCAGACCAAAGATAGAGTT
OCN	F: AGCTCAATCCGGACTGT	55º C	150 bp
	R: GGAAGAGGAAAGAAGGGTGC
ASPN	F: CCAACCGCGAGAAGATGA	60º C	223 bp
	R: CCAAGCAAGGTCTTCCAAAG
BMP-2	F: CTTCCACCCCTCTTTCTTCC	58º C	221 bp
	R: GTCTCCCGGAAACACTTGAA
VDR	F: TATCCACCCAGCCCATTCTC	59º C	206 bp
	R: TCCCTCAACATCAGTCAGCA

• RUNX2: runt-related transcription factor 2; ALP: alkaline phosphatase; OCN: osteocalcin; ASPN: asporin; BMP-2: bone morphogenetic protein 2. VDR: vitamin D receptor.

ELISA

Cells were seeded (2 × 10⁴ cells/well) in six-well culture plates and incubated overnight in standard medium. Next, cells were cultured under conditions described in section 2.3. The antigens were prepared to a final concentration of 80μg/mL using Phosphate Buffered Saline (PBS). The plate was sealed and incubated overnight at 4. The wells were washed three times with 400 μL of 1% Tween 20 in PBS. The remaining protein binding sites in the coated wells were then blocked by adding 200 µL of blocking buffer, 5% non-fat dry milk /PBS, per well. After washing, polyclonal rabbit antibody anti-BMP2 (clone ab14933, Abcam, Cambridge, UK), diluted 1:100 in PBS, was added to the wells and incubated for 2 h. After another washing step, peroxidase-conjugated anti-rabbit IgG (Vector Laboratories, Inc., Burlingame, USA) diluted 1:1000 in PBS was added and maintained for 1 h. After the end of the reaction with 50 μL of 2 N H₂SO₄, (stop solution) absorbance was read at 450 nm (Genesys TM 2, Thermo Spectronic US, Rochester, NY, USA). BMP-2 levels, as represented by absorbance values, were calculated considering the 3-day control as 100%.

Osteogenic differentiation

To evaluate the capacity of mineral matrix deposition, cells were seeded (3x10⁴ cells/well) in 24-well plates and incubated for 24 hours in standard medium. Then, the medium was replaced according to experimental groups, and cells were maintained under osteogenic condition for 28 days, with the osteogenic medium being changed every three days. On designated days up to day 28, the ability of cells to promote mineral nodule formation was determined by Alizarin Red Staining (AR-S).³³ After the discoloration procedure of mineral nodules, quantitative analysis (562 nm) was performed using VersaMax microplate reader (Molecular Devices).

Statistical analysis

All experiments were performed in triplicate and repeated on at least three separate occasions. Data were initially examined for normality by Shapiro-Wilk test and expressed as mean ± standard deviation (SD). The differences between multiple groups were analyzed using two-way analysis of variance (ANOVA), followed by Tukey’s post-hoc test. Pearson correlation was used to calculate crosstalk between mRNA levels of ASPN and BMP-2 on day 14. A significance level of less than 0.05 was adopted (GraphPad Prism 10 – GraphPad Software Inc). The data are shown as intragroup analysis, in which they are compared for the effect of the treatments over time, in addition to evaluating the differences among the treatments in each time point. In this way, the intragroup variables refer to the different times that the treatments are being subjected to, and the intergroup analyses relate to the different types of treatment.

Results

Metabolic activity of LOP cells is not affected by 1,25(OH)2D3

To verify whether LOP cells responded to 1,25(OH)₂D₃ treatment, metabolic activity was measured using MTT assay, as an indicator for cell viability. First, a range of concentrations of 1,25(OH)₂D₃ (0.1, 1, 10, 20 and 30 nM) was tested on a single population (LOP 1 cells). By the results, we verified that cell viability under 1,25(OH)₂D₃ treatment was dose-dependent (supporting data, Figure S1) with the concentration of 1nM not affecting the proliferation of LOP 1 cells during a 10-day period, when compared to CONTROL and OM groups. Then, all three LOP cell populations were treated with 1nM of 1,25(OH)₂D₃ to evaluate cell metabolic activity. The MTT assay results showed that the three LOP cell populations responded in different ways, but not unfavorably to 1,25(OH)₂D₃ treatment. LOP 1 cells have already shown an increase of metabolic activity after one day of 1,25(OH)₂D₃ treatment (absorbance (%)=106.6), which was significantly different when compared to OM group (absorbance (%)=94.3) (Figure 1) (P=0.007). This increase in metabolic activity was maintained throughout the 1,25(OH)₂D₃ treatment with highest levels after 10 days (Figure 1A) (P<0.0001). LOP 2 cells also had an improvement on day 10 of 1,25(OH)₂D₃ treatment (absorbance (%) = 223.25), but there was not a significant difference when compared to OM group (absorbance (%)=242.1) (P=0.16) (Figure 1). Finally, in LOP 3 cells, 1,25(OH)₂D₃ induced a significantly different increase of metabolic activity on day one (absorbance (%)=111.4), when compared to CONTROL group (absorbance (%)=101) (Figure 1) (P=0.0069). Further, after three and seven days, OM + VD group showed a higher metabolic activity (absorbance (%)=102; absorbance (%)=98.2, respectively) when compared to OM group, (absorbance (%)=82.17; absorbance (%)=90.32, respectively) (Figure 1) (P<0.0001; P=0.046 respectively). In summary, the results show that 1,25(OH)₂D₃ was not able to affect the viability of LOP cells.

Figure 1
(A) Effect of 1,25(OH)2D3 on metabolic activity. Three LOP cell populations (LOP 1, LOP 2, and LOP 3) were cultured in standard medium (CONTROL), osteogenic medium (OM), and OM + 1nM of 1,25(OH)2D3 (OM + VD). MTT assay to assess cell metabolism and viability was performed at one, three, seven and 10 days. The control represents 100% of viability. (B) VDR expression after 1,25(OH)2D3 treatment. Real-time PCR analysis after treatment confirmed that all three populations express mRNAs for VDR. Experiments were performed in triplicate three times, with comparable results obtained on each occasion. Bars represent mean ± standard deviation (SD), intergroup analysis statistical differences are indicated by different lowercase letters, and intragroup statistically significant differences are indicated by different uppercase letters. The letter “X” represents the difference in relation to day one, while the letter “Y” represents the difference in relation to day three and “Z'” to day seven (P<0.05).

VDR expression

Quantitative qRT-PCR analysis confirmed that cell populations expressed the vitamin D receptor (VDR) gene. During the first three days, LOP 3 was the only one whose VDR expression was increased by 1,25(OH)₂D₃ (mRNA=26.70) (P<0.05), while LOP 1 and LOP 2 showed decreases in VDR expression in OM + VD (mRNA=13.55; mRNA=11.78 respectively) (Figure 1B). On day seven, LOP 2 and LOP 3 had increased VDR expression only in OM (Figure 1B) (P<0.05). It should be noted that the three cell populations showed a trend after 14 days of induction, that is, after this period in osteogenic medium (OM), the cells began to express considerably higher levels of VDR mRNA when compared to CONTROL and 1,25(OH)₂D₃ medium. In addition, during this same period it was clear that OM + VD reduced the expression of the receptor, even when compared to the CONTROL group (Figure 1B) (P<0.05).

1,25(OH)2D3 treatment changes the gene expression for ASPN and BMP-2

LOP cells were cultured in standard medium (CONTROL), OM, and OM + 1 nM of 1,25(OH)₂D₃ for three, seven, and 14 days, and the effect on the gene expression for ASPN and BMP-2 was detected using qRT-PCR. The results showed that in CONTROL and OM conditions, the ASPN gene is expressed by LOP cells only after 14 days (Figure 2A). Also, after 14 days of 1,25(OH)₂D₃ treatment (OM + VD) the mRNA levels for ASPN were significantly decreased compared with CONTROL and OM groups (Figure 2A) (P<0.05). At the same time, LOP 2 and LOP 3 cells had an increased expression of BMP-2 gene from seven days of 1,25(OH)₂D₃ treatment (mRNA=9.02; mRNA=11.71 respectively), which was significantly different compared to the CONTROL and OM groups (Figure 2B) (P<0.05). In a different way, LOP 1 cells already expressed BMP-2, however, from three days in all cultured conditions (Figure 2B). Further, the mRNA levels for BMP-2 increased from day three to day 14 (P<0.05), and no difference was observed in the OM+VD compared to CONTROL and OM groups (Figure 2B) (P>0.05). In summary, PCR results showed that 1nM of 1,25(OH)₂D₃ alters the pattern of ASPN expression in LOP cells after 14 days of treatment. However, the effect of 1,25(OH)₂D₃ on increasing BMP-2 gene expression was favorable only for LOP 2 and LOP 3 cell populations.

Figure 2
Real-time PCR analysis indicated a downregulation of the mRNA levels for ASPN (A), and an increased level of transcripts for BMP-2 (B) after the treatment with 1nm of 1,25(OH)2D3. (C) Correlation between BMP-2 and ASPN on day 14. Experiments were performed in triplicate three times, with comparable results obtained on each occasion. Bars represent mean ± standard deviation (SD), intergroup analysis statistical differences are indicated by different lowercase letters, and intragroup statistical significant differences are indicated by different uppercase letters. The letter “Y” represents the difference in relation to day three, while “Z” represents a difference in relation to day seven. (P<0.05)

Pearson correlation showed a negative correlation between BMP-2 and ASPN in LOP 1 (r =-0.6775) and LOP 2 (r=-0.8104) over the 14-day period (Figure 2C). This shows a relation between a decrease in ASPN transcripts and an increase in BMP-2 transcripts (P<0.05). In LOP 3, there was a trend towards a negative correlation between ASPN and BMP-2, which was not as statistically significant as in the other populations (Figure 2C) (r=-0.1330). In this sense, in LOP 3 the lower expression of ASPN did not result in a higher expression of BMP-2 (p=0.7331).

1,25(OH)2D3 alters the expression for osteogenic gene markers

To evaluate whether the modulation of expression for ASPN and BMP-2 may enhance the osteogenic potential of LOP cells, mRNA levels for RUNX2, ALP, and OCN were detected by qRT-PCR. LOP 1, LOP 2, and LOP 3 cells showed an increase of expression for RUNX2 gene after 14 days of 1,25(OH)₂D₃ treatment, when compared to CONTROL and OM groups (Figure 3A) (P<0.05). Both cells expressed significant levels of ALP transcripts after 3 days of treatment with 1,25(OH)₂D₃ (Figure 3B) (P<0.05). Concerning OCN, LOP 1 cells already showed a significant increase of mRNA levels on the third day of 1,25(OH)₂D₃ treatment (mRNA=12.6), while in LOP 2 cells this increase was only observed after 14 days (mRNA=17.31) (Figure 3B). In LOP 3 cells, the expression of genes for RUNX2, ALP, and OCN was only detected after seven days of culturing (Figure 3A-3C). The transcripts levels for RUNX2 and OCN were significantly higher in the OM + VD group as early as day seven when compared to OM group (Figure3A and 3C) (P<0.0001). On the other hand, the expression of ALP in the OM + VD group was only significantly different from OM at day 14 (Figure 3B) (P=0.04).

Figure 3
Osteoblast genes expression after 1,25(OH)2D3 treatment. Real-time PCR analysis after treatment indicated that 1,25(OH)2D3 upregulated the expression of mRNAs for RUNX2 (A), ALP (B), and OCN (C). Bars represent mean ± standard deviation (SD), intergroup analysis statistical differences are indicated by different lowercase letters, and intragroup statistical significant differences are indicated by different uppercase letters. The letter “Y” represents the difference in relation to day three, while “Z” represents a difference in relation to day seven. (P<0.05).

Expression of BMP-2 protein is modified in three LOP cells by 1,25(OH)2D3

The ELISA assay results showed significantly higher levels of BMP-2 in supernatants of LOP 1, LOP 2, and LOP 3 cells after 1,25(OH)₂D₃ induction compared to OM and CONTROL groups (Figure 4) (P<0.05). Although the BMP-2 protein was more highly expressed in the 1,25(OH)₂D₃-induced groups, each cell population showed its own particularities regarding time. In LOP 1, there was a peak in BMP-2 expression in the 1,25(OH)₂D₃ groups at seven and 14 days (absorbance (%)=2188.85; absorbance (%)=1839.68 respectively). In LOP 2, the peaks occurred on days three (absorbance (%)=2375.4) and 14 (absorbance (%)=2093.43), while in LOP 3 only on day 14 (1375.29) (Figure 4). (P<0.05)

Figure 4
BMP-2 protein expression. Quantification of BMP-2 secreted in supernatant of LOP 1, LOP 2, and LOP 3 cells after three, seven, and 14 days of osteogenic induction associated with 1,25(OH)2D3. Bars represent mean ± standard deviation (SD), intergroup analysis statistical differences are indicated by different lowercase letters, and intragroup statistical significantly differences are indicated by different uppercase letters. The letter “Y” represents the difference in relation to day three, while “Z” represents a difference in relation to day seven. (P<0.05)

1,25(OH)2D3 increases mineralized matrix deposition by LOP cells

To verify the long-term effect of 1,25(OH)₂D₃ on osteoblast differentiation, AR-S assay was used to identify mineralized nodule deposition in vitro. After 28 days of culturing, AR-S revealed that the osteogenic medium did not induce a significant mineral nodule deposition (Figure 5A-5C). On the other hand, OM + VD treatment increased mineralization compared to osteogenic medium alone in all LOP cell populations (Figure 5A-5F). (P<0.05)

Figure 5
Effect of 1,25(OH)2D3 on mineral nodule deposition. (A-C) Microscopic of Alizarin Red Staining (AR-S) mineralization of LOP 1, LOP 2, and LOP 3, respectively. Scale bar = 40µm. (D-F) Quantification of AR-S at 28 days. Experiments were performed in triplicate three times, with comparable results obtained on each occasion. Bars represent mean ± standard deviation (SD) and intergroup analysis statistical differences are indicated by different lowercase letters (P<0.05).

Discussion

This study was conducted to confirm the osteogenic effect of 1,25(OH)₂D₃ in three LOP cells of PDLMSCs. After 14 days of 1,25(OH)₂D₃ treatment, the mRNA levels for ASPN and VDR decreased (P<0.05), while BMP-2 transcripts and extracellular expression increased (P<0.05). In parallel, RUNX2, ALP, and OCN gene expression was upregulated by 1,25(OH)₂D₃ treatment, resulting in an increase of mineral nodule deposition in vitro (P<0.05). Contradicting the null hypothesis, 1,25(OH)₂D₃ obtained favorable results in terms of mineralized matrix production when compared to the OM group. In this sense, to the best of our knowledge, it is the first time that 1,25(OH)₂D₃ has been shown to alter the osteoblastic capacity of cells with low osteoblast potential.

There is a pressing need to find therapies with broad indications and greater predictability for periodontal regeneration. Recent research has sought to analyze ways of enhancing the osteo-cementoblastic differentiation capacity of PDLMCs,⁹-¹² which are quite heterogeneous in character, and few have demonstrated the ability to produce mineralized matrix in vitro.¹⁴-¹⁶ Studies have shown that ASPN is a negative regulator in the differentiation of mesenchymal cells of the periodontal ligament.¹⁸ At the same time, ASPN is known to competitively bind to BMP-2, resulting in inhibition of BMP-2 activation.¹⁸,³⁴ It was also related that 1,25(OH)₂D₃ had an inhibitory effect on ASPN transcription.²⁹

The maintenance of appropriate vitamin D levels has shown to be associated with better oral development and health throughout life.³⁵ Although the influence of Vitamin D₃ on the mesenchymal cells of the periodontal ligament is still not entirely clear, it was reported that vitamin D₃ promotes osteogenic differentiation of human PDL cells and antagonizes inflammation in human periodontal tissue.³⁶ Knowing that vitamin D₃ can act as a negative regulator of ASPN, our study is the first to determine its effect in three different PDL-CD105⁺ cell populations characterized as low osteoblast potential.

According to the MTT results obtained, 1nM of 1,25(OH)2D₃ did not compromise the metabolic capacity of all the populations. Moreover, we found that after 10 days of induction, OM + VD had the ability to be neutral or improve cellular viability. Vitamin D₃ can reduce the expression of pro-inflammatory cytokines, suggesting promotion of periodontal regeneration and antagonizing periodontal inflammation.²⁹,³⁶ Vitamin D₃ also plays a significant role in various aspects of cell functions and is associated with the regulation of osteoblastic and osteoclastic activities, thereby impacting both the resorption and synthesis stages of bone remodeling.³⁷

It has been suggested that cells of the periodontal ligament can metabolize Vitamin D due to the presence of receptors.²⁴,²⁵ VDR mediates the transcriptional actions of the hormonally active form of vitamin D3 (1,25(OH)₂D₃).³⁸ Our qRT-PCR analysis confirmed that all cell populations expressed the vitamin D receptor gene. We noticed a pattern on the fourteenth day in which LOP 1, LOP 2, and LOP 3 had decreased VDR transcripts in the presence of Vitamin D. 1,25(OH)2D₃ autoregulates the expression of the VDR gene in response to exposure to Vitamin D_3.³⁸ Therefore, we can suggest that the decrease in VDR expression is related to presence of the active metabolite there, no longer requiring the receptor metabolizing function. On the other hand, the OM group considerably increased VDR expression levels. Dexamethasone, one of the components of osteogenic induction medium, has been reported to up-regulate mRNA expression of VDR in primary cultures of osteoblast-like cells.³⁹

Considering the primary cell culture and its heterogeneity, all of them showed reduced ASPN expression after 14 days of OM+VD induction. On the other hand, BMP-2 had its mRNA expression improved by 1,25(OH)₂D₃ after seven days of induction in most populations. Thus, we can observe that ASPN started to be limited by 1,25(OH)₂D₃ only on the 14^th day, which may suggest that, between seven and 14 days, the signaling pathway started to receive the influence of BMP-2 and had the expected reduction in the last period. Zhang, et al.²⁹ (2020) confirmed that a vitamin D receptor (VDR) binding site was identified in the ASPN promoter region, which can explain the negative regulation of vitamin D on ASPN gene expression.

After 14 days, cell populations LOP 1 and LOP 2 showed a negative correlation when comparing BMP-2 and ASPN. That is, while ASPN expression was being reduced in the OM + VD group, BMP-2 transcripts increased, confirming the influence between them.¹⁸,³⁴ Although there was a negative correlation trend for LOP 3, it was not possible to state that ASPN was influencing BMP-2 expression. This does not mean that 1,25(OH)2D₃ had no effect, but its action extent could not interfere with BMP-2 expression, which remained similar to the OM group.

To confirm the stimulatory effect of 1,25(OH)₂D₃ on BMP-2 protein expression, we noticed that all cell populations began to express more extracellular protein in the Vitamin D groups, especially after 14 days. The difference with the CONTROL and OM groups was evident, corroborating the gene expression data, especially in LOP 1 and LOP 2, which confirmed the correlation with ASPN. Although the OM + VD groups from LOP 1 and LOP 2 showed high protein expression on days seven and three respectively, there was a unanimous increase in extracellular BMP-2 protein after 14 days. Therefore, we suggest that 1,25(OH)₂D₃ induced cells to secrete more BMP-2 proteins, which may have contributed to the mediation and alteration of the low osteoblastic potential of LOP 1, LOP 2, and LOP 3. It is important to note that BMP-2 is a key factor in this phenotype change, since this protein signaling regulates bone mineral density and it is a growth factor that initiates osteoblast differentiation.⁴⁰

The microscopic analysis of Alizarin Red Staining (AR-S) after 28 days of induction showed more evident mineral nodules in the OM + VD group. These data were confirmed by ARS quantification . The greater formation of mineral nodules may suggest that the phenotype of these three cell populations with low osteoblast potential could be altered by the action of 1,25(OH)₂D₃. The AR-S was essential to highlight mineralization and the difference between the groups. Vitamin D₃ has been demonstrated to regulate osteoblast and chondrocyte gene transcription, proliferation, and differentiation.³⁷

It has been reported that 1,25(OH)2D₃ enhanced the expression of runt-related transcription factor 2 (RUNX2), osteocalcin (OCN), and alkaline phosphatase (ALP) in human osteoblastic cells.³⁶,⁴¹ Confirming our hypothesis, the highest transcript expressions of ALP, RUNX2, and OCN occurred in the presence of 1,25(OH)₂D₃. ALP activity is commonly assessed as an early marker of osteogenic differentiation,⁴² as it plays a crucial role in bone mineralization by initiating and/or promoting hydroxyapatite crystal formation in the osteoblast matrix.⁴³ On the other hand, RUNX2 has been identified as a “master gene” in controlling osteogenic differentiation,⁴⁴ serving as an early-stage transcription factor that activates osteoblastic differentiation.⁴⁵,⁴⁶ It triggers OCN transcription by binding to target promoters and enhancers.⁴⁷ RUNX2 expression regulates bone matrix mineralization, and its upregulation is associated with enhanced stimulation of the extracellular matrix mineralization.⁴⁸,⁴⁹ The OCN gene is a marker for late-stage osteogenic differentiation and is synthesized only during the maturation of osteoblasts, odontoblasts, and cementoblasts.⁴⁴,⁵⁰ Therefore, the greater expression of these osteogenic markers in the OM + VD group helps to confirm the potential of 1,25(OH)2D₃ to stimulate O/C differentiation.

However, it must be emphasized that more tests are needed to understand the modulation between ASPN and BMP-2 and its consequence for the osteogenic differentiation of PDLMSCs. Also, in vitro study conditions can oversimplify complex interactions, leading to results that might not translate directly to in vivo settings, which can limit the applicability. Furthermore, new studies are needed to visualize the broad influence that 1,25(OH)₂D₃ can have on periodontal ligament cells in vivo, to establish the possibility of local application as a future alternative for periodontal regeneration.

Conclusion

The study demonstrates that treatment with 1,25(OH)₂D₃ enhances the differentiation potential of PDL-CD105+ cells with initially low osteoblast/cementoblast potential. This enhancement is evidenced by an increased production of mineralized matrix and accompanied by alterations in the gene expression of ASPN and BMP-2. These findings suggest that 1,25(OH)₂D₃ effectively improves the osteogenic profile of PDL cells that initially showed low predisposition for mineralized tissue reconstruction. Future steps will involve in vivo treatments to further evaluate the clinical effects of 1,25(OH)₂D₃.

Acknowledgments

This research was supported by the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES; finance code no. 001).

References

• ¹ - Reynolds MA Reynolds MA, Kao RT, Kao RT, Camargo PM, et al. Periodontal regeneration - intrabony defects: a consensus report from the AAP Regeneration Workshop. J Periodontol. 2015;86(2 Suppl):S105-7. doi: 10.1902/jop.2015.140378
  » https://doi.org/10.1902/jop.2015.140378
• ² - Reddy MS, Aichelmann-Reidy ME, Avila-Ortiz G, et al. Periodontal regeneration - furcation defects: a consensus report from the AAP Regeneration Workshop. J Periodontol. 2015;86(2 Suppl):S131-3. doi: 10.1902/jop.2015.140379
  » https://doi.org/10.1902/jop.2015.140379
• ³ - Cirelli JA, Fiorini T, Moreira CH, Molon RS, Dutra TP, Sallum EA. Periodontal regeneration: is it still a goal in clinical periodontology? Braz Oral Res. 2021;35(Supp 2):e09. doi: 10.1590/1807-3107bor-2021.vol35.0097
  » https://doi.org/10.1590/1807-3107bor-2021.vol35.0097
• ⁴ - Sculean A, Nikolidakis D, Nikou G, Ivanovic A, Chapple IL, Stavropoulos A. Biomaterials for promoting periodontal regeneration in human intrabony defects: a systematic review. Periodontol 2000. 2015;68(1):182-216. doi: 10.1111/prd.12086
  » https://doi.org/10.1111/prd.12086
• ⁵ - Jepsen S, Gennai S, Hirschfeld J, Kalemaj Z, Buti J, Graziani F. Regenerative surgical treatment of furcation defects: a systematic review and Bayesian network meta-analysis of randomized clinical trials. J Clin Periodontol. 2020;47 Suppl 22:352-74. doi: 10.1111/jcpe.13238
  » https://doi.org/10.1111/jcpe.13238
• ⁶ - Nyman S, Gottlow J, Lindhe J, Karring T, Wennstrom J. New attachment formation by guided tissue regeneration. J Periodontal Res. 1987;22(3):252-4. doi: 10.1111/j.1600-0765.1987.tb01581.x
  » https://doi.org/10.1111/j.1600-0765.1987.tb01581.x
• ⁷ - Polimeni G, Xiropaidis AV, Wikesjö UM. Biology and principles of periodontal wound healing/regeneration. Periodontol 2000. 2006;41:30-47. doi: 10.1111/j.1600-0757.2006.00157.x
  » https://doi.org/10.1111/j.1600-0757.2006.00157.x
• ⁸ - Melcher AH. On the repair potential of periodontal tissues. J Periodontol. 1976;47(5):256-60. doi: 10.1902/jop.1976.47.5.256
  » https://doi.org/10.1902/jop.1976.47.5.256
• ⁹ - Nyman S, Gottlow J, Karring T, Lindhe J. The regenerative potential of the periodontal ligament. An experimental study in the monkey. J Clin Periodontol. 1982;9(3):257-65. doi: 10.1111/j.1600-051x.1982.tb02065.x
  » https://doi.org/10.1111/j.1600-051x.1982.tb02065.x
• ¹⁰ - Seo BM, Miura M, Gronthos S, Bartold PM, Batouli S, Brahim J, et al. Investigation of multipotent postnatal stem cells from human periodontal ligament. Lancet. 2004;364:149-55. doi: 10.1016/S0140-6736(04)16627-0.
  » https://doi.org/10.1016/S0140-6736(04)16627-0
• ¹¹ - Singhatanadgit W, Donos N, Olsen I. Isolation and characterization of stem cell clones from adult human ligament. Tissue Eng Part A. 2009;15(9):2625-36. doi: 10.1089/ten.TEA.2008.0442
  » https://doi.org/10.1089/ten.TEA.2008.0442
• ¹² - Silvério KG, Rodrigues TL, Coletta RD, Benevides L, Silva JS, Casati MZ, et al. Mesenchymal stem cell properties of periodontal ligament cells from deciduous and permanent teeth. J Periodontol. 2010;81(8):1207-15. doi: 10.1902/jop.2010.090729
  » https://doi.org/10.1902/jop.2010.090729
• ¹³ - Sununliganon L, Singhatanadgit W. Highly osteogenic PDL stem cell clones specifically express elevated levels of ICAM1, ITGB1 and TERT. Cytotechnology. 2012;64(1):53-63. doi: 10.1007/s10616-011-9390-5
  » https://doi.org/10.1007/s10616-011-9390-5
• ¹⁴ - Saito MT, Salmon CR, Amorim BR, Ambrosano GM, Casati MZ, Sallum EA, et al. Characterization of highly osteoblast/cementoblast cell clones from a CD105-enriched periodontal ligament progenitor cell population. J Periodontol. 2014;85:e205-11. doi: 10.1902/jop.2014.130461
  » https://doi.org/10.1902/jop.2014.130461
• ¹⁵ - Saito MT, Mofatto LS, Albiero ML, Casati MZ, Sallum EA, Nociti FH Junior, et al. Transcriptome profile of highly osteoblastic/cementoblastic periodontal ligament cell clones. J Appl Oral Sci. 2020;28:e20200242. doi: 10.1590/1678-7757-2020-0242
  » https://doi.org/10.1590/1678-7757-2020-0242
• ¹⁶ - Sacramento CM, Assis RI, Saito MT, Coletta RD, Dourado MR, Sallum EA, et al. BMP-2 and asporin expression regulate 5-aza-dC-mediated osteoblast/cementoblast differentiation of periodontal dental ligament mesenchymal progenitor cells. Differentiation. 2022;124:17-27. doi: 10.1016/j.diff.2022.02.003
  » https://doi.org/10.1016/j.diff.2022.02.003
• ¹⁷ - Levi B, Hyun JS, Nelson ER, Li S, Montoro DT, Wan DC, et al. Nonintegrating knockdown and customized scaffold design enhances human adipose-derived stem cells in skeletal repair. Stem Cells. 2011;29(12):2018-29. doi: 10.1002/stem.757
  » https://doi.org/10.1002/stem.757
• ¹⁸ - Yamada S, Tomoeda M, Ozawa Y, Yoneda S, Terashima Y, Ikezawa K, et al. PLAP-1/asporin, a novel negative regulator of periodontal ligament mineralization. J Biol Chem. 2007;282(32):23070-80. doi: 10.1074/jbc.M611181200
  » https://doi.org/10.1074/jbc.M611181200
• ¹⁹ - Wang L, Liu C, Wu F. Low-level laser irradiation enhances the proliferation and osteogenic differentiation of PDLSCs via BMP signaling. Lasers Med Sci. 2022;37(2):941-8. doi: 10.1007/s10103-021-03338-6.
  » https://doi.org/10.1007/s10103-021-03338-6
• ²⁰ - García EV, Valdecantos PA, Barrera D, Roldán-Olarte M, Miceli DC. Bone morphogenetic proteins in the bovine oviduct: differential expression of BMP-5 in the isthmus during the estrous cycle. Theriogenology. 2014;81(8):1032-41. doi: 10.1016/j.theriogenology.2014.01.025
  » https://doi.org/10.1016/j.theriogenology.2014.01.025
• ²¹ - Kim HY, Park SY, Choung SY. Enhancing effects of myricetin on the osteogenic differentiation of human periodontal ligament stem cells via BMP-2/Smad and ERK/JNK/p38 mitogen-activated protein kinase signaling pathway. Eur J Pharmacol. 2018;834:84-91. doi: 10.1016/j.ejphar.2018.07.012
  » https://doi.org/10.1016/j.ejphar.2018.07.012
• ²² - Zhang Y, Shen L, Mao Z, Wang N, Wang X, Huang X, et al. Icariin enhances bone repair in rabbits with bone infection during post-infection treatment and prevents inhibition of osteoblasts by vancomycin. Front Pharmacol. 2017;8:784. doi: 10.3389/fphar.2017.00784
  » https://doi.org/10.3389/fphar.2017.00784
• ²³ - Jones G, Strugnell SA, DeLuca HF. Current understanding of the molecular actions of vitamin D. Physiol Rev. 1998;78(4):1193-231. doi: 10.1152/physrev.1998.78.4.1193
  » https://doi.org/10.1152/physrev.1998.78.4.1193
• ²⁴ - Liu K, Meng H, Hou J. Activity of 25-hydroxylase in human gingival fibroblasts and periodontal ligament cells. PLoS One. 2012;7(12):e52053. doi: 10.1371/journal.pone.0052053
  » https://doi.org/10.1371/journal.pone.0052053
• ²⁵ - Liu K, Meng H, Lu R, Xu L, Zhang L, Chen Z, et al. Initial periodontal therapy reduced systemic and local 25-hydroxy vitamin D(3) and interleukin-1beta in patients with aggressive periodontitis. J Periodontol. 2010;81(2):260-6. doi: 10.1902/jop.2009.090355
  » https://doi.org/10.1902/jop.2009.090355
• ²⁶ - Haussler MR, Whitfield GK, Haussler CA, Hsieh JC, Thompson PD, Selznick SH, et al. The nuclear vitamin D receptor: biological and molecular regulatory properties revealed. J Bone Miner Res. 1998;13(3):325-49. doi: 10.1359/jbmr.1998.13.3.325
  » https://doi.org/10.1359/jbmr.1998.13.3.325
• ²⁷ - Holick MF. Vitamin D deficiency. N Engl J Med. 2007;357(3):266-81. doi: 10.1056/NEJMra070553
  » https://doi.org/10.1056/NEJMra070553
• ²⁸ - Adams JS, Hewison M. Update in vitamin D. J Clin Endocrinol Metab. 2010;95(2):471-8. doi: 10.1210/jc.2009-1773
  » https://doi.org/10.1210/jc.2009-1773
• ²⁹ - Zhang P, Zhang Y, Liu Q, Zhang Y, Ji Y, Xu X. 1,25(OH)2D3 supports the osteogenic differentiation of hPDLSCs under inflammatory conditions through inhibiting PLAP-1 expression transcriptionally. Int Immunopharmacol. 2020;78:105998. doi: 10.1016/j.intimp.2019.105998
  » https://doi.org/10.1016/j.intimp.2019.105998
• ³⁰ - Assis RI, Schmidt AG, Racca F, Silva RA, Zambuzzi WF, Silverio KG, et al. DNMT1 inhibitor restores RUNX2 expression and mineralization in periodontal ligament cells. DNA Cell Biol. 2021;40(5):662-74. doi: 10.1089/dna.2020.6239
  » https://doi.org/10.1089/dna.2020.6239
• ³¹ - Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M, et al. Primer3: new capabilities and interfaces. Nucleic Acids Res. 2012;40(15):e115. doi: 10.1093/nar/gks596
  » https://doi.org/10.1093/nar/gks596
• ³² - Kent WJ, Sugnet CW, Furey TS, Roskin KM, Pringle TH, Zahler AM, et al. The human genome browser at UCSC. Genome Res. 2002;12(6):996-1006. doi: 10.1101/gr.229102
  » https://doi.org/10.1101/gr.229102
• ³³ - Gregory CA, Gunn WG, Peister A, Prockop DJ. An Alizarin red-based assay of mineralization by adherent cells in culture: comparison with cetylpyridinium chloride extraction. Anal Biochem. 2004;329(1):77-84. doi: 10.1016/j.ab.2004.02.002
  » https://doi.org/10.1016/j.ab.2004.02.002
• ³⁴ - Tomoeda M, Yamada S, Shirai H, Ozawa Y, Yanagita M, Murakami S. PLAP-1/asporin inhibits activation of BMP receptor via its leucine-rich repeat motif. Biochem Biophys Res Commun. 2008;371(2):191-6. doi: 10.1016/j.bbrc.2008.03.158
  » https://doi.org/10.1016/j.bbrc.2008.03.158
• ³⁵ - Dietrich T, Joshipura KJ, Dawson-Hughes B, Bischoff-Ferrari HA. Association between serum concentrations of 25-hydroxyvitamin D3 and periodontal disease in the US population. Am J Clin Nutr. 2004;80(1):108-13. doi: 10.1093/ajcn/80.1.108
  » https://doi.org/10.1093/ajcn/80.1.108
• ³⁶ - Nebel D, Svensson D, Arosenius K, Larsson E, Jönsson D, Nilsson BO. 1a,25-dihydroxyvitamin D3 promotes osteogenic activity and downregulates proinflammatory cytokine expression in human periodontal ligament cells. J Periodontal Res. 2015;50(5):666-73. doi: 10.1111/jre.12249
  » https://doi.org/10.1111/jre.12249
• ³⁷ - Atkins GJ, Anderson PH, Findlay DM, Welldon KJ, Vincent C, Zannettino AC, et al. Metabolism of vitamin D3 in human osteoblasts: evidence for autocrine and paracrine activities of 1 alpha,25-dihydroxyvitamin D3. Bone. 2007;40(6):1517-28. doi: 10.1016/j.bone.2007.02.024
  » https://doi.org/10.1016/j.bone.2007.02.024
• ³⁸ - Zella LA, Kim S, Shevde NK, Pike JW. Enhancers located within two introns of the vitamin D receptor gene mediate transcriptional autoregulation by 1,25-dihydroxyvitamin D3. Mol Endocrinol. 2006;20(6):1231-47. doi: 10.1210/me.2006-0015
  » https://doi.org/10.1210/me.2006-0015
• ³⁹ - Chen TL, Hauschka PV, Feldman D. Dexamethasone increases 1,25-dihydroxyvitamin D3 receptor levels and augments bioresponses in rat osteoblast-like cells. Endocrinology. 1986;118(3):1119-26. doi: 10.1210/endo-118-3-1119
  » https://doi.org/10.1210/endo-118-3-1119
• ⁴⁰ - Bragdon B, Bonor J, Shultz KL, Beamer WG, Rosen CJ, Nohe A. Bone morphogenetic protein receptor type Ia localization causes increased BMP2 signaling in mice exhibiting increased peak bone mass phenotype. J Cell Physiol. 2012;227(7):2870-9. doi: 10.1002/jcp.23028
  » https://doi.org/10.1002/jcp.23028
• ⁴¹ - Liu P, Oyajobi BO, Russell RG, Scutt A. Regulation of osteogenic differentiation of human bone marrow stromal cells: interaction between transforming growth factor-beta and 1,25(OH)(2) vitamin D(3) in vitro. Calcif Tissue Int. 1999;65(2):173-80. doi: 10.1007/s002239900678
  » https://doi.org/10.1007/s002239900678
• ⁴² - Ciavarella S, Dammacco F, De Matteo M, Loverro G, Silvestris F. Umbilical cord mesenchymal stem cells: role of regulatory genes in their differentiation to osteoblasts. Stem Cells Dev. 2009;18(8):1211-20. doi: 10.1089/scd.2008.0340
  » https://doi.org/10.1089/scd.2008.0340
• ⁴³ - Orimo H, Shimada T. The role of tissue-nonspecific alkaline phosphatase in the phosphate-induced activation of alkaline phosphatase and mineralization in SaOS-2 human osteoblast-like cells. Mol Cell Biochem. 2008;315(1-2):51-60. doi: 10.1007/s11010-008-9788-3
  » https://doi.org/10.1007/s11010-008-9788-3
• ⁴⁴ - Jensen ED, Gopalakrishnan R, Westendorf JJ. Regulation of gene expression in osteoblasts. Biofactors. 2010;36(1):25-32. doi: 10.1002/biof.72
  » https://doi.org/10.1002/biof.72
• ⁴⁵ - Katz JM, Nataraj C, Jaw R, Deigl E, Bursac P. Demineralized bone matrix as an osteoinductive biomaterial and in vitro predictors of its biological potential. J Biomed Mater Res B Appl Biomater. 2009;89(1):127-34. doi: 10.1002/jbm.b.31195
  » https://doi.org/10.1002/jbm.b.31195
• ⁴⁶ - Kasten P, Luginbühl R, van Griensven M, Barkhausen T, Krettek C, Bohner M, et al. Comparison of human bone marrow stromal cells seeded on calcium-deficient hydroxyapatite, beta-tricalcium phosphate and demineralized bone matrix. Biomaterials. 2003;24(15):2593-603. doi: 10.1016/s0142-9612(03)00062-0
  » https://doi.org/10.1016/s0142-9612(03)00062-0
• ⁴⁷ - Franceschi RT, Ge C, Xiao G, Roca H, Jiang D. Transcriptional regulation of osteoblasts. Ann N Y Acad Sci. 2007;1116:196-207. doi: 10.1196/annals.1402.081
  » https://doi.org/10.1196/annals.1402.081
• ⁴⁸ - Kaji H, Naito J, Sowa H, Sugimoto T, Chihara K. Smad3 differently affects osteoblast differentiation depending upon its differentiation stage. Horm Metab Res. 2006;38(11):740-5. doi: 10.1055/s-2006-955085
  » https://doi.org/10.1055/s-2006-955085
• ⁴⁹ - Hinoi E, Fujimori S, Wang L, Hojo H, Uno K, Yoneda Y. Nrf2 negatively regulates osteoblast differentiation via interfering with RUNX2-dependent transcriptional activation. J Biol Chem. 200630;281(26):18015-24. doi: 10.1074/jbc.M600603200
  » https://doi.org/10.1074/jbc.M600603200
• ⁵⁰ - Komori T. Regulation of bone development and extracellular matrix protein genes by RUNX2. Cell Tissue Res. 2010;339(1):189-95. doi: 10.1007/s00441-009-0832-8
  » https://doi.org/10.1007/s00441-009-0832-8

• Data availability statement:
  The datasets generated during and/or analyzed during the current study are available in the SciELO Data repository, https://doi.org/10.48331/scielodata.EYNIXB.
• *
  This article is derived from a master’s dissertation

Edited by

• Editor:
  Ana Carolina Magalhães

• Associate Editor:
  Joel Ferreira Santiago Junior

Data availability

The datasets generated during and/or analyzed during the current study are available in the SciELO Data repository, https://doi.org/10.48331/scielodata.EYNIXB.

Publication Dates

• Publication in this collection
  22 Nov 2024
• Date of issue
  2024

History

• Received
  16 Apr 2024
• Reviewed
  09 Sept 2024
• Accepted
  24 Sept 2024