Genetic Variability and Antimicrobial Resistance Profile of Malaysian M. Gallisepticum and M. Synoviae Poultry Isolates

ABSTRACT

M. gallisepticum (MG) and M. synoviae (MS) infections are among the most common and complicated respiratory diseases in birds. The infections can cause a huge loss of production performance in different types of poultry farming, including broilers and layers. Avian mycoplasmosis in Malaysia was detected many years ago, but there is a paucity of information on its genetic variability and antimicrobial susceptibility profile. Therefore, this study was carried out to isolate, molecular characterize, and determine the antimicrobial minimum inhibitory concentration of Malaysian MG and MS poultry isolates. A total of 492 choanal swab samples were collected from different poultry farms and subjected to isolation and PCR. Using immunofluorescence assay, 36.4% (179/492) MG and MS isolates were detected, out of which 26.8% (48/179) samples yielded MG colonies, and 73.2% (131/179) samples yielded MS colonies. Using PCR, a higher number of MG and MS were detected. M. gallisepticum was detected in 28% (138/492) of samples, while 61.2% (301/492) of samples were positive by PCR for MS. Phylogenetic analysis of the MG local isolates showed an identical pattern in both pvpA and mgc2 genes with MG strain F. M. synoviae field isolates shared an identical pattern of vlhA gene with the MS strain MS-H. The isolates had the highest resistance to erythromycin, lincomycin, and chlortetracycline. The high number of positive MG and MS infections is suggestive of the continuous circulation of these pathogens among poultry in Malaysia. Therefore, continuous monitoring of the susceptibility profile of isolates to ensure effective treatment dosage is highly recommended.

Keywords: Antimicrobial resistance; characterization; M. gallisepticum; M. synoviae; phylogenetics

INTRODUCTION

Mycoplasma gallisepticum (MG) is among the common causative agents of respiratory disease in birds in Malaysia (Zahraa et al., 2011; Taiyari et al., 2023). M. gallisepticum can cause considerable economic losses to poultry industries via reduction in production performance of infected chickens (Burnham et al., 2003; Parker et al., 2003; Winner et al., 2003). Like MG, Mycoplasma synoviae (MS) infection could also cause huge economic losses to the production level of poultry industries (Ferguson-noel & Noormohammadi, 2013). M. synoviae can spread faster than MG, and it can cause synovitis, in addition to respiratory disease (Ferguson-noel & Noormohammadi, 2013). Chickens infected by MG and MS suffer from respiratory problems that lead to reduced egg production and weight gain (Marouf et al., 2020). In addition, MG and MS are vertically transmitted pathogens that can cause embryonic mortality and reduction in hatchability of eggs (Bencina et al., 1988a, 1988b; Raviv & Ley, 2013).

The detection of MG and MS infections is done via culture, serological and molecular techniques. The culture technique includes the isolation and subsequent identification using immunofluorescence staining. Although the culture technique is laborious and time-consuming, its capability to identify all mycoplasma species with high specificity is still paramount (Levisohn & Kleven, 2000). Polymerase chain reaction (PCR) offers a rapid and convenient diagnosis of pathogenic mycoplasmas. However, a few studies reported false diagnosis of MG by PCR (Kempf et al., 1997; Ganapathy & Bradbury, 1999). The products of PCR can be used for genotyping and phylogenetic analysis of the isolates. Gene-targeted sequencing (GTS) is a reproducible typing method with satisfactory discriminatory power to separate isolates (Ferguson et al., 2005). In Malaysia, studies have reported a high occurrence of mycoplasmosis in poultry farms (Zahraa et al., 2011). Previous phylogenetic analysis of Malaysian MG field isolates were identical to F and S6 strains based on pMGA and pvpA partial gene sequencing (Yasmin et al., 2018).

Despite all the efforts to control MG infection in Malaysia, previous studies have reported its high occurrence in poultry farms (Yasmin et al., 2014). Antimicrobial medication is one of the main control strategies for poultry mycoplasmosis (Kleven, 2008). Mycoplasmas do not have a cell wall, and are therefore resistant to β-lactam antibiotics such as penicillins or cephalosporins. Macrolides, tetracyclines, and fluoroquinolones are considered to be effective to treat avian mycoplasmosis (Kleven, 2008). In vitro determination of the antimicrobial susceptibility profile of avian mycoplasmas was described by Hannan (2000). Although mycoplasmas tend to be susceptible to macrolides, tetracyclines, and fluoroquinolones, there is a growing trend of resistance development against enrofloxacin, tylosin, erythromycin, and oxytetracycline (Taiyari et al., 2021). Unfortunately, there is a paucity of data on the antimicrobial susceptibility profile of Malaysian MG and MS isolates. Therefore the aim of this study is to isolate, molecular characterize, and determine the antimicrobial susceptibility profile of Malaysian MG and MS field isolates.

MATERIALS AND METHODS

Sample Collection

A total of 492 choanal slit samples were collected from six broiler breeder farms and six layer farms. These farms were different in herd size and were located in five different states of Peninsular Malaysia. To control MG infection, Live F strain vaccine were used in these farms. No MS vaccination protocol were used in these farms. Samples were collected from chickens with clinical signs related to avian mycoplasmosis. All of the sampling procedures and the number of samples were approved by the Institutional Animal Care and Use Committee (IACUC) (UPM/IACUC/AUP-R069/2019). For identification of the isolates and further characterization, M. gallisepticum PG31 reference strain and M. synoviae WVU 1853 were obtained from ATCC.

Isolation and Identification

The isolation protocol and preparation of the type of medium used for isolation were adapted from Ferguson-noel & Kleven (2016). Frey medium with 15% swine serum (FMS) was used to isolate MG and MS. After swabbing the choanal slit, swab samples were inoculated into the FMS broth medium. Once broth medium changed color during incubation, samples were subjected to agar inoculation. Plates with colonies were assayed using a stereomicroscope. Tiny, smooth colonies of 0.1-0.5 mm diameter with dense, elevated centers with a “fried egg appearance” were considered mycoplasmal colonies. The identification of MG and MS colonies was respectively made using direct and indirect immunofluorescence assay (IFA), according to Ferguson-noel & Kleven (2016). The direct immunofluorescence technique was used to identify MG by using a high-titer MG specific rabbit polyclonal antibody (IgG) conjugated with Alexa fluor 488 (Bioss Antibodies, USA). The indirect immunofluorescence technique was used for the identification of MS. The MS-specific chicken polyclonal antibody (IgY) was used as the primary antibody. For the secondary antibody, goat anti-chicken IgY conjugated with Phycoerythrin (PE) was used (Abcam, UK). After IFA staining, the agar blocks were viewed using a fluorescence microscope (Figure 1).

Figure 1
Immunofluorescence (IF) staining of MG and MS colonies. (a) Alexa fluor 488 stained the MG colonies bright green (apple green); (b) Phycoerythrin (PE) was used for MS colonies and stained the colonies red.

Molecular Detection and Characterization

In addition to isolation, samples were also tested for MG and MS using multiplex species-specific PCR targeting 16S rRNA (Moscoso et al., 2004). Two sets of primers targetting 16S rRNA gene of MG ( MG-16S rRNA F:5´-GAC CTA ATC TGT AAA GTT GGT C-3´; MG-16S rRNA R:5´-GCT TCC TTG CGG TTA GCA AC-3´) and MS (MS-16S rRNA F:5’ -GAG AAG CAA AAT AGT GAT ATC A- 3’; MS-16S rRNA R:5’ -CAG TCG TCT CCG AAG TTA ACA A- 3’) were used for molecular identification. Extraction of DNA was done using the QIAGEN extraction kit (QIAamp DNA Mini Kit). The reaction solution was prepared at 25µl. Initial denaturation was at 94°C for 5 min, followed by 35 cycles of 94°C for 30 sec, 55°C for 30 sec, and 72°C for 30 sec. A final extension was performed at 72°C for 5 min.

For molecular characterization, positive cultures of MG and MS were subjected to strain-specific PCR assays. Strain-specific PCR assays were designed to target single genomic loci of virulence genes. For MG, mgc2 and pvpA cytadhesin genes were amplified in order to molecular characterize the isolates. For MS, the vlhA hemagglutinin gene was amplified for molecular characterization. Fifteen MG and twenty MS isolates were subjected to a strain-specific PCR assay. The sequences of primers used for strain-specific PCR are shown in Table 1. For the mgc2 gene, initial denaturation was at 94°C for 5 min followed by 35 cycles of 94°C for 30 sec, 58°C for 30 sec, and 72°C for 60 sec, and final extension was performed at 72°C for 5 min. For the pvpA gene, initial denaturation was at 94°C for 5 min, followed by 35 cycles of 94°C for 60 sec, 55°C for 60 sec, and 72°C for 90 sec, and final extension was performed at 72°C for 5 min. For the vlhA gene, initial denaturation was at 95°C for 5 min, followed by 40 cycles of 95°C for 30 sec, 55°C for 30 sec, and 72°C for 90 sec, and final extension was performed at 72°C for 15 min. PCR products were purified and then sequenced using Sanger sequencing. Sequences of virulent genes were first aligned and then subjected to phylogenetic analysis using the MEGA 7 software.

Table 1
Strain-specific primers used in the PCR assay.

Target gene	Primers sequence	Amplicon size
mgc2	F: CGCAATTTGGTCCTAATCCCCAACA	300 bp-860 bp
	R: TAAACCCACCTCCAGCTTTATTTCC
pvpA	F: GCCAMTCCAACTCAACAAGCTGA	430 bp-660 bp
	R: GGACGTSGTCCTGGCTGGTTAGC
vlhA	F: GAT GCG TAA AAT AAA AGG AT	316 bp-394 bp
	R: GCT TCT GTT GTA GTT GCT TC

Antimicrobial Susceptibility Profile

For the determination of antimicrobial susceptibility profile of MG and MS isolates, microdilution minimum inhibitory concentration (MIC) assay was employed, according to Hannan (2000). Customized sensititer plates were obtained from Thermo Fischer (CMP1VEAH). Briefly, after the preparation of pure cultures using inoculation techniques and immunofluorescence staining, stock pure cultures were preserved by adding 5% of v/v sterile glycerol. Stock cultures were then used to perform viable counting. Once MG or MS field isolates reached 10⁴ color changing units (ccu) in the viable counting stage, microdilution MIC plates were inoculated. To determine the MIC value of the field isolates, the plates were monitored three times per day for up to 72 hours for the initial MIC value. For the validation of the MIC test, the MG PG31 ATCC reference strain was subjected to MIC assay, and its MIC values were compared with previous studies.

RESULTS

Isolation and Identification

Both isolation and PCR techniques were used to detect MG and MS. A total of 179 MG and MS were isolated from 492 samples. The result of isolation and PCR detection is shown in Table 2. Using the immunofluorescence assay, 48 isolates were identified as MG isolates, and 131 were identified as MS isolates. 11 samples had both MG and MS isolates. Using PCR, MG and MS were detected in 27.6% (136/492) and 61.2% (301/492) of samples, respectively. Twenty-six samples were positive for both MG and MS by PCR.

Table 2
Isolation and PCR assay result of the samples.

Farm ID	No Samples	MG isolates (%)	MG PCR (%)	MS isolates (%)	MS PCR (%)
ABB	45	10 (22%)	25 (56%)	38 (84%)	41 (91%)
BBB	75	0	5 (7%)	0	56 (75%)
CBB	75	0	2 (3%)	0	24 (32%)
DBB	45	0	18 (40%)	29 (64%)	38 (84%)
EBB	60	20 (33%)	33 (55%)	0	8 (13%)
FBB	30	0	0	13 (43%)	30 (100%)
GL	10	2 (20%)	5 (50%)	6 (60%)	8 (80%)
HL	45	7 (16%)	18 (40%)	19 (42%)	32 (71%)
IL	40	5 (13%)	16 (40%)	17 (43%)	25 (63%)
JL	13	0	2 (15%)	0	6 (46%)
KL	24	4 (17%)	14 (58%)	5 (21%)	16 (67%)
LL	30	0	0	4 (13%)	17 (57%)
Total	492	48	136	131	301

• ^B
  ^B broiler breeder; ^L layer

Genetic Variability of Isolates

The sequences of strain-specific PCR products were further analyzed by constructing the phylogenetic tree. The phylogenetic trees of MG and MS field isolates were constructed based on the mgc2, pvpA, and vlhA genes (GenBank accession numbers: OP957010, OP957011, OP957012, OP957013, OP957014, OP957015, OP957016, PP277658 and PP277659) (Figure 2, Figure 3, and Figure 4). Figure 2 portrays the identical pattern of the MG isolates to the reference F strain based on the mgc2 gene. According to the gene-targeted sequencing of the pvpA gene (Figure 3), MG isolates were identical to the reference F strain. Phylogenetic analysis of the MS isolates based on the vlhA gene showed an identical pattern between the field isolates and the MS-H reference strain (Figure 4).

Figure 2
Phylogenetic tree of MG field isolates based on the mgc2 gene using neighbor joining algorithm (rooted). PAK: Pakistan; SARA: Saudi Arabia; IND: India; PAN: Panama; EGY: Egypt; ITA: Italy; UK: United Kingdom; ALG: Algeria; ISR: Israel; THA: Thailand; GUA: Guatemala; VEN: Venezuela; ECUA: Ecuador; BANG: Bangladesh; USA: United States of America; RUS: Russia; JOR: Jordan.

Figure 3
Phylogenetic tree of MG field isolates based on the pvpA gene using neighbor joining algorithm (rooted). THA: Thailand; SARA: Saudi Arabia; AUS: Australia; ISR: Israel; ITA: Italy; RUS: Russia; CHN: China; IRN: Iran.

Figure 4
Phylogenetic tree of MS field isolates based on the vlhA gene using neighbor joining algorithm (rooted). BRA: Brazil; JPN: Japan; ISR: Israel; POL: Poland; NLD: Netherlands; ITA: Italy; FRA: France; SPN: Spain; CHN: China; AUS: Australia; USA: United States of America.

Antimicrobial Susceptibility

Antimicrobial susceptibility profile of the isolates was determined by comparing their microdilution MIC values (Table 3) with clinical breakpoints or cut-off points. Four MG and 2 MS isolates were subjected to antimicrobial minimum inhibitory concentration assay.

Table 3
MIC values of antibiotics against MG and MS isolates.

Strain	MIC (µg/ml)
	TIL	TIA	ENRO	DOX	ERY	LIN	CTET	TVN	TYLT
MG PG31	≤0.06	≤0.015	≤0.03	0.12	≤0.12	8	2	0.03	≤0.06
MG PMY1	≤0.06	0.06	2	0.5	64	0.5	8	0.03	0.12
MG PMY2	≤0.06	≤0.015	0.12	0.5	0.5	2	1	≤0.015	≤0.06
MG PMY3	≤0.06	≤0.015	0.12	0.25	0.5	2	4	≤0.015	≤0.06
MG PMY4	≤0.06	≤0.015	0.12	0.25	≤0.012	4	4	≤0.015	≤0.06
MS PMY1	≤0.06	0.12	0.25	≤0.06	64	0.5	4	0.03	≤0.06
MS PMY2	≤0.06	0.25	0.25	0.25	64	2	8	0.12	0.25

• TIL: Tilmicosin; TIA: Tiamulin; ENRO: Enrofloxacin; DOX: Doxycycline; ERY: Erythromycin; LIN: Lincomycin; CTET: Chlortetracycline; TVN: Tylvalosin; TYLT: Tylosin

DISCUSSION

A higher number of positives were detected for both MG and MS using PCR assay in comparison to the isolation technique (437 vs 179). This indicates the higher sensitivity of PCR in the detection of MG and MS from field samples (Amores et al., 2010). Similarly, experimental studies designed to compare the diagnostic techniques for avian mycoplasmosis showed significant differences between PCR and culture in diagnosing MG and MS (Salisch et al., 1998; Feberwee et al., 2005). Polymerase chain reaction assay was found to be fast, cheap, and sensitive in the detection of MG and MS (Feberwee et al., 2005). However, PCR results are not reliable in detecting atypical MG strain infections or Mycoplasma imitans infections (Kempf et al., 1997; Ganapathy & Bradbury, 1999). In this study, PCR could not differentiate active infections from inactive infections. This finding was observed in samples collected from a recently treated broiler breeder farm, where there were no samples detected as positive for MG and MS by the culture technique. However, numerous samples were positive for MG and MS via PCR (data not shown). Therefore, in a field assessment, culture should always accompany PCR assay to prevent such problems.

In this study, a higher number of MS was detected using both culture and PCR techniques compared to MG. In general, it is believed that MS can spread faster than MG, making it more prevalent (Olson & Kerr, 1967), as the outcomes of this study show. However, previous studies in Malaysia detected more MG than MS (Tan et al., 2005; Ahmad, 2012). In the study conducted by Tan et al. (2005), 11% of the samples were positive for MG by culture, and 3% were positive for MS. Similarly, in the study conducted by Ahmad (2012), MG was detected more than MS using both culture (9% vs. 2%) and PCR (24% vs. 5.6%). The increase in the number of MS infections in recent years could be due to several factors. The wide use of vaccination and antimicrobial treatment against MG could be one of the possible factors, paving the way for the faster spread of MS. Another factor that could lead to an increase in MS number is the organism’s long-term survival in environmental samples such as litter (Marois et al., 2000, 2005). This factor is highly associated with the management system of the farm. In other words, the reuse of litter could increase the risk of MS infection. The isolation of both MG and MS from a sample was found more often in layer chicken samples than in broiler breeder samples, which might be explained by the higher stocking density in layer farms.

To further characterize the isolates, virulent genes of both MG and MS were subjected to sequencing. These genes were inclusive of mgc2 and pvpA for MG, and the vlhA gene for MS, which have been used to characterize MG and MS isolates (Boguslavsky et al., 2000; Liu et al., 2001; Garcia et al., 2005; El-Gazzar et al., 2012; Yasmin, 2013). Different strains of MG and MS have varied gene sizes, and only a single copy of this gene can be found in the bacterial genome. This study showed that four of the field MG isolates were grouped in the same cluster of the vaccine F strain. The findings of this study are similar to another study that reported the close relationship of MG positive samples with the MG F strain (Zahraa et al., 2011; Yasmin, 2013). According to the gene-targeted sequencing of mgc2, all isolates were 100% identical. However, upon targeting the pvpA gene, one of the poultry isolates was slightly different from the others. This difference could be due to the more polymorphic nature of the pvpA gene (Jiang et al., 2009). Although mgc2 is one of the recommended genes for MG molecular detection, some MG isolates could not produce bands in the gel electrophoresis of mgc2 in this study. Similarly, some MG isolates could not be characterized based on the pvpA gene in this study. The pvpA gene has been used to characterize MG isolates (Liu et al., 2001). These studies, however, amplified the gene using nested PCR. For MS, two isolates were successfully sequenced based on the vlhA gene. Both isolates had an identical pattern to the MS-H reference strain. Many MS isolates did not show any band in the gel electrophoresis of the vlhA PCR product. The vlhA gene is the most commonly used gene for targeted sequence typing of MS strains. However, some factors can cause failure in the targeted sequence typing of MS isolates based on the vlhA gene. These factors include the length of the amplicon, level of homogeneity, the possibility of multiple bands, and virulent strains (May & Brown, 2011; El-Gazzar et al., 2012).

The MIC values of MG PG31 were similar to Hannan (2000), indicating the validity of the MIC tests. In this study, tylvalosin was found to be the most effective antibiotic to treat avian mycoplasmosis. Similar findings have been observed in Thailand, Egypt, Iran, and Europe (Pakpinyo & Sasipreeyajan, 2007; Behbahan et al., 2008; Kreizinger et al., 2017; El-Hamid et al., 2019). All of the isolates tested for their antimicrobial susceptibility profiles were susceptible to tiamulin. It has also been found that MG and MS do not develop resistance after 10 passages in a sub-inhibitory concentration of tiamulin (Nhung et al., 2017). A high number of isolates were resistant to macrolides (erythromycin and lincomycin). Similar findings have been observed in Egypt and Iran (Behbahan et al., 2008; El-Hamid et al., 2019). The fast development of resistance against macrolides has been reported by Gautier-Bouchardon et al. (2002), suggesting a mechanism of natural resistance, as already observed in Mycoplasma hominis (Furneri et al., 2000). Twenty percent of isolates in this study were resistant to enrofloxacin. Although it has been found that there is a quinolone resistance determining region in the genome of mycoplasmas, it has been found that MG develops resistance towards enrofloxacin gradually and slower in comparison to macrolides (Gautier-Bouchardon et al., 2002). Among tetracyclines, chlortetracycline had the highest number of resistant isolates, which is consistent with studies from Thailand and Egypt (Pakpinyo & Sasipreeyajan, 2007; El-Hamid et al., 2019). Chlortetracycline is believed to be used more frequently, and has been introduced for longer periods (Pakpinyo & Sasipreeyajan, 2007). Studies investigating the mutation in MG isolates have shown that MG can develop resistance against antimicrobial agents, especially macrolides and quinolones (Wu et al., 2005; Li et al., 2010; Lysnyansky et al., 2012; Taiyari et al., 2021). This study also reported a similar outcome, whereby the highest number of resistant isolates was related to erythromycin.

CONCLUSION

This study shows that MG and MS infections are still a problem among poultry in Malaysia. A higher occurrence of MS was observed in this study compared to previous studies conducted in the country. Phylogenetic analysis of the isolates indicated that MG isolates are in the same cluster of the MG F strain, and MS isolates are in the same cluster of the MS MS-H strain. Differences in the MIC values of isolates in the same cluster indicate the lack of an optimized treatment regime. The detection of AMR isolates highlights the need for a prudent use of antibiotics in Malaysia, and for antimicrobial sensitivity tests prior to the treatment of any infections.

ACKNOWLEDGEMENTS

The study was supported by the Institute of Biosciences, Higher Institution Centre of Excellence (JBS HICoE) Grant No 6369101 from the Ministry of Higher Education (MOHE), Government of Malaysia.

REFERENCES

• Abd El-Hamid MI, Awad NF, Hashem YM, et al. In vitro evaluation of various antimicrobials against field Mycoplasma gallisepticum and Mycoplasma synoviae isolates in Egypt. Poultry Science 2019;98(12):6281-8. https://doi.org/10.3382/ps/pez576
  » https://doi.org/10.3382/ps/pez576
• Ahmad K. Detection and molecular characterization of Mycoplasma gallisepticum and Mycoplasma synoviae from commercial chickens in Malaysia [dissertation]. Selangor (MYS): Universiti Putra Malaysia; 2012.
• Amores J, Corrales JC, Martín ÁG, et al. Comparison of culture and PCR to detect Mycoplasma agalactiae and Mycoplasma mycoides subsp. capri in ear swabs taken from goats. Veterinary Microbiology 2010;140(1-2):105-8. https://doi.org/10.1016/j.vetmic.2009.06.036
  » https://doi.org/10.1016/j.vetmic.2009.06.036
• Behbahan NG, Asasi K, Afsharifar AR, et al. Susceptibilities of Mycoplasma gallispeticum and Mycoplasma synoviae isolates to antimicrobial agents in vitro. International Journal of Poultry Science 2008;7(11):1058-64. https://doi.org/10.3923/ijps.2008.1058.1064
  » https://doi.org/10.3923/ijps.2008.1058.1064
• Bencina D, Tadina T, Dorrer D. Natural infection of ducks with Mycoplasma synoviae and Mycoplasma gallisepticum and Mycoplasma egg transmission. Avian Pathology 1988b;17(2):441-9. https://doi.org/10.1080/03079458808436462
  » https://doi.org/10.1080/03079458808436462
• Bencina D, Tadina T, Dorrer D. Natural infection of geese with Mycoplasma gallisepticum and Mycoplasma synoviae and egg transmission of the mycoplasmas. Avian Pathology 1988a;17(4):925-8. https://doi.org/10.1080/03079458808436514
  » https://doi.org/10.1080/03079458808436514
• Boguslavsky S, Menaker D, Lysnyansky I, et al. Molecular characterization of the Mycoplasma gallisepticum pvpA gene which encodes a putative variable cytadhesin protein. Infection and Immunity 2000;68(7):3956-64. https://doi.org/10.1128/iai.68.7.3956-3964.2000
  » https://doi.org/10.1128/iai.68.7.3956-3964.2000
• Burnham MR, Peebles ED, Branton SL, et al. Effects of F-strain Mycoplasma gallisepticum inoculation at twelve weeks of age on the blood characteristics of commercial egg laying hens. Poultry Science 2003;82(9):1397-402. https://doi.org/10.1093/ps/82.9.1397
  » https://doi.org/10.1093/ps/82.9.1397
• El-Gazzar MM, Wetzel AN, Raviv Z. The genotyping potential of the Mycoplasma synoviae vlhA gene. Avian Diseases 2012;56(4):711-9. https://doi.org/10.1637/10200-041212-Reg.1
  » https://doi.org/10.1637/10200-041212-Reg.1
• Feberwee A, Mekkes DR, De Wit JJ, et al. Comparison of culture, PCR, and different serologic tests for detection of Mycoplasma gallisepticum and Mycoplasma synoviae infections. Avian Diseases 2005;49(2):260-8. https://doi.org/10.1637/7274-090804R
  » https://doi.org/10.1637/7274-090804R
• Ferguson NM, Hepp D, Sun S, et al. Use of molecular diversity of Mycoplasma gallisepticum by gene-targeted sequencing (GTS) and random amplified polymorphic DNA (RAPD) analysis for epidemiological studies. Microbiology 2005;151(6):1883-93. https://doi.org/10.1099/mic.0.27642-0
  » https://doi.org/10.1099/mic.0.27642-0
• Ferguson-noel N, Kleven SH. Mycoplasma species. In: Williams SM, Dufour-Zavala L, Jackwood MW, et al. A laboratory manual for the isolation, identification, and characterization of avian pathogens. 6th ed. Jacksonville: American Association of Avian Pathologists; 2016 p.63-70.
• Ferguson-noel N, Noormohammadi AH. Mycoplasma synoviae infection. In: Swayne DE, Glisson JR, McDougald LR, et al. Diseases of poultry. 13th ed. Iowa: Iowa State University Press; 2013 p.875-943.
• Furneri PM, Rappazzo G, Musumarra MP, et al. Genetic basis of natural resistance to erythromycin in Mycoplasma hominis. Journal of Antimicrobial Chemotherapy 2000;45(4):547-8. https://doi.org/10.1093/jac/45.4.547
  » https://doi.org/10.1093/jac/45.4.547
• Ganapathy K, Bradbury JM. Pathogenicity of Mycoplasma imitans in mixed infection with infectious bronchitis virus in chickens. Avian Pathology 1999;28(3):229-37. https://doi.org/10.1080/03079459994713
  » https://doi.org/10.1080/03079459994713
• García M, Ikuta N, Levisohn S, et al. Evaluation and comparison of various PCR methods for detection of Mycoplasma gallisepticum infection in chickens. Avian Diseases 2005;49(1):125-32. https://doi.org/10.1637/7261-0812204R1
  » https://doi.org/10.1637/7261-0812204R1
• Gautier-Bouchardon AV, Reinhardt AK, Kobisch M, et al. In vitro development of resistance to enrofloxacin, erythromycin, tylosin, tiamulin and oxytetracycline in Mycoplasma gallisepticum, Mycoplasma iowae and Mycoplasma synoviae. Veterinary Microbiology 2002;88(1):47-58. https://doi.org/10.1016/S0378-1135(02)00087-1
  » https://doi.org/10.1016/S0378-1135(02)00087-1
• Hannan P. Guidelines and recommendations for antimicrobial minimum inhibitory concentration (MIC) testing against veterinary mycoplasma species. Veterinary Research 2000;31(4):373-95. https://dx.doi.org/10.1051/vetres:2000100
  » https://dx.doi.org/10.1051/vetres:2000100
• Jiang HX, Chen JR, Yan HL, et al. Molecular variability of DR-1 and DR-2 within the pvpA gene in Mycoplasma gallisepticum isolates. Avian Diseases 2009;53(1):124-8. https://doi.org/10.1637/8338-042908-ResNote.1
  » https://doi.org/10.1637/8338-042908-ResNote.1
• Kempf I, Gesbert F, Guittet M. Experimental infection of chickens with an atypical Mycoplasma gallisepticum strain: comparison of diagnostic methods. Research in Veterinary Science 1997;63(3):211-3. https://doi.org/10.1016/S0034-5288(97)90022-9
  » https://doi.org/10.1016/S0034-5288(97)90022-9
• Kleven SH. Control of avian mycoplasma infections in commercial poultry. Avian Diseases 2008;52(3):367-74. https://doi.org/10.1637/8323-041808-Review.1
  » https://doi.org/10.1637/8323-041808-Review.1
• Kreizinger Z, Grózner D, Sulyok KM, et al. Antibiotic susceptibility profiles of Mycoplasma synoviae strains originating from Central and Eastern Europe. BMC Veterinary Research 2017;13:1-10. https://doi.org/10.1186/s12917-017-1266-2
  » https://doi.org/10.1186/s12917-017-1266-2
• Levisohn S, Kleven SH. Avian mycoplasmosis (Mycoplasma gallisepticum). Revue Scientifique et Technique 2000;19(2):425-42. Available from: https://europepmc.org/article/med/10935272
  » https://europepmc.org/article/med/10935272
• Li BB, Shen JZ, Cao XY, et al. Mutations in 23S rRNA gene associated with decreased susceptibility to tiamulin and valnemulin in Mycoplasma gallisepticum. FEMS Microbiology Letters 2010;308(2):144-9. https://doi.org/10.1111/j.1574-6968.2010.02003.x
  » https://doi.org/10.1111/j.1574-6968.2010.02003.x
• Liu T, Garcia M, Levisohn S, et al. Molecular variability of the adhesin-encoding gene pvpA among Mycoplasma gallisepticum strains and its application in diagnosis. Journal of Clinical Microbiology 2001;39(5):1882-8. https://doi.org/10.1128/jcm.39.5.1882-1888.2001
  » https://doi.org/10.1128/jcm.39.5.1882-1888.2001
• Lysnyansky I, Gerchman I, Levisohn S, et al. Discrepancy between minimal inhibitory concentration to enrofloxacin and mutations present in the quinolone-resistance determining regions of Mycoplasma gallisepticum field strains. Veterinary Microbiology 2012;160(1-2):222-6. https://doi.org/10.1016/j.vetmic.2012.05.002
  » https://doi.org/10.1016/j.vetmic.2012.05.002
• Marois C, Oufour-Gesbert F, Kempf I. Detection of Mycoplasma synoviae in poultry environment samples by culture and polymerase chain reaction. Veterinary Microbiology 2000;73(4):311-8. https://doi.org/10.1016/S0378-1135(00)00178-4
  » https://doi.org/10.1016/S0378-1135(00)00178-4
• Marois C, Picault JP, Kobisch M, et al. Experimental evidence of indirect transmission of Mycoplasma synoviae. Veterinary Research 2005;36(5/6):759-69. https://dx.doi.org/10.1051/vetres:2005031
  » https://dx.doi.org/10.1051/vetres:2005031
• Marouf S, Moussa IM, Salem H, et al. A picture of Mycoplasma gallisepticum and Mycoplasma synoviae in poultry in Egypt: phenotypic and genotypic characterization. Journal of King Saud University-Science 2020;32(3):2263-8. https://doi.org/10.1016/j.jksus.2020.02.036
  » https://doi.org/10.1016/j.jksus.2020.02.036
• May M, Brown DR. Diversity of expressed vlhA adhesin sequences and intermediate hemagglutination phenotypes in Mycoplasma synoviae. Journal of Bacteriology 2011;193(9):2116-21. https://doi.org/10.1128/jb.00022-11
  » https://doi.org/10.1128/jb.00022-11
• Moscoso H, Thayer SG, Hofacre CL, et al. Inactivation, storage, and PCR detection of mycoplasma on FTA(r) filter paper. Avian Diseases 2004;48(4):841-50. https://doi.org/10.1637/7215-060104
  » https://doi.org/10.1637/7215-060104
• Nhung NT, Chansiripornchai N, Carrique-Mas JJ. Antimicrobial resistance in bacterial poultry pathogens: a review. Frontiers in Veterinary Science 2017;10;4:126. https://doi.org/10.3389/fvets.2017.00126
  » https://doi.org/10.3389/fvets.2017.00126
• Olson NO, Kerr KM. The duration and distribution of synovitis-producing agents in chickens. Avian Diseases 1967;11(4):578-85. https://doi.org/10.2307/1588298
  » https://doi.org/10.2307/1588298
• Pakpinyo S, Sasipreeyajan J. Molecular characterization and determination of antimicrobial resistance of Mycoplasma gallisepticum isolated from chickens. Veterinary Microbiology 2007;125(1-2):59-65. https://doi.org/10.1016/j.vetmic.2007.05.011
  » https://doi.org/10.1016/j.vetmic.2007.05.011
• Parker TA, Branton SL, Jones MS, et al. Effects of an S6 strain of Mycoplasma gallisepticum challenge at onset of lay on digestive and reproductive tract characteristics in commercial layers. Avian Diseases 2003;47(1):96-100. https://doi.org/10.1637/0005-2086(2003)047[0096:EOASSO]2.0.CO;2
  » https://doi.org/10.1637/0005-2086(2003)047[0096:EOASSO]2.0.CO;2
• Raviv Z, Ley DH. Mycoplasma gallisepticum infection. In: Swayne DE, Glisson JR, McDougald LR, et al. Diseases of poultry. 13th ed. Iowa: Iowa State University Press; 2013. p.877- 93.
• Salisch H, Hinz KH, Graack HD, et al. A comparison of a commercial PCR-based test to culture methods for detection of Mycoplasma gallisepticum and Mycoplasma synoviae in concurrently infected chickens. Avian Pathology 1998;27(2):142-7. https://doi.org/10.1080/03079459808419315
  » https://doi.org/10.1080/03079459808419315
• Taiyari H, Abu J, Faiz NM, et al. Genetic variability and antimicrobial susceptibility profile of Mycoplasma gallisepticum and antimicrobial susceptibility profile of Mycoplasma synoviae isolated from various bird species in Peninsular Malaysia. Pertanika Journal of Tropical Agricultural Science 2023;46(4):1245-1257. https://doi.org/10.47836/pjtas.46.4.11
  » https://doi.org/10.47836/pjtas.46.4.11
• Taiyari H, Faiz NM, Abu J, et al. Antimicrobial minimum inhibitory concentration of Mycoplasma gallisepticum: a systematic review. Journal of Applied Poultry Research 2021;30(2):100160. https://doi.org/10.1016/j.japr.2021.100160
  » https://doi.org/10.1016/j.japr.2021.100160
• Tan CG, Aini I, Salim NB, et al. Prevalence of Mycoplasma gallisepticum and Mycoplasma synoviae in commercial and village chickens in Penang. Proceedings of 11th International Conference of The Association of Institutions for Tropical Veterinary Medicine; 2005. Petaling Jaya, Malaysia; 2005.
• Winner F, Markova I, Much P, et al. Phenotypic switching in Mycoplasma gallisepticum hemadsorption is governed by a high-frequency, reversible point mutation. Infection and Immunity 2003;71(3):1265-73. https://doi.org/10.1128/iai.71.3.1265-1273.2003
  » https://doi.org/10.1128/iai.71.3.1265-1273.2003
• Wu CM, Wu H, Ning Y, et al. Induction of macrolide resistance in Mycoplasma gallisepticum in vitro and its resistance-related mutations within domain V of 23S rRNA. FEMS Microbiology Letters 2005;247(2):199-205. https://doi.org/10.1016/j.femsle.2005.05.012
  » https://doi.org/10.1016/j.femsle.2005.05.012
• Yasmin F, Ideris A, Omar AR, et al. Molecular characterization of field strains of Mycoplasma gallisepticum in Malaysia through pMGA and pVPA genes sequencing. Cogent Biology 2018;4(1):1456738. https://doi.org/10.1080/23312025.2018.1456738
  » https://doi.org/10.1080/23312025.2018.1456738
• Yasmin F, Ideris A, Omar AR, et al. Molecular detection of Mycoplasma gallisepticum by real time PCR. Jurnal Veterinar Malaysia 2014;26(1):1-7. Available from: https://core.ac.uk/reader/42989750
  » https://core.ac.uk/reader/42989750
• Yasmin F. Development of a diagnostic real time PCR Assay for molecular detection and characterization of Mycoplasma gallisepticum [dissertation]. Selangor (MYS): Universiti Putra Malaysia; 2013.
• Zahraa F, Aini I, Mohd HB, et al. The prevalence of Mycoplasma gallisepticum infection in chickens from Peninsular Malaysia. Journal of Animal and Veterinary Advances 2011;10(14):1867-74. https://doi.org/10.3923/javaa.2011.1867.1874
  » https://doi.org/10.3923/javaa.2011.1867.1874

• FUNDING
  he study was supported by the Institute of Biosciences, Higher Institution Centre of Excellence (JBS HICoE) Grant No 6369101 from the Ministry of Higher Education (MOHE), Government of Malaysia.
• DATA AVAILABILITY STATEMENT
  Data will be available upon request.
• DISCLAIMER/PUBLISHER’S NOTE
  The published papers’ statements, opinions, and data are those of the individual author(s) and contributor(s). The editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions, or products referred to in the content.

Edited by

• Section Editor:
  Ramon Malheiros

Data availability

Data will be available upon request.

Publication Dates

• Publication in this collection
  16 Dec 2024
• Date of issue
  2024

History

• Received
  20 Feb 2024
• Accepted
  25 Aug 2024